>gb|AC127593.4| Mus musculus BAC clone RP23-390G15 from chromosome 10, complete
             sequence
          Length = 214856

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 325   tgagcaatgaactcaagcaga 345
             |||||||||||||||||||||
Sbjct: 60214 tgagcaatgaactcaagcaga 60194

>gb|AC133078.3| Mus musculus BAC clone RP24-444O21 from chromosome 10, complete
            sequence
          Length = 141420

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 325  tgagcaatgaactcaagcaga 345
            |||||||||||||||||||||
Sbjct: 7583 tgagcaatgaactcaagcaga 7603

>gb|AC117527.2| Homo sapiens chromosome 5 clone RP11-1A7, complete sequence
          Length = 167042

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 265    gaagagggcaaattatcaaat 285
              |||||||||||||||||||||
Sbjct: 110855 gaagagggcaaattatcaaat 110875

>gb|AC012315.5|AC012315 Homo sapiens chromosome 5 clone CTD-2122K7, complete sequence
          Length = 170216

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 265   gaagagggcaaattatcaaat 285
             |||||||||||||||||||||
Sbjct: 72387 gaagagggcaaattatcaaat 72407

>emb|AJ234700.1|HVU234700 Hordeum vulgare genomic DNA fragment; clone MWG0985
          Length = 392

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 40/45 (88%), Gaps = 1/45 (2%)
 Strand = Plus / Plus

                                                        
Query: 168 gggattgaatgatttgtcccactttacaaagggttggatgatttg 212
           ||||||| | ||||||||||| |||| || |||||||||||||||
Sbjct: 18  gggattggaggatttgtcccattttataa-gggttggatgatttg 61

>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome
          Length = 1827111

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 29      cctacaaagcatagtagtgc 48
               ||||||||||||||||||||
Sbjct: 1422349 cctacaaagcatagtagtgc 1422368

>gb|AC162370.4| Mus musculus chromosome 7, clone RP23-32F4, complete sequence
          Length = 225308

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   gtgggcaaaagatccaattt 316
             ||||||||||||||||||||
Sbjct: 62713 gtgggcaaaagatccaattt 62694

>emb|AL513327.34| Human DNA sequence from clone RP11-415J8 on chromosome 1 Contains the
             gene for a novel protein (FLJ35476), the gene for a novel
             protein similar to ABO family protein, two novel genes,
             the PHC2 gene for polyhomeotic-like 2 (Drosophila) and two
             CpG islands, complete sequence
          Length = 188665

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   aaagtgggcaaaagatccaa 313
             ||||||||||||||||||||
Sbjct: 12502 aaagtgggcaaaagatccaa 12521

>emb|AL646046.8| Mouse DNA sequence from clone RP23-101M12 on chromosome 11, complete
              sequence
          Length = 214665

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 265    gaagagggcaaattatcaaattag 288
              ||||||||||||| ||||||||||
Sbjct: 125524 gaagagggcaaatcatcaaattag 125501

>emb|BX927377.5| Zebrafish DNA sequence from clone DKEY-5I22 in linkage group 2, complete
              sequence
          Length = 164652

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    agggggattgaatgatttgt 184
              ||||||||||||||||||||
Sbjct: 126119 agggggattgaatgatttgt 126138

>gb|AC097376.3| Homo sapiens BAC clone RP11-83A24 from 4, complete sequence
          Length = 145395

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 294    aaagtgggcaaaagatccaa 313
              ||||||||||||||||||||
Sbjct: 119032 aaagtgggcaaaagatccaa 119013

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 135     caaggaaacaaaatgacgat 154
               ||||||||||||||||||||
Sbjct: 3792270 caaggaaacaaaatgacgat 3792251

>emb|AL663052.8| Mouse DNA sequence from clone RP23-202N14 on chromosome X, complete
              sequence
          Length = 202972

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 284    attaggaggtaaagtgggcaaaag 307
              ||||||||||||||| ||||||||
Sbjct: 169076 attaggaggtaaagttggcaaaag 169053


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,400,463
Number of Sequences: 3902068
Number of extensions: 3400463
Number of successful extensions: 59010
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 58970
Number of HSP's gapped (non-prelim): 40
length of query: 416
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 394
effective length of database: 17,147,199,772
effective search space: 6755996710168
effective search space used: 6755996710168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)