ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags29d12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC125315.4| Mus musculus BAC clone RP24-370B21 from chromosom... 40 1.2
2gb|AC122312.3| Mus musculus BAC clone RP23-298K16 from 19, compl... 40 1.2
3gb|AC008280.4| Homo sapiens BAC clone RP11-477N3 from 2, complet... 40 1.2
4gb|AC116839.8| Mus musculus chromosome 8, clone RP24-390L13, com... 38 4.7
5ref|XM_958855.1| Neurospora crassa OR74A hypothetical protein (N... 38 4.7
6ref|XM_329979.1| Neurospora crassa OR74A hypothetical protein (N... 38 4.7
7emb|CR354584.8| Zebrafish DNA sequence from clone DKEY-7B6 in li... 38 4.7
8gb|AC126242.3| Mus musculus BAC clone RP24-249E21 from chromosom... 38 4.7
9ref|XM_719152.1| Plasmodium yoelii yoelii str. 17XNL NIMA-relate... 38 4.7
10ref|XM_721087.1| Plasmodium yoelii yoelii str. 17XNL protein pot... 38 4.7
11ref|XM_665670.1| Plasmodium berghei strain ANKA hypothetical pro... 38 4.7
12emb|AL513283.9| Human DNA sequence from clone RP11-95P13 on chro... 38 4.7
13emb|AL390962.11| Human DNA sequence from clone RP11-84G24 on chr... 38 4.7
14emb|AL645982.26| Mouse DNA sequence from clone DN-452A22 on chro... 38 4.7
15emb|BX511062.12| Zebrafish DNA sequence from clone CH211-266M11 ... 38 4.7
16gb|AC096739.3| Homo sapiens BAC clone RP11-213G21 from 4, comple... 38 4.7
17gb|AC018923.21| Homo sapiens 12 BAC RP11-559C10 (Roswell Park Ca... 38 4.7
18gb|AC106893.3| Homo sapiens BAC clone RP11-55P14 from 4, complet... 38 4.7
19gb|AC153568.5| Mus musculus 10 BAC RP23-66K22 (Roswell Park Canc... 38 4.7
20gb|AC158237.2| Mus musculus BAC clone RP23-142I8 from chromosome... 38 4.7
21gb|AC145869.2| Pan troglodytes BAC clone RP43-39F14 from chromos... 38 4.7
22gb|AC147719.1| Gallus gallus BAC clone CH261-22J12 from chromoso... 38 4.7
23emb|CR385047.19| Zebrafish DNA sequence from clone DKEY-221N16 i... 38 4.7
24gb|AC092856.26| Mus musculus strain C57BL/6J chromosome 10 clone... 38 4.7
25emb|AL645807.4| Mouse DNA sequence from clone CT7-337H6 on chrom... 38 4.7

>gb|AC125315.4| Mus musculus BAC clone RP24-370B21 from chromosome 19, complete
             sequence
          Length = 155192

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    cttatgaaatgacagaatta 73
             ||||||||||||||||||||
Sbjct: 99840 cttatgaaatgacagaatta 99859



to top

>gb|AC122312.3| Mus musculus BAC clone RP23-298K16 from 19, complete sequence
          Length = 206657

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    aaatgacagaattaagtaat 79
             ||||||||||||||||||||
Sbjct: 61707 aaatgacagaattaagtaat 61688



to top

>gb|AC008280.4| Homo sapiens BAC clone RP11-477N3 from 2, complete sequence
          Length = 180595

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 46     caatgaaacttatgaaatga 65
              ||||||||||||||||||||
Sbjct: 154454 caatgaaacttatgaaatga 154435



to top

>gb|AC116839.8| Mus musculus chromosome 8, clone RP24-390L13, complete sequence
          Length = 142874

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 86    aaatggcagatattttaca 104
             |||||||||||||||||||
Sbjct: 29173 aaatggcagatattttaca 29155



to top

>ref|XM_958855.1| Neurospora crassa OR74A hypothetical protein (NCU02792.1) partial
           mRNA
          Length = 156

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 21  agaacagcatttcagagtc 39
           |||||||||||||||||||
Sbjct: 106 agaacagcatttcagagtc 124



to top

>ref|XM_329979.1| Neurospora crassa OR74A hypothetical protein (NCU02792.1) partial
           mRNA
          Length = 156

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 21  agaacagcatttcagagtc 39
           |||||||||||||||||||
Sbjct: 106 agaacagcatttcagagtc 124



to top

>emb|CR354584.8| Zebrafish DNA sequence from clone DKEY-7B6 in linkage group 12, complete
              sequence
          Length = 218091

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     acagcatttcagagtctgt 42
              |||||||||||||||||||
Sbjct: 106603 acagcatttcagagtctgt 106621



to top

>gb|AC126242.3| Mus musculus BAC clone RP24-249E21 from chromosome 10, complete
             sequence
          Length = 177581

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    ctgtacacaatgaaactta 57
             |||||||||||||||||||
Sbjct: 52103 ctgtacacaatgaaactta 52121



to top

>ref|XM_719152.1| Plasmodium yoelii yoelii str. 17XNL NIMA-related protein kinase
           (PY04005) partial mRNA
          Length = 1506

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 65  acagaattaagtaatacaa 83
           |||||||||||||||||||
Sbjct: 970 acagaattaagtaatacaa 988



to top

>ref|XM_721087.1| Plasmodium yoelii yoelii str. 17XNL protein potential
           transcriptional repressor Not4hp (PY05684) partial mRNA
          Length = 2000

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 65  acagaattaagtaatacaa 83
           |||||||||||||||||||
Sbjct: 132 acagaattaagtaatacaa 150



to top

>ref|XM_665670.1| Plasmodium berghei strain ANKA hypothetical protein (PB300069.00.0)
           partial mRNA
          Length = 825

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 65  acagaattaagtaatacaa 83
           |||||||||||||||||||
Sbjct: 364 acagaattaagtaatacaa 382



to top

>emb|AL513283.9| Human DNA sequence from clone RP11-95P13 on chromosome 1, complete
            sequence
          Length = 99591

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 61   aatgacagaattaagtaat 79
            |||||||||||||||||||
Sbjct: 6277 aatgacagaattaagtaat 6259



to top

>emb|AL390962.11| Human DNA sequence from clone RP11-84G24 on chromosome 9 Contains the
             5' end of a novel gene, complete sequence
          Length = 169670

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 47    aatgaaacttatgaaatgacaga 69
             ||||||| |||||||||||||||
Sbjct: 10031 aatgaaaattatgaaatgacaga 10009



to top

>emb|AL645982.26| Mouse DNA sequence from clone DN-452A22 on chromosome 3 Contains the 5'
             end of the Fgf2 gene for fibroblast growth factor 2, a
             novel gene (A930011G24RIK), a mitochondrial ribosomal
             protein S33 (Mrps33) pseudogene, a novel gene (gene model
             1805 (NCBI) (Gm1805)), the Cetn4 gene for centrin 4, a
             novel gene, the 5' end of the Il21 gene for interleukin 21
             and a CpG island, complete sequence
          Length = 133023

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    aatgaaacttatgaaatga 65
             |||||||||||||||||||
Sbjct: 19903 aatgaaacttatgaaatga 19921



to top

>emb|BX511062.12| Zebrafish DNA sequence from clone CH211-266M11 in linkage group 17,
             complete sequence
          Length = 131970

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    agaacagcatttcagagtc 39
             |||||||||||||||||||
Sbjct: 84073 agaacagcatttcagagtc 84091



to top

>gb|AC096739.3| Homo sapiens BAC clone RP11-213G21 from 4, complete sequence
          Length = 96482

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 87  aatggcagatattttacag 105
           |||||||||||||||||||
Sbjct: 791 aatggcagatattttacag 809



to top

>gb|AC018923.21| Homo sapiens 12 BAC RP11-559C10 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 152802

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 15    taactgagaacagcatttcagag 37
             ||||||| |||||||||||||||
Sbjct: 15225 taactgataacagcatttcagag 15203



to top

>gb|AC106893.3| Homo sapiens BAC clone RP11-55P14 from 4, complete sequence
          Length = 48666

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 87    aatggcagatattttacag 105
             |||||||||||||||||||
Sbjct: 47457 aatggcagatattttacag 47475



to top

>gb|AC153568.5| Mus musculus 10 BAC RP23-66K22 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 186215

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 39   ctgtacacaatgaaactta 57
            |||||||||||||||||||
Sbjct: 3608 ctgtacacaatgaaactta 3590



to top

>gb|AC158237.2| Mus musculus BAC clone RP23-142I8 from chromosome 9, complete sequence
          Length = 179606

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    acaatgaaacttatgaaat 63
             |||||||||||||||||||
Sbjct: 97428 acaatgaaacttatgaaat 97410



to top

>gb|AC145869.2| Pan troglodytes BAC clone RP43-39F14 from chromosome 7, complete
             sequence
          Length = 201977

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 42    tacacaatgaaacttatgaaatg 64
             |||||||||||| ||||||||||
Sbjct: 96720 tacacaatgaaatttatgaaatg 96698



to top

>gb|AC147719.1| Gallus gallus BAC clone CH261-22J12 from chromosome unknown, complete
             sequence
          Length = 192198

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 41    gtacacaatgaaacttatgaaat 63
             ||||||||||||| |||||||||
Sbjct: 26084 gtacacaatgaaatttatgaaat 26106



to top

>emb|CR385047.19| Zebrafish DNA sequence from clone DKEY-221N16 in linkage group 18,
              complete sequence
          Length = 193827

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     aatgaaacttatgaaatga 65
              |||||||||||||||||||
Sbjct: 144184 aatgaaacttatgaaatga 144202



to top

>gb|AC092856.26| Mus musculus strain C57BL/6J chromosome 10 clone rp23-7p15, complete
              sequence
          Length = 221799

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 39     ctgtacacaatgaaactta 57
              |||||||||||||||||||
Sbjct: 150844 ctgtacacaatgaaactta 150826



to top

>emb|AL645807.4| Mouse DNA sequence from clone CT7-337H6 on chromosome 3, complete
              sequence
          Length = 201500

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     aatgaaacttatgaaatga 65
              |||||||||||||||||||
Sbjct: 138419 aatgaaacttatgaaatga 138437


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,225,125
Number of Sequences: 3902068
Number of extensions: 1225125
Number of successful extensions: 90779
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90733
Number of HSP's gapped (non-prelim): 46
length of query: 105
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 84
effective length of database: 17,151,101,840
effective search space: 1440692554560
effective search space used: 1440692554560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top