>gb|AC007374.6|AC007374 Homo sapiens chromosome 14 clone RP11-325L17 map 14q31, complete sequence
          Length = 190565

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 56     cattccttgacccaccccaaaact 79
              ||||||||||||||||||||||||
Sbjct: 133361 cattccttgacccaccccaaaact 133338

>emb|AL121784.5|CNS01DSH Human chromosome 14 DNA sequence BAC R-305I3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 180523

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 56     cattccttgacccaccccaaaact 79
              ||||||||||||||||||||||||
Sbjct: 110880 cattccttgacccaccccaaaact 110857

>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 54     atcattccttgacccaccccaaaact 79
              |||| |||||||||||||||||||||
Sbjct: 111352 atcaatccttgacccaccccaaaact 111327

>gb|AC155641.8| Mus musculus 10 BAC RP24-121N1 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 195480

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 59     tccttgacccaccccaaaact 79
              |||||||||||||||||||||
Sbjct: 117723 tccttgacccaccccaaaact 117743

>emb|AL671867.8| Mouse DNA sequence from clone RP23-131J17 on chromosome 4, complete
             sequence
          Length = 202342

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 53    gatcattccttgacccacccc 73
             |||||||||||||||||||||
Sbjct: 85302 gatcattccttgacccacccc 85322

>gb|AY153760.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.8 gene, complete cds; nuclear
            gene for chloroplast product
          Length = 3098

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 87   caaaattggctaccgcaattttgg 110
            |||||||||||||| |||||||||
Sbjct: 2815 caaaattggctacctcaattttgg 2838

>gb|AY153759.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.2m gene, complete cds; nuclear
            gene for chloroplast product
          Length = 2922

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 87   caaaattggctaccgcaattttgg 110
            |||||||||||||| |||||||||
Sbjct: 2787 caaaattggctacctcaattttgg 2810

>gb|AY153758.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.2 gene, complete cds; nuclear
            gene for chloroplast product
          Length = 3064

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 87   caaaattggctaccgcaattttgg 110
            |||||||||||||| |||||||||
Sbjct: 2784 caaaattggctacctcaattttgg 2807

>gb|AC159746.5| Mus musculus 6 BAC RP23-437F11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 171039

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     ccttgacccaccccaaaact 79
              ||||||||||||||||||||
Sbjct: 141948 ccttgacccaccccaaaact 141929

>gb|AC107810.8| Mus musculus chromosome 1, clone RP23-68D4, complete sequence
          Length = 160167

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    tgacccaccccaaaactata 82
             ||||||||||||||||||||
Sbjct: 50763 tgacccaccccaaaactata 50782

>emb|AL163011.3|CNS01RI8 Human chromosome 14 DNA sequence BAC C-2324M15 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 100791

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ctggcaaatctcaaattatt 42
             ||||||||||||||||||||
Sbjct: 63746 ctggcaaatctcaaattatt 63765

>gb|AC117682.11| Mus musculus chromosome 1, clone RP23-436K7, complete sequence
          Length = 212395

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 58    ttccttgacccaccccaaa 76
             |||||||||||||||||||
Sbjct: 78010 ttccttgacccaccccaaa 78028

>gb|AC104616.5| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0079H13
              map E60284SA, complete sequence
          Length = 116863

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     aatctcaaattattacaat 47
              |||||||||||||||||||
Sbjct: 114927 aatctcaaattattacaat 114909

>gb|AC105932.6| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNBb0038H12 map E60284SA, complete sequence
          Length = 139190

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    aatctcaaattattacaat 47
             |||||||||||||||||||
Sbjct: 36571 aatctcaaattattacaat 36589

>ref|XM_720422.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05100)
           partial mRNA
          Length = 540

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 25  ggcaaatctcaaattatta 43
           |||||||||||||||||||
Sbjct: 327 ggcaaatctcaaattatta 309

>ref|XM_673718.1| Plasmodium berghei strain ANKA hydroxyacyl glutathione hydrolase
           (PB001635.02.0) partial mRNA
          Length = 771

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 25  ggcaaatctcaaattatta 43
           |||||||||||||||||||
Sbjct: 561 ggcaaatctcaaattatta 543

>emb|CR954192.2| Medicago truncatula chromosome 5 clone mth2-15h3, COMPLETE SEQUENCE
          Length = 118151

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 30    atctcaaattattacaatg 48
             |||||||||||||||||||
Sbjct: 59322 atctcaaattattacaatg 59340

>emb|AL161627.13| Human DNA sequence from clone RP11-287A8 on chromosome 9 Contains the
             3' end of the gene for CDw92 antigen (CDW92) (CTL1), a
             novel gene, the CSDUFD1 gene for cystatin and DUF19 domain
             containing 1, the 5' end of a novel gene, part of a
             pseudogene similar to KIAA1272, KIAA0884, Drosophila
             CG5521 and rat Tulip 1 and 2 proteins and a CpG island,
             complete sequence
          Length = 138752

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 57    attccttgacccaccccaa 75
             |||||||||||||||||||
Sbjct: 34616 attccttgacccaccccaa 34598

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 138    ttgtcgacgacttcgatga 156
              |||||||||||||||||||
Sbjct: 632359 ttgtcgacgacttcgatga 632341

>gb|AC126781.22| Medicago truncatula clone mth2-12m15, complete sequence
          Length = 116119

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 102    caattttggcttcagagag 120
              |||||||||||||||||||
Sbjct: 101715 caattttggcttcagagag 101697

>dbj|AK088880.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430029J22
           product:unclassifiable, full insert sequence
          Length = 3770

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 58  ttccttgacccaccccaaa 76
           |||||||||||||||||||
Sbjct: 750 ttccttgacccaccccaaa 732

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 29      aatctcaaattattacaat 47
               |||||||||||||||||||
Sbjct: 5887312 aatctcaaattattacaat 5887294

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 29       aatctcaaattattacaat 47
                |||||||||||||||||||
Sbjct: 10421961 aatctcaaattattacaat 10421943

>gb|AC084048.5| Homo sapiens BAC clone RP11-61G19 from 4, complete sequence
          Length = 131584

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 26    gcaaatctcaaattattac 44
             |||||||||||||||||||
Sbjct: 72466 gcaaatctcaaattattac 72448

>gb|AC091522.23| Mus musculus strain C57BL/6J chromosome 10 clone rp23-199g2, complete
              sequence
          Length = 214798

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    ttttggcttcagagagcgc 123
              |||||||||||||||||||
Sbjct: 195663 ttttggcttcagagagcgc 195645

>emb|BX248394.5| Zebrafish DNA sequence from clone CH211-205P19 in linkage group 12,
             complete sequence
          Length = 143099

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    ccttgacccaccccaaaac 78
             |||||||||||||||||||
Sbjct: 49417 ccttgacccaccccaaaac 49435

>dbj|AP005731.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0091D16
          Length = 174222

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     aatctcaaattattacaat 47
              |||||||||||||||||||
Sbjct: 122919 aatctcaaattattacaat 122901

>dbj|AP005163.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0053M06
          Length = 175416

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    aatctcaaattattacaat 47
             |||||||||||||||||||
Sbjct: 44552 aatctcaaattattacaat 44534

>gb|AC153569.4| Mus musculus 10 BAC RP23-225D5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 193135

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   ttttggcttcagagagcgc 123
             |||||||||||||||||||
Sbjct: 80893 ttttggcttcagagagcgc 80875

>dbj|AP003173.4| Homo sapiens genomic DNA, chromosome 11 clone:CTD-2579L12, complete
            sequence
          Length = 206769

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 101  gcaattttggcttcagaga 119
            |||||||||||||||||||
Sbjct: 6571 gcaattttggcttcagaga 6553

>dbj|AP002001.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-680E19, complete
              sequence
          Length = 149253

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 101    gcaattttggcttcagaga 119
              |||||||||||||||||||
Sbjct: 118080 gcaattttggcttcagaga 118062

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 29      aatctcaaattattacaat 47
               |||||||||||||||||||
Sbjct: 5888498 aatctcaaattattacaat 5888480


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,008,905
Number of Sequences: 3902068
Number of extensions: 1008905
Number of successful extensions: 69741
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69582
Number of HSP's gapped (non-prelim): 159
length of query: 161
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 139
effective length of database: 17,147,199,772
effective search space: 2383460768308
effective search space used: 2383460768308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)