| Clone Name | rbags29a13 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, co... | 38 | 7.8 |
|---|
>gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, complete sequence Length = 206302 Score = 38.2 bits (19), Expect = 7.8 Identities = 21/22 (95%) Strand = Plus / Minus Query: 32 caggcatntgacaggcatcctc 53 ||||||| |||||||||||||| Sbjct: 28844 caggcatctgacaggcatcctc 28823 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 554,312 Number of Sequences: 3902068 Number of extensions: 554312 Number of successful extensions: 29824 Number of sequences better than 10.0: 1 Number of HSP's better than 10.0 without gapping: 1 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 29823 Number of HSP's gapped (non-prelim): 1 length of query: 161 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 139 effective length of database: 17,147,199,772 effective search space: 2383460768308 effective search space used: 2383460768308 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)