| Clone Name | rbags28p01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC127593.4| Mus musculus BAC clone RP23-390G15 from chromosome 10, complete sequence Length = 214856 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 325 tgagcaatgaactcaagcaga 345 ||||||||||||||||||||| Sbjct: 60214 tgagcaatgaactcaagcaga 60194
>gb|AC133078.3| Mus musculus BAC clone RP24-444O21 from chromosome 10, complete sequence Length = 141420 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 325 tgagcaatgaactcaagcaga 345 ||||||||||||||||||||| Sbjct: 7583 tgagcaatgaactcaagcaga 7603
>gb|AC117527.2| Homo sapiens chromosome 5 clone RP11-1A7, complete sequence Length = 167042 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 265 gaagagggcaaattatcaaat 285 ||||||||||||||||||||| Sbjct: 110855 gaagagggcaaattatcaaat 110875
>gb|AC012315.5|AC012315 Homo sapiens chromosome 5 clone CTD-2122K7, complete sequence Length = 170216 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 265 gaagagggcaaattatcaaat 285 ||||||||||||||||||||| Sbjct: 72387 gaagagggcaaattatcaaat 72407
>emb|AJ234700.1|HVU234700 Hordeum vulgare genomic DNA fragment; clone MWG0985 Length = 392 Score = 42.1 bits (21), Expect = 1.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Plus Query: 168 gggattgaatgatttgtcccactttacaaagggttggatgatttg 212 ||||||| | ||||||||||| |||| || ||||||||||||||| Sbjct: 18 gggattggaggatttgtcccattttataa-gggttggatgatttg 61
>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome Length = 1827111 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 cctacaaagcatagtagtgc 48 |||||||||||||||||||| Sbjct: 1422349 cctacaaagcatagtagtgc 1422368
>gb|AC162370.4| Mus musculus chromosome 7, clone RP23-32F4, complete sequence Length = 225308 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 gtgggcaaaagatccaattt 316 |||||||||||||||||||| Sbjct: 62713 gtgggcaaaagatccaattt 62694
>emb|AL513327.34| Human DNA sequence from clone RP11-415J8 on chromosome 1 Contains the gene for a novel protein (FLJ35476), the gene for a novel protein similar to ABO family protein, two novel genes, the PHC2 gene for polyhomeotic-like 2 (Drosophila) and two CpG islands, complete sequence Length = 188665 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 aaagtgggcaaaagatccaa 313 |||||||||||||||||||| Sbjct: 12502 aaagtgggcaaaagatccaa 12521
>emb|AL646046.8| Mouse DNA sequence from clone RP23-101M12 on chromosome 11, complete sequence Length = 214665 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 265 gaagagggcaaattatcaaattag 288 ||||||||||||| |||||||||| Sbjct: 125524 gaagagggcaaatcatcaaattag 125501
>emb|BX927377.5| Zebrafish DNA sequence from clone DKEY-5I22 in linkage group 2, complete sequence Length = 164652 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 agggggattgaatgatttgt 184 |||||||||||||||||||| Sbjct: 126119 agggggattgaatgatttgt 126138
>gb|AC097376.3| Homo sapiens BAC clone RP11-83A24 from 4, complete sequence Length = 145395 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 aaagtgggcaaaagatccaa 313 |||||||||||||||||||| Sbjct: 119032 aaagtgggcaaaagatccaa 119013
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 caaggaaacaaaatgacgat 154 |||||||||||||||||||| Sbjct: 3792270 caaggaaacaaaatgacgat 3792251
>emb|AL663052.8| Mouse DNA sequence from clone RP23-202N14 on chromosome X, complete sequence Length = 202972 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 284 attaggaggtaaagtgggcaaaag 307 ||||||||||||||| |||||||| Sbjct: 169076 attaggaggtaaagttggcaaaag 169053 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,400,463 Number of Sequences: 3902068 Number of extensions: 3400463 Number of successful extensions: 59010 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 58970 Number of HSP's gapped (non-prelim): 40 length of query: 416 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 394 effective length of database: 17,147,199,772 effective search space: 6755996710168 effective search space used: 6755996710168 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)