ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags29f21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-12
2dbj|AP005745.2| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-12
3dbj|AK112084.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 5e-12
4gb|BT018293.1| Zea mays clone EL01T0205F02.c mRNA sequence 60 5e-06
5gb|AY109101.1| Zea mays PCO082934 mRNA sequence 60 5e-06
6gb|AC144772.2| Mus musculus BAC clone RP24-173G12 from chromosom... 46 0.073
7gb|AC112180.2| Homo sapiens chromosome 5 clone RP11-130F17, comp... 44 0.29
8gb|AC093295.2| Homo sapiens chromosome 5 clone RP11-535A15, comp... 44 0.29
9gb|AC161358.8| Mus musculus chromosome 18, clone wi1-1930A12, co... 42 1.1
10ref|XM_383851.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 42 1.1
11emb|AL662897.6| Human DNA sequence from clone RP11-309C8 on chro... 42 1.1
12emb|AL139009.14| Human DNA sequence from clone RP5-976H8 on chro... 42 1.1
13gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, com... 40 4.5
14gb|AY371697.2| Homo sapiens integrin, alpha 8 (ITGA8) gene, comp... 40 4.5
15gb|AC125466.4| Mus musculus BAC clone RP23-477O24 from chromosom... 40 4.5
16gb|AC124389.4| Mus musculus BAC clone RP24-429G21 from chromosom... 40 4.5
17gb|AC117238.3| Mus musculus BAC clone RP24-82N17 from 1, complet... 40 4.5
18gb|AC148765.24| Medicago truncatula clone mth2-34f9, complete se... 40 4.5
19gb|AC137552.11| Medicago truncatula clone mth2-9k5, complete seq... 40 4.5
20gb|AC133864.32| Medicago truncatula clone mth2-18d12, complete s... 40 4.5
21emb|AL590636.12| Human DNA sequence from clone RP11-50E19 on chr... 40 4.5
22emb|AL158040.14| Human DNA sequence from clone RP11-360G10 on ch... 40 4.5
23gb|AF506843.1| Papaya ringspot virus isolate VNW-48 coat protein... 40 4.5
24gb|AC104590.4| Homo sapiens chromosome 15, clone RP11-643M14, co... 40 4.5
25gb|AC090772.9| Homo sapiens chromosome 18, clone RP11-799B12, co... 40 4.5
26gb|AC018642.7| Homo sapiens chromosome 7 clone RP11-329I5, compl... 40 4.5
27gb|AC009554.14| Homo sapiens, clone RP11-16B9, complete sequence 40 4.5
28emb|BX511224.8| Zebrafish DNA sequence from clone CH211-113D14 i... 40 4.5
29gb|AC018698.5|AC018698 Homo sapiens BAC clone RP11-579C11 from 1... 40 4.5
30emb|BX005328.9| Zebrafish DNA sequence from clone DKEY-63D15 in ... 40 4.5
31gb|AC009362.8|AC009362 Homo sapiens chromosome 7 clone RP11-256C... 40 4.5
32gb|AC127366.4| Mus musculus BAC clone RP23-10E9 from 8, complete... 40 4.5
33emb|AL929382.9| Mouse DNA sequence from clone RP23-136C24 on chr... 40 4.5

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 74/84 (88%), Gaps = 1/84 (1%)
 Strand = Plus / Plus

                                                                           
Query: 256     gagtgcttcgcaatgagtttatcaacgtggatgataatgtcgtccgatatggggacgaac 315
               |||| ||| |||||||| ||||||||||||||||| || || ||  || |||||||||||
Sbjct: 2860938 gagtactttgcaatgagcttatcaacgtggatgatgatatcatca-atgtggggacgaac 2860996

                                       
Query: 316     tgcaggatgtggctgcagcatcca 339
               ||||||||| ||||||||||||||
Sbjct: 2860997 tgcaggatgaggctgcagcatcca 2861020



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                         
Query: 163     tcacttttaatgaatcaagcagatgttctataaacttacata 204
               |||| |||||||||||||| |||||||||||  |||||||||
Sbjct: 2860855 tcacatttaatgaatcaagtagatgttctattgacttacata 2860896



to top

>dbj|AP005745.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0017O03
          Length = 180651

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 74/84 (88%), Gaps = 1/84 (1%)
 Strand = Plus / Plus

                                                                         
Query: 256   gagtgcttcgcaatgagtttatcaacgtggatgataatgtcgtccgatatggggacgaac 315
             |||| ||| |||||||| ||||||||||||||||| || || ||  || |||||||||||
Sbjct: 51930 gagtactttgcaatgagcttatcaacgtggatgatgatatcatca-atgtggggacgaac 51988

                                     
Query: 316   tgcaggatgtggctgcagcatcca 339
             ||||||||| ||||||||||||||
Sbjct: 51989 tgcaggatgaggctgcagcatcca 52012



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 163   tcacttttaatgaatcaagcagatgttctataaacttacata 204
             |||| |||||||||||||| |||||||||||  |||||||||
Sbjct: 51847 tcacatttaatgaatcaagtagatgttctattgacttacata 51888



to top

>dbj|AK112084.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-A07, full
            insert sequence
          Length = 1615

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 74/84 (88%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                        
Query: 256  gagtgcttcgcaatgagtttatcaacgtggatgataatgtcgtccgatatggggacgaac 315
            |||| ||| |||||||| ||||||||||||||||| || || ||  || |||||||||||
Sbjct: 1214 gagtactttgcaatgagcttatcaacgtggatgatgatatcatca-atgtggggacgaac 1156

                                    
Query: 316  tgcaggatgtggctgcagcatcca 339
            ||||||||| ||||||||||||||
Sbjct: 1155 tgcaggatgaggctgcagcatcca 1132



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 163  tcacttttaatgaatcaagcagatgttctataaacttacata 204
            |||| |||||||||||||| |||||||||||  |||||||||
Sbjct: 1297 tcacatttaatgaatcaagtagatgttctattgacttacata 1256



to top

>gb|BT018293.1| Zea mays clone EL01T0205F02.c mRNA sequence
          Length = 1238

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 302 atatggggacgaactgcaggatgtggctgcagcatcca 339
           ||||| ||||||||||| ||||||||||||||||||||
Sbjct: 916 atatgaggacgaactgcgggatgtggctgcagcatcca 879



to top

>gb|AY109101.1| Zea mays PCO082934 mRNA sequence
          Length = 1538

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 302  atatggggacgaactgcaggatgtggctgcagcatcca 339
            ||||| ||||||||||| ||||||||||||||||||||
Sbjct: 1225 atatgaggacgaactgcgggatgtggctgcagcatcca 1188



to top

>gb|AC144772.2| Mus musculus BAC clone RP24-173G12 from chromosome 15, complete
             sequence
          Length = 160630

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 116   aaaatatcatctttcttccttcc 138
             |||||||||||||||||||||||
Sbjct: 72808 aaaatatcatctttcttccttcc 72830



to top

>gb|AC112180.2| Homo sapiens chromosome 5 clone RP11-130F17, complete sequence
          Length = 166720

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 43    aaaaaatacatacatctacagacataatgt 72
             ||||||||||||||||| |||| |||||||
Sbjct: 68821 aaaaaatacatacatcttcagaaataatgt 68792



to top

>gb|AC093295.2| Homo sapiens chromosome 5 clone RP11-535A15, complete sequence
          Length = 203831

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 43    aaaaaatacatacatctacagacataatgt 72
             ||||||||||||||||| |||| |||||||
Sbjct: 20581 aaaaaatacatacatcttcagaaataatgt 20610



to top

>gb|AC161358.8| Mus musculus chromosome 18, clone wi1-1930A12, complete sequence
          Length = 42218

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 124   atctttcttccttccatacaa 144
             |||||||||||||||||||||
Sbjct: 18853 atctttcttccttccatacaa 18833



to top

>ref|XM_383851.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03675.1)
            partial mRNA
          Length = 1590

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 204  acgaattccttttcttctttctgtt 228
            |||||||||||||||||| ||||||
Sbjct: 1322 acgaattccttttcttctctctgtt 1346



to top

>emb|AL662897.6| Human DNA sequence from clone RP11-309C8 on chromosome X, complete
            sequence
          Length = 84987

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 43   aaaaaatacatacatctacag 63
            |||||||||||||||||||||
Sbjct: 3266 aaaaaatacatacatctacag 3286



to top

>emb|AL139009.14| Human DNA sequence from clone RP5-976H8 on chromosome 10p14-15.3,
              complete sequence
          Length = 172657

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 46     aaatacatacatctacagaca 66
              |||||||||||||||||||||
Sbjct: 166507 aaatacatacatctacagaca 166527



to top

>gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, complete sequence
          Length = 222682

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   attccttttcttctttctgt 227
             ||||||||||||||||||||
Sbjct: 63929 attccttttcttctttctgt 63948



to top

>gb|AY371697.2| Homo sapiens integrin, alpha 8 (ITGA8) gene, complete cds
          Length = 206310

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     cacaaaaaatacatacatct 59
              ||||||||||||||||||||
Sbjct: 130323 cacaaaaaatacatacatct 130304



to top

>gb|AC125466.4| Mus musculus BAC clone RP23-477O24 from chromosome 9, complete sequence
          Length = 150128

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 209    ttccttttcttctttctgtt 228
              ||||||||||||||||||||
Sbjct: 139134 ttccttttcttctttctgtt 139153



to top

>gb|AC124389.4| Mus musculus BAC clone RP24-429G21 from chromosome 1, complete sequence
          Length = 183428

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   ttccttttcttctttctgtt 228
             ||||||||||||||||||||
Sbjct: 76875 ttccttttcttctttctgtt 76856



to top

>gb|AC117238.3| Mus musculus BAC clone RP24-82N17 from 1, complete sequence
          Length = 214280

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    ttccttttcttctttctgtt 228
              ||||||||||||||||||||
Sbjct: 200912 ttccttttcttctttctgtt 200893



to top

>gb|AC148765.24| Medicago truncatula clone mth2-34f9, complete sequence
          Length = 85199

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 122   tcatctttcttccttccatacaat 145
             |||||||||||||||||| |||||
Sbjct: 78821 tcatctttcttccttccaaacaat 78798



to top

>gb|AC137552.11| Medicago truncatula clone mth2-9k5, complete sequence
          Length = 122089

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 122   tcatctttcttccttccatacaat 145
             |||||||||||||||||| |||||
Sbjct: 13126 tcatctttcttccttccaaacaat 13103



to top

>gb|AC133864.32| Medicago truncatula clone mth2-18d12, complete sequence
          Length = 125734

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   ttttcttctttctgttgaag 232
             ||||||||||||||||||||
Sbjct: 96064 ttttcttctttctgttgaag 96083



to top

>emb|AL590636.12| Human DNA sequence from clone RP11-50E19 on chromosome 10 Contains the 3'
              end of the ITGA8 gene for integrin alpha 8, complete
              sequence
          Length = 141790

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 40     cacaaaaaatacatacatct 59
              ||||||||||||||||||||
Sbjct: 134336 cacaaaaaatacatacatct 134355



to top

>emb|AL158040.14| Human DNA sequence from clone RP11-360G10 on chromosome 10 Contains the
              5' end of the gene for KIAA0940 protein, a succinate
              dehydrogenase complex pseudogene, the 5' end of a novel
              gene (FLJ20445), a nucleolar protein family A member 2
              pseudogene 1 (NOLA2P1) and a CpG island, complete sequence
          Length = 213648

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 236    ttccatttacttgtcaagtc 255
              ||||||||||||||||||||
Sbjct: 189336 ttccatttacttgtcaagtc 189355



to top

>gb|AF506843.1| Papaya ringspot virus isolate VNW-48 coat protein (cp) gene,
           partial cds
          Length = 840

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 209 ttccttttcttctttctgtt 228
           ||||||||||||||||||||
Sbjct: 51  ttccttttcttctttctgtt 32



to top

>gb|AC104590.4| Homo sapiens chromosome 15, clone RP11-643M14, complete sequence
          Length = 191212

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   aatcaagcagatgttctata 194
             ||||||||||||||||||||
Sbjct: 92266 aatcaagcagatgttctata 92247



to top

>gb|AC090772.9| Homo sapiens chromosome 18, clone RP11-799B12, complete sequence
          Length = 189763

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   cctgctacagaaaatatcat 125
             ||||||||||||||||||||
Sbjct: 70110 cctgctacagaaaatatcat 70091



to top

>gb|AC018642.7| Homo sapiens chromosome 7 clone RP11-329I5, complete sequence
          Length = 194523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     aaaaatacatacatctacag 63
              ||||||||||||||||||||
Sbjct: 124946 aaaaatacatacatctacag 124965



to top

>gb|AC009554.14| Homo sapiens, clone RP11-16B9, complete sequence
          Length = 197639

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 175  aatcaagcagatgttctata 194
            ||||||||||||||||||||
Sbjct: 7461 aatcaagcagatgttctata 7480



to top

>emb|BX511224.8| Zebrafish DNA sequence from clone CH211-113D14 in linkage group 2,
              complete sequence
          Length = 186709

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 40     cacaaaaaatacatacatct 59
              ||||||||||||||||||||
Sbjct: 177998 cacaaaaaatacatacatct 178017



to top

>gb|AC018698.5|AC018698 Homo sapiens BAC clone RP11-579C11 from 12, complete sequence
          Length = 204713

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aattccttttcttctttctg 226
              ||||||||||||||||||||
Sbjct: 131034 aattccttttcttctttctg 131015



to top

>emb|BX005328.9| Zebrafish DNA sequence from clone DKEY-63D15 in linkage group 8,
             complete sequence
          Length = 272840

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 142   caatgactattaaggaacatgtca 165
             ||||||||||||| ||||||||||
Sbjct: 86512 caatgactattaatgaacatgtca 86489



to top

>gb|AC009362.8|AC009362 Homo sapiens chromosome 7 clone RP11-256C6, complete sequence
          Length = 160156

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   aaaaatacatacatctacag 63
            ||||||||||||||||||||
Sbjct: 4264 aaaaatacatacatctacag 4283



to top

>gb|AC127366.4| Mus musculus BAC clone RP23-10E9 from 8, complete sequence
          Length = 177375

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    attccttttcttctttctgt 227
              ||||||||||||||||||||
Sbjct: 108104 attccttttcttctttctgt 108123



to top

>emb|AL929382.9| Mouse DNA sequence from clone RP23-136C24 on chromosome X, complete
              sequence
          Length = 201060

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    ttccttttcttctttctgtt 228
              ||||||||||||||||||||
Sbjct: 122541 ttccttttcttctttctgtt 122522


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,145,902
Number of Sequences: 3902068
Number of extensions: 4145902
Number of successful extensions: 112962
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112856
Number of HSP's gapped (non-prelim): 103
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top