ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags28p05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC010557.1| Homo sapiens KIAA1442 protein, mRNA (cDNA clone I... 44 0.40
2gb|BC019106.2| Homo sapiens KIAA1442 protein, mRNA (cDNA clone I... 44 0.40
3gb|BC037555.1| Homo sapiens, Similar to early B-cell factor (olf... 44 0.40
4emb|AL035460.15|HS860F19 Human DNA sequence from clone RP5-860F1... 44 0.40
5ref|NM_001039168.1| Mus musculus DNA segment, Chr 11, Brigham & ... 44 0.40
6ref|NM_001039167.1| Mus musculus DNA segment, Chr 11, Brigham & ... 44 0.40
7ref|XM_938882.1| PREDICTED: Homo sapiens KIAA1442 protein (KIAA1... 44 0.40
8ref|XM_044921.6| PREDICTED: Homo sapiens KIAA1442 protein (KIAA1... 44 0.40
9dbj|AK079086.1| Mus musculus adult male diencephalon cDNA, RIKEN... 44 0.40
10emb|AL591075.11| Mouse DNA sequence from clone RP23-159O6 on chr... 44 0.40
11gb|BC054347.1| Homo sapiens KIAA1442 protein, mRNA (cDNA clone I... 44 0.40
12dbj|AB037863.1| Homo sapiens mRNA for KIAA1442 protein, partial cds 44 0.40
13gb|AY570945.1| Lemur catta microcephalin mRNA, partial cds 42 1.6
14emb|BX569690.1| Synechococcus sp. WH8102 complete genome; segmen... 42 1.6
15gb|AC134978.4| Homo sapiens chromosome 18, clone RP11-671C19, co... 42 1.6
16gb|AC115723.13| Mus musculus chromosome 5, clone RP23-17D18, com... 40 6.3
17gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 40 6.3
18emb|AL109627.18|HSJ733M16 Human DNA sequence from clone RP4-733M... 40 6.3
19gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 40 6.3
20emb|AL442164.1|NCB2J23 Neurospora crassa DNA linkage group I BAC... 40 6.3
21gb|AE005708.1| Caulobacter crescentus CB15 section 34 of 359 of ... 40 6.3
22gb|AC087894.15| Homo sapiens 12 BAC RP11-749H20 (Roswell Park Ca... 40 6.3
23gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.3
24gb|AC120381.13| Mus musculus chromosome 5, clone RP24-266G11, co... 40 6.3
25gb|AC153817.6| Mus musculus BAC RP23-11P24 (Roswell Park Cancer... 40 6.3
26gb|AC117376.3| Homo sapiens 12 BAC RP11-349K16 (Roswell Park Can... 40 6.3
27gb|AC006433.18|AC006433 Homo sapiens, clone RP11-6A1, complete s... 40 6.3
28gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 6.3

>gb|BC010557.1| Homo sapiens KIAA1442 protein, mRNA (cDNA clone IMAGE:4155057),
           with apparent retained intron
          Length = 1603

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 397 cagatgcagggccagggccatg 418
           ||||||||||||||||||||||
Sbjct: 831 cagatgcagggccagggccatg 852



to top

>gb|BC019106.2| Homo sapiens KIAA1442 protein, mRNA (cDNA clone IMAGE:5020670),
           partial cds
          Length = 1447

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 397 cagatgcagggccagggccatg 418
           ||||||||||||||||||||||
Sbjct: 639 cagatgcagggccagggccatg 660



to top

>gb|BC037555.1| Homo sapiens, Similar to early B-cell factor (olfactory neuronal
            transcription factor 1), clone IMAGE:4944280, mRNA
          Length = 2090

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 397  cagatgcagggccagggccatg 418
            ||||||||||||||||||||||
Sbjct: 1248 cagatgcagggccagggccatg 1269



to top

>emb|AL035460.15|HS860F19 Human DNA sequence from clone RP5-860F19 on chromosome 20p12.3-13
             Contains the gene for a novel protein (KIAA1442), the
             RPL19P1 gene for ribosomal protein L19 pseudogene 1, the
             CPX-1 gene for metallocarboxypeptidase, the C20orf141
             gene, a novel gene and four CpG islands, complete sequence
          Length = 135005

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 397   cagatgcagggccagggccatg 418
             ||||||||||||||||||||||
Sbjct: 74941 cagatgcagggccagggccatg 74962



to top

>ref|NM_001039168.1| Mus musculus DNA segment, Chr 11, Brigham & Women's Genetics 0517
            expressed (D11Bwg0517e), transcript variant 2, mRNA
          Length = 4401

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 407  gccagggccatgcccatgcctc 428
            ||||||||||||||||||||||
Sbjct: 1892 gccagggccatgcccatgcctc 1913



to top

>ref|NM_001039167.1| Mus musculus DNA segment, Chr 11, Brigham & Women's Genetics 0517
            expressed (D11Bwg0517e), transcript variant 1, mRNA
          Length = 4545

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 407  gccagggccatgcccatgcctc 428
            ||||||||||||||||||||||
Sbjct: 2036 gccagggccatgcccatgcctc 2057



to top

>ref|XM_938882.1| PREDICTED: Homo sapiens KIAA1442 protein (KIAA1442), mRNA
          Length = 3007

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 397  cagatgcagggccagggccatg 418
            ||||||||||||||||||||||
Sbjct: 2250 cagatgcagggccagggccatg 2271



to top

>ref|XM_044921.6| PREDICTED: Homo sapiens KIAA1442 protein (KIAA1442), mRNA
          Length = 3007

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 397  cagatgcagggccagggccatg 418
            ||||||||||||||||||||||
Sbjct: 2250 cagatgcagggccagggccatg 2271



to top

>dbj|AK079086.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330161I19 product:HEXARIBONUCLEOTIDE
            BINDING PROTEIN 3 (FRAGMENT) homolog [Mus musculus], full
            insert sequence
          Length = 3104

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 407  gccagggccatgcccatgcctc 428
            ||||||||||||||||||||||
Sbjct: 2037 gccagggccatgcccatgcctc 2058



to top

>emb|AL591075.11| Mouse DNA sequence from clone RP23-159O6 on chromosome 11, complete
             sequence
          Length = 159896

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   gccagggccatgcccatgcctc 428
             ||||||||||||||||||||||
Sbjct: 78063 gccagggccatgcccatgcctc 78042



to top

>gb|BC054347.1| Homo sapiens KIAA1442 protein, mRNA (cDNA clone IMAGE:5502800),
           complete cds
          Length = 1617

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 397 cagatgcagggccagggccatg 418
           ||||||||||||||||||||||
Sbjct: 802 cagatgcagggccagggccatg 823



to top

>dbj|AB037863.1| Homo sapiens mRNA for KIAA1442 protein, partial cds
          Length = 2782

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 397  cagatgcagggccagggccatg 418
            ||||||||||||||||||||||
Sbjct: 2026 cagatgcagggccagggccatg 2047



to top

>gb|AY570945.1| Lemur catta microcephalin mRNA, partial cds
          Length = 2480

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 306  gaacccagcagccgcgcgcga 326
            |||||||||||||||||||||
Sbjct: 2094 gaacccagcagccgcgcgcga 2074



to top

>emb|BX569690.1| Synechococcus sp. WH8102 complete genome; segment 2/7
          Length = 349652

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 396    gcagatgcagggccagggcca 416
              |||||||||||||||||||||
Sbjct: 225677 gcagatgcagggccagggcca 225697



to top

>gb|AC134978.4| Homo sapiens chromosome 18, clone RP11-671C19, complete sequence
          Length = 177630

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 403   cagggccagggccatgcccat 423
             |||||||||||||||||||||
Sbjct: 43212 cagggccagggccatgcccat 43192



to top

>gb|AC115723.13| Mus musculus chromosome 5, clone RP23-17D18, complete sequence
          Length = 206470

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    actgtttgctgttgctgtatgtgt 90
             ||||||||||||||||||| ||||
Sbjct: 17852 actgtttgctgttgctgtaggtgt 17829



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 295     cgagtacgaacgaacccagcagcc 318
               ||||| ||||||||||||||||||
Sbjct: 1520365 cgagtgcgaacgaacccagcagcc 1520388



to top

>emb|AL109627.18|HSJ733M16 Human DNA sequence from clone RP4-733M16 on chromosome 1p36.11-36.23
              Contains four novel genes, a novel gene (FLJ33962), a novel
              gene (MGC10731), the 3' end of a novel gene (KIAA1332), a
              metallothionein family pseudogene and three CpG islands,
              complete sequence
          Length = 120825

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    ccgtgacgctctctctttcc 133
              ||||||||||||||||||||
Sbjct: 109068 ccgtgacgctctctctttcc 109087



to top

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 397    cagatgcagggccagggcca 416
              ||||||||||||||||||||
Sbjct: 491487 cagatgcagggccagggcca 491506



to top

>emb|AL442164.1|NCB2J23 Neurospora crassa DNA linkage group I BAC clone B2J23
          Length = 65725

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 286   gtacgagtacgagtacgaacgaac 309
             ||||||||||||||| ||||||||
Sbjct: 15445 gtacgagtacgagtatgaacgaac 15422



to top

>gb|AE005708.1| Caulobacter crescentus CB15 section 34 of 359 of the complete genome
          Length = 12627

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 333  aaggcgatcagctcctcgcgacgg 356
            |||||||||||| |||||||||||
Sbjct: 1135 aaggcgatcagcgcctcgcgacgg 1158



to top

>gb|AC087894.15| Homo sapiens 12 BAC RP11-749H20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 169117

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 395    tgcagatgcagggccagggc 414
              ||||||||||||||||||||
Sbjct: 151456 tgcagatgcagggccagggc 151475



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 184     cacggggatttccatggcct 203
               ||||||||||||||||||||
Sbjct: 2912819 cacggggatttccatggcct 2912800



to top

>gb|AC120381.13| Mus musculus chromosome 5, clone RP24-266G11, complete sequence
          Length = 166871

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 67     actgtttgctgttgctgtatgtgt 90
              ||||||||||||||||||| ||||
Sbjct: 145630 actgtttgctgttgctgtaggtgt 145607



to top

>gb|AC153817.6| Mus musculus  BAC RP23-11P24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 247508

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 392    ccatgcagatgcagggccag 411
              ||||||||||||||||||||
Sbjct: 109332 ccatgcagatgcagggccag 109351



to top

>gb|AC117376.3| Homo sapiens 12 BAC RP11-349K16 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 177041

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 395    tgcagatgcagggccagggc 414
              ||||||||||||||||||||
Sbjct: 103050 tgcagatgcagggccagggc 103031



to top

>gb|AC006433.18|AC006433 Homo sapiens, clone RP11-6A1, complete sequence
          Length = 179563

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 407  gccagggccatgcccatgcc 426
            ||||||||||||||||||||
Sbjct: 1457 gccagggccatgcccatgcc 1438



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 394    atgcagatgcagggccagggccatgccc 421
              |||| |||||||||| ||||||||||||
Sbjct: 968340 atgccgatgcagggcaagggccatgccc 968313


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,312,059
Number of Sequences: 3902068
Number of extensions: 3312059
Number of successful extensions: 62889
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62678
Number of HSP's gapped (non-prelim): 211
length of query: 465
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 443
effective length of database: 17,147,199,772
effective search space: 7596209498996
effective search space used: 7596209498996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top