ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags29e11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC158684.7| Mus musculus 6 BAC RP23-332N21 (Roswell Park Canc... 44 0.24
2gb|AC161888.5| Mus musculus 6 BAC RP23-448G18 (Roswell Park Canc... 44 0.24
3gb|AC158679.8| Mus musculus 6 BAC RP23-345O17 (Roswell Park Canc... 44 0.24
4gb|AC155721.7| Mus musculus 6 BAC RP24-186O21 (Roswell Park Canc... 42 0.96
5gb|AC153908.2| Mus musculus 6 BAC RP23-190K19 (Roswell Park Canc... 42 0.96
6gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5... 40 3.8
7gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome... 40 3.8
8emb|AL355300.9| Human DNA sequence from clone RP11-810B23 on chr... 40 3.8
9dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.8
10gb|AF133128.1|AF133128 Watermelon spotted wilt virus L protein (... 40 3.8
11emb|CR753890.27| Zebrafish DNA sequence from clone CH211-207D8 i... 40 3.8
12emb|BX950865.11| Zebrafish DNA sequence from clone DKEYP-100E12 ... 40 3.8
13gb|AY863200.1| Watermelon silver mottle virus L protein (L) mRNA... 40 3.8

>gb|AC158684.7| Mus musculus 6 BAC RP23-332N21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 210307

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 141    tgtcctgatgctngtgaagaaacat 165
              |||||||||||| ||||||||||||
Sbjct: 200389 tgtcctgatgcttgtgaagaaacat 200413



to top

>gb|AC161888.5| Mus musculus 6 BAC RP23-448G18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 189867

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 141    tgtcctgatgctngtgaagaaacat 165
              |||||||||||| ||||||||||||
Sbjct: 139593 tgtcctgatgcttgtgaagaaacat 139617



to top

>gb|AC158679.8| Mus musculus 6 BAC RP23-345O17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 192748

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 141    tgtcctgatgctngtgaagaaacat 165
              |||||||||||| ||||||||||||
Sbjct: 176882 tgtcctgatgcttgtgaagaaacat 176858



to top

>gb|AC155721.7| Mus musculus 6 BAC RP24-186O21 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 180652

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 196   aaatggttagcaacaaaataaaagt 220
             ||||| |||||||||||||||||||
Sbjct: 42018 aaatgtttagcaacaaaataaaagt 41994



to top

>gb|AC153908.2| Mus musculus 6 BAC RP23-190K19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 201588

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 196   aaatggttagcaacaaaataaaagt 220
             ||||| |||||||||||||||||||
Sbjct: 97982 aaatgtttagcaacaaaataaaagt 97958



to top

>gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5 of 7 of the complete
              sequence
          Length = 252394

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      aatataacacatatgaatgt 24
              ||||||||||||||||||||
Sbjct: 161083 aatataacacatatgaatgt 161064



to top

>gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0508G08,
             complete sequence
          Length = 141383

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 102   tccgagaactagatccattgaactatac 129
             ||||| || |||||||||||||||||||
Sbjct: 24431 tccgaaaaatagatccattgaactatac 24404



to top

>emb|AL355300.9| Human DNA sequence from clone RP11-810B23 on chromosome 10 Contains a
             novel gene, complete sequence
          Length = 141456

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     aatataacacatatgaatgt 24
             ||||||||||||||||||||
Sbjct: 46950 aatataacacatatgaatgt 46969



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 102      tccgagaactagatccattgaactatac 129
                ||||| || |||||||||||||||||||
Sbjct: 12863885 tccgaaaaatagatccattgaactatac 12863858



to top

>gb|AF133128.1|AF133128 Watermelon spotted wilt virus L protein (L) gene, complete cds
          Length = 8917

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 204  agcaacaaaataaaagtaatctaa 227
            |||||||||||||||||| |||||
Sbjct: 8907 agcaacaaaataaaagtattctaa 8884



to top

>emb|CR753890.27| Zebrafish DNA sequence from clone CH211-207D8 in linkage group 9,
             complete sequence
          Length = 201771

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   cattgttatacaacaaaatg 200
             ||||||||||||||||||||
Sbjct: 53749 cattgttatacaacaaaatg 53730



to top

>emb|BX950865.11| Zebrafish DNA sequence from clone DKEYP-100E12 in linkage group 6,
             complete sequence
          Length = 162517

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 117   cattgaactatacttcttcttctt 140
             ||||||||||| ||||||||||||
Sbjct: 68585 cattgaactattcttcttcttctt 68608



to top

>gb|AY863200.1| Watermelon silver mottle virus L protein (L) mRNA, complete cds
          Length = 8917

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 204  agcaacaaaataaaagtaatctaa 227
            |||||||||||||||||| |||||
Sbjct: 8907 agcaacaaaataaaagtattctaa 8884


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,523,867
Number of Sequences: 3902068
Number of extensions: 3523867
Number of successful extensions: 67327
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67307
Number of HSP's gapped (non-prelim): 20
length of query: 291
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 269
effective length of database: 17,147,199,772
effective search space: 4612596738668
effective search space used: 4612596738668
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top