ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags28j19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kin... 287 1e-74
2ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative... 194 1e-46
3dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clon... 194 1e-46
4gb|AY103833.1| Zea mays PCO135636 mRNA sequence 174 1e-40
5gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphat... 143 4e-31
6gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno... 121 2e-24
7dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
8gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 121 2e-24
9gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I ... 101 1e-18
10gb|AY104578.1| Zea mays PCO113042 mRNA sequence 101 1e-18
11ref|XM_478187.1| Oryza sativa (japonica cultivar-group), mRNA 100 6e-18
12gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside... 100 6e-18
13dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphat... 100 6e-18
14dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 6e-18
15dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate ... 88 2e-14
16ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ... 84 3e-13
17ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ... 84 3e-13
18gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence 84 3e-13
19emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleo... 84 3e-13
20gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA... 80 5e-12
21ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosp... 78 2e-11
22gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase... 78 2e-11
23dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
24dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
25dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
26gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside ... 76 8e-11
27ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosph... 70 5e-09
28emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cos... 70 5e-09
29emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosm... 70 5e-09
30dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate ... 70 5e-09
31gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kina... 68 2e-08
32gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate ki... 66 8e-08
33dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886 62 1e-06
34dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102 62 1e-06
35ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21 n... 60 5e-06
36dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 5e-06
37ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (... 58 2e-05
38gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndp... 58 2e-05
39ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus simila... 58 2e-05
40gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, c... 58 2e-05
41emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segmen... 56 8e-05
42gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, c... 56 8e-05
43gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase m... 56 8e-05
44gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphat... 54 3e-04
45ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 54 3e-04
46gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate ki... 54 3e-04
47emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphos... 52 0.001
48gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase ... 52 0.001
49dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds 52 0.001
50ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM027... 50 0.005
51dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside... 50 0.005
52gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 48 0.019
53emb|BX072516.1|CNS09S48 Single read from an extremity of a full-... 48 0.019
54emb|BX072515.1|CNS09S47 Single read from an extremity of a full-... 48 0.019
55emb|BX063953.1|CNS09LID Single read from an extremity of a full-... 48 0.019
56emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-... 48 0.019
57emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-... 48 0.019
58emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-... 48 0.019
59emb|BX048701.1|CNS099QP Single read from an extremity of a full-... 48 0.019
60emb|BX044675.1|CNS096MV Single read from an extremity of a full-... 48 0.019
61emb|BX039425.1|CNS092L1 Single read from an extremity of a full-... 48 0.019
62emb|BX038906.1|CNS0926M Single read from an extremity of a full-... 48 0.019
63emb|BX038905.1|CNS0926L Single read from an extremity of a full-... 48 0.019
64emb|BX038259.1|CNS091ON Single read from an extremity of a full-... 48 0.019
65emb|BX038258.1|CNS091OM Single read from an extremity of a full-... 48 0.019
66emb|BX038116.1|CNS091KO Single read from an extremity of a full-... 48 0.019
67emb|BX038115.1|CNS091KN Single read from an extremity of a full-... 48 0.019
68emb|BX037581.1|CNS0915T Single read from an extremity of a full-... 48 0.019
69emb|BX037580.1|CNS0915S Single read from an extremity of a full-... 48 0.019
70emb|BX036658.1|CNS090G6 Single read from an extremity of a full-... 48 0.019
71emb|BX032742.1|CNS08XFE Single read from an extremity of a full-... 48 0.019
72emb|BX031659.1|CNS08WLB Single read from an extremity of a full-... 48 0.019
73emb|BX031658.1|CNS08WLA Single read from an extremity of a full-... 48 0.019
74emb|BX025663.1|CNS08RYR Single read from an extremity of a full-... 48 0.019
75emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-... 48 0.019
76emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-... 48 0.019
77emb|BX024508.1|CNS08R2O Single read from an extremity of a full-... 48 0.019
78emb|BX024507.1|CNS08R2N Single read from an extremity of a full-... 48 0.019
79emb|BX023654.1|CNS08QEY Single read from an extremity of a full-... 48 0.019
80emb|BX022916.1|CNS08PUG Single read from an extremity of a full-... 48 0.019
81emb|BX022915.1|CNS08PUF Single read from an extremity of a full-... 48 0.019
82emb|BX021481.1|CNS08OQL Single read from an extremity of a full-... 48 0.019
83emb|BX021480.1|CNS08OQK Single read from an extremity of a full-... 48 0.019
84emb|BX021303.1|CNS08OLN Single read from an extremity of a full-... 48 0.019
85emb|BX021302.1|CNS08OLM Single read from an extremity of a full-... 48 0.019
86emb|BX021192.1|CNS08OIK Single read from an extremity of a full-... 48 0.019
87emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-... 48 0.019
88emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-... 48 0.019
89emb|BX018153.1|CNS08M65 Single read from an extremity of a full-... 48 0.019
90emb|BX018054.1|CNS08M3E Single read from an extremity of a full-... 48 0.019
91emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-... 48 0.019
92emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-... 48 0.019
93emb|BX017207.1|CNS08LFV Single read from an extremity of a full-... 48 0.019
94emb|BX017206.1|CNS08LFU Single read from an extremity of a full-... 48 0.019
95emb|BX016645.1|CNS08L09 Single read from an extremity of a full-... 48 0.019
96emb|BX014282.1|CNS08J6M Single read from an extremity of a full-... 48 0.019
97emb|BX013424.1|CNS08IIS Single read from an extremity of a full-... 48 0.019
98emb|BX009576.1|CNS08FJW Single read from an extremity of a full-... 48 0.019
99emb|BX009575.1|CNS08FJV Single read from an extremity of a full-... 48 0.019
100emb|BX009569.1|CNS08FJP Single read from an extremity of a full-... 48 0.019
101emb|BX009487.1|CNS08FHF Single read from an extremity of a full-... 48 0.019
102emb|BX007945.1|CNS08EAL Single read from an extremity of a full-... 48 0.019
103emb|BX007944.1|CNS08EAK Single read from an extremity of a full-... 48 0.019
104emb|BX006734.1|CNS08DCY Single read from an extremity of a full-... 48 0.019
105emb|BX006733.1|CNS08DCX Single read from an extremity of a full-... 48 0.019
106emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-... 48 0.019
107ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253 ... 48 0.019
108ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucle... 46 0.074
109gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence 46 0.074
110emb|BX025692.1|CNS08RZK Single read from an extremity of a full-... 46 0.074
111emb|X69376.1|ATNDK13 A.thaliana gene for nucleoside diphosphate ... 46 0.074
112emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate ki... 46 0.074
113emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, ... 46 0.074
114emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, B... 46 0.074
115gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 46 0.074
116gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, comple... 46 0.074
117dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside dipho... 46 0.074
118gb|AF370529.1|AF370529 Arabidopsis thaliana Unknown protein mRNA... 46 0.074
119emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Co... 46 0.074
120emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Co... 46 0.074
121gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase m... 46 0.074
122dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside d... 46 0.074
123emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 46 0.074
124gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphos... 46 0.074
125gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphospha... 46 0.074
126dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds 46 0.074
127gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic c... 44 0.29
128gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expr... 44 0.29
129gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic c... 44 0.29
130gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic c... 44 0.29
131gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic c... 44 0.29
132gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expr... 44 0.29
133ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein ex... 44 0.29
134ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphospha... 44 0.29
135ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical... 44 0.29
136ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical... 44 0.29
137emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblas... 44 0.29
138emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal bra... 44 0.29
139dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE20223... 44 0.29
140emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblas... 44 0.29
141emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblas... 44 0.29
142emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal bra... 44 0.29
143gb|AF295650.1| Beta vulgaris nucleotide diphosphate kinase (ndk)... 44 0.29
144gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic c... 44 0.29
145dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diph... 44 0.29
146dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside d... 44 0.29
147gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replicati... 44 0.29
148gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002.... 44 0.29
149gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001.... 44 0.29
150gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000.... 44 0.29
151gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999.... 44 0.29
152gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998.... 44 0.29
153gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997.... 44 0.29
154dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside d... 44 0.29
155dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diph... 44 0.29
156dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside d... 44 0.29
157dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside d... 44 0.29
158gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 44 0.29
159gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA cl... 44 0.29
160gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expr... 44 0.29
161emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1 44 0.29
162emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1 44 0.29
163emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1 44 0.29
164emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate ... 44 0.29
165gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, com... 42 1.2
166gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 42 1.2
167gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, co... 42 1.2
168emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chr... 42 1.2
169ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.2
170emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal ... 42 1.2
171gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA 42 1.2
172ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2... 42 1.2
173gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside ... 42 1.2
174gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, r... 42 1.2
175gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 11... 42 1.2
176gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside d... 42 1.2
177gb|CP000097.1| Synechococcus sp. CC9902, complete genome 40 4.6
178gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kina... 40 4.6
179gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosom... 40 4.6
180gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome... 40 4.6
181emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chro... 40 4.6
182gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosom... 40 4.6
183gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, co... 40 4.6
184emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chro... 40 4.6
185emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J... 40 4.6
186emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P2... 40 4.6
187emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-... 40 4.6
188emb|BX018154.1|CNS08M66 Single read from an extremity of a full-... 40 4.6
189emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on ch... 40 4.6
190emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, ... 40 4.6
191emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in ... 40 4.6
192emb|AL116259.1|CNS01D1N Botrytis cinerea strain T4 cDNA library 40 4.6
193emb|AL116136.1|CNS01CY8 Botrytis cinerea strain T4 cDNA library 40 4.6
194emb|AL115859.1|CNS01CQJ Botrytis cinerea strain T4 cDNA library 40 4.6
195emb|AL115323.1|CNS01CBN Botrytis cinerea strain T4 cDNA library 40 4.6
196emb|AL114869.1|CNS01BZ1 Botrytis cinerea strain T4 cDNA library 40 4.6
197emb|AL114309.1|CNS01BJH Botrytis cinerea strain T4 cDNA library 40 4.6
198emb|AL111481.1|CNS019CX Botrytis cinerea strain T4 cDNA library 40 4.6
199dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 4.6
200gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783... 40 4.6
201gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons ... 40 4.6
202gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete... 40 4.6
203gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, comple... 40 4.6
204ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTC... 40 4.6
205gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside d... 40 4.6

>gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kinase (NDPK) mRNA, complete
           cds
          Length = 720

 Score =  287 bits (145), Expect = 1e-74
 Identities = 184/197 (93%)
 Strand = Plus / Minus

                                                                       
Query: 148 gcctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccag 207
           ||||| |||||||||||||||||||||||  ||||| | || || |||||||||||||| 
Sbjct: 515 gcctcgtagatccagttgtgctggctgctggtccacccggcgagaccctcagggaaccac 456

                                                                       
Query: 208 agggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccg 267
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 455 agggcaatctccttcctggcattctcaactgagtcgcttccatggatgacgttcctgccg 396

                                                                       
Query: 268 atgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcg 327
           ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 395 atgtcaacggcgaagtcaccacggatggtgccaggctcagaggccagggggttggtggcg 336

                            
Query: 328 ccaatgatcttgcgtcc 344
           |||||||||||||||||
Sbjct: 335 ccaatgatcttgcgtcc 319



to top

>ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative nucleoside
           diphosphate kinase (OSJNBa0027P10.4), mRNA
          Length = 800

 Score =  194 bits (98), Expect = 1e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 208
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 520 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 461

                                                                       
Query: 209 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 268
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 460 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 401

                                                                     
Query: 269 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           ||||||| |||||||| |||||||||||||| ||||| | ||||||||||||||||||
Sbjct: 400 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttggtggc 343



to top

>dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023136C24, full
           insert sequence
          Length = 734

 Score =  194 bits (98), Expect = 1e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 208
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 532 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 473

                                                                       
Query: 209 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 268
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 472 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 413

                                                                     
Query: 269 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           ||||||| |||||||| |||||||||||||| ||||| | ||||||||||||||||||
Sbjct: 412 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttggtggc 355



to top

>gb|AY103833.1| Zea mays PCO135636 mRNA sequence
          Length = 929

 Score =  174 bits (88), Expect = 1e-40
 Identities = 163/188 (86%)
 Strand = Plus / Minus

                                                                       
Query: 154 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 213
           |||||||||  |||||||||||||  ||| |||||| ||||||| |||||||| ||||| 
Sbjct: 709 tagatccaggggtgctggctgctctgccaatcagcagggccctcggggaaccacagggca 650

                                                                       
Query: 214 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 273
           ||||||||  | ||| ||||||    ||| |||||||| |||||||||||||| ||||||
Sbjct: 649 atctccttattagcactctcaatgctgtcacttccatgaatgacattcctgccaatgtcg 590

                                                                       
Query: 274 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgccaatg 333
           || || ||||| |||||||||||||||||||| || ||||||||||||||||||||||||
Sbjct: 589 acagcaaagtcgccacggatggtgccgggctcagaagccagggggttggtggcgccaatg 530

                   
Query: 334 atcttgcg 341
           ||||||||
Sbjct: 529 atcttgcg 522



to top

>gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphate kinase (SoNDPK1) mRNA,
           complete cds
          Length = 742

 Score =  143 bits (72), Expect = 4e-31
 Identities = 159/188 (84%)
 Strand = Plus / Minus

                                                                       
Query: 154 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 213
           |||||||||  |||||||||||||  ||| ||||| |||||||| |||||||| || || 
Sbjct: 498 tagatccaggggtgctggctgctctgccaatcagcgaggccctcggggaaccacagagca 439

                                                                       
Query: 214 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 273
           ||||||||  | ||| ||||||    ||| |||||||||||||||||||| || ||||||
Sbjct: 438 atctccttgttagcactctcaatgctgtcacttccatggatgacattccttccaatgtcg 379

                                                                       
Query: 274 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgccaatg 333
           || || ||||| ||||||||||| |||||||| ||  ||||||||||||||||||| |||
Sbjct: 378 acagcaaagtcgccacggatggttccgggctcagaaaccagggggttggtggcgccgatg 319

                   
Query: 334 atcttgcg 341
           ||||||||
Sbjct: 318 atcttgcg 311



to top

>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete
             sequence
          Length = 141307

 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                         
Query: 149   cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 208
             |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 53331 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 53390

                                                                      
Query: 209   gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 265
             | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 53391 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 53447



 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                         
Query: 261   cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 320
             |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 54738 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 54797

                   
Query: 321   ggtggc 326
             ||||||
Sbjct: 54798 ggtggc 54803



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 149      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 208
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21738648 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21738707

                                                                         
Query: 209      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 265
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21738708 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21738764



 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                            
Query: 261      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 320
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21740055 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21740114

                      
Query: 321      ggtggc 326
                ||||||
Sbjct: 21740115 ggtggc 21740120



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 149      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 208
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21750311 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21750370

                                                                         
Query: 209      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 265
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21750371 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21750427



 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                            
Query: 261      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 320
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21751718 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21751777

                      
Query: 321      ggtggc 326
                ||||||
Sbjct: 21751778 ggtggc 21751783



to top

>gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I mRNA, complete cds
          Length = 573

 Score =  101 bits (51), Expect = 1e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                       
Query: 186 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 245
           |||| |||||||||||||||| |  ||||| |||||  ||||| ||||||| ||||||||
Sbjct: 503 agcagggccctcagggaaccacaatgcgatttccttggtggcactctcaacagagtcgct 444

                                                                       
Query: 246 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 305
           ||| ||||| |||||||| || ||||| | |||||||||||||||||| || || |||||
Sbjct: 443 tccgtggatcacattccttccaatgtcaatggcgaagtcaccacggatagttccaggctc 384

                          
Query: 306 ggaggccagggggtt 320
            || |||| ||||||
Sbjct: 383 agatgccaaggggtt 369



to top

>gb|AY104578.1| Zea mays PCO113042 mRNA sequence
          Length = 943

 Score =  101 bits (51), Expect = 1e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           |||||||||||||| |||||||||||| |  | ||||| || ||||||||||||||||||
Sbjct: 575 tcagggaaccagagagcgatctccttcttcccgttctccacggagtcgcttccatggatg 516

                                                          
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccggg 302
           |||||||||||||  || |||||| |||| ||||| ||||| |||||
Sbjct: 515 acattcctgccgacttccacggcgtagtccccacgaatggtaccggg 469



to top

>ref|XM_478187.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 450

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 173 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 232
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 233 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 292
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                     
Query: 293 tggtgccggg 302
           ||||||||||
Sbjct: 301 tggtgccggg 292



to top

>gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside diphosphate
           kinase 1 mRNA, complete cds
          Length = 683

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 173 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 232
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 233 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 292
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                     
Query: 293 tggtgccggg 302
           ||||||||||
Sbjct: 301 tggtgccggg 292



to top

>dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphate kinase, complete cds
          Length = 683

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 173 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 232
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 442 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 383

                                                                       
Query: 233 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 292
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 382 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 323

                     
Query: 293 tggtgccggg 302
           ||||||||||
Sbjct: 322 tggtgccggg 313



to top

>dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033095O19, full
           insert sequence
          Length = 866

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 173 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 232
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 540 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 481

                                                                       
Query: 233 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 292
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 480 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 421

                     
Query: 293 tggtgccggg 302
           ||||||||||
Sbjct: 420 tggtgccggg 411



to top

>dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate kinase I, complete cds
          Length = 828

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 247 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcg 306
           |||||||||||||| ||||| ||||||| |||||| |||||||||||||| || ||||| 
Sbjct: 380 ccatggatgacatttctgccaatgtcgatggcgaaatcaccacggatggttcctggctct 321

                                       
Query: 307 gaggccagggggttggtggcgccaatga 334
           || || || ||||||||||| |||||||
Sbjct: 320 gaagcaagagggttggtggctccaatga 293



to top

>ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 201 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 260
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 261 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 320
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

                 
Query: 321 ggtggc 326
           ||||||
Sbjct: 282 ggtggc 277



to top

>ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 201 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 260
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 261 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 320
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

                 
Query: 321 ggtggc 326
           ||||||
Sbjct: 282 ggtggc 277



to top

>gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence
          Length = 727

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 451 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 392

                                                 
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggat 293
           ||||||||||| ||||| |  || || |||||||||||
Sbjct: 391 acattcctgccaatgtcaatagcaaaatcaccacggat 354



to top

>emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleoside diphosphate kinase
          Length = 590

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 388 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 329

                                                 
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggat 293
           ||||||||||| ||||| |  || || |||||||||||
Sbjct: 328 acattcctgccaatgtcaatagcaaaatcaccacggat 291



to top

>gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA, partial cds
          Length = 595

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 238 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 297
           |||||||||||||| ||||||||||||||||| ||||  || | ||| || |||||||||
Sbjct: 267 gagtcgcttccatgaatgacattcctgccgatctcgatcgcaaggtccccgcggatggtg 208

                                                       
Query: 298 ccgggctcggaggccagggggttggtggcgccaatgatcttgcg 341
           |||||  ||||| |    |||||||||||||| |||||||||||
Sbjct: 207 ccgggggcggagtcagccgggttggtggcgccgatgatcttgcg 164



to top

>ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosphate kinase
           (AN8216.2), mRNA
          Length = 486

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 264 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 323
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 360 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttggt 301

              
Query: 324 ggc 326
           |||
Sbjct: 300 ggc 298



to top

>gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase (swoH) gene,
           complete cds
          Length = 776

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 264 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 323
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 650 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttggt 591

              
Query: 324 ggc 326
           |||
Sbjct: 590 ggc 588



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                            
Query: 173      tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 232
                |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 18281744 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 18281803

                                               
Query: 233      caactgagtcgcttccatggatgacattcct 263
                | || |||||||| |||||||||||||||||
Sbjct: 18281804 ccacggagtcgctcccatggatgacattcct 18281834



to top

>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1218_C12
          Length = 105861

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 173   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 232
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 84987 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 85046

                                            
Query: 233   caactgagtcgcttccatggatgacattcct 263
             | || |||||||| |||||||||||||||||
Sbjct: 85047 ccacggagtcgctcccatggatgacattcct 85077



to top

>dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0038F10
          Length = 153929

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 173   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 232
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 11239 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 11298

                                            
Query: 233   caactgagtcgcttccatggatgacattcct 263
             | || |||||||| |||||||||||||||||
Sbjct: 11299 ccacggagtcgctcccatggatgacattcct 11329



to top

>gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside diphosphate kinase I (NDK
           I) mRNA, complete cds
          Length = 724

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 119/146 (81%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 252
           |||||||||||||| ||||| ||||| ||  | ||| | ||||| |  |||||||| |||
Sbjct: 432 ccctcagggaaccacagggcaatctcttttgttgcactttcaacagcatcgcttccgtgg 373

                                                                       
Query: 253 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggcc 312
           || || || ||||| ||||||| ||| || || ||||||||||| || ||||| || || 
Sbjct: 372 ataacgtttctgccaatgtcgatggcaaaatctccacggatggtaccaggctctgaagct 313

                                     
Query: 313 agggggttggtggcgccaatgatctt 338
           || ||||||||||| |||||||||||
Sbjct: 312 agagggttggtggctccaatgatctt 287



to top

>ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosphate kinase
           (Afu5g03490) partial mRNA
          Length = 462

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 323
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| || ||||||||
Sbjct: 336 gccgacgtcgatagcgaagtcaccacggatggtgccgggagcggaggcaagagggttggt 277

              
Query: 324 ggc 326
           |||
Sbjct: 276 ggc 274



to top

>emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cosmid contig 62D11
          Length = 102165

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                            
Query: 280   aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
             |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 14775 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 14821



 Score = 46.1 bits (23), Expect = 0.074
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 201   gaaccagagggcgatctccttcctggcattctcaactgagtcg 243
             |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 14630 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 14672



to top

>emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosmid contig 21D9
          Length = 55380

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 280  aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
            |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 4628 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 4582



 Score = 46.1 bits (23), Expect = 0.074
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 201  gaaccagagggcgatctccttcctggcattctcaactgagtcg 243
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 4773 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 4731



to top

>dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate kinase, complete
            cds
          Length = 4240

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 280  aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
            |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 3268 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 3222



 Score = 46.1 bits (23), Expect = 0.074
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 201  gaaccagagggcgatctccttcctggcattctcaactgagtcg 243
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 3413 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 3371



to top

>gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kinase (NDK) gene,
           complete cds
          Length = 928

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 277 gcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           ||||||||||||||||||||||||||  ||||||| || |||||||||||
Sbjct: 737 gcgaagtcaccacggatggtgccgggagcggaggcaagagggttggtggc 688



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 201 gaaccagagggcgatctccttcctggcattctc 233
           |||||||||||| ||||||||| |||| |||||
Sbjct: 865 gaaccagagggcaatctccttcttggcgttctc 833



to top

>gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate kinase mRNA, complete cds
          Length = 755

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                       
Query: 170 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 229
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 470 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatctccttccttgcac 411

                                                                       
Query: 230 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 289
           ||||||| |  || |||||||| |||||||||||||| ||||| |  ||  | |||||||
Sbjct: 410 tctcaacagcatcacttccatgaatgacattcctgccaatgtcaatagcataatcaccac 351

                                                            
Query: 290 ggatggtgccgggctcggaggccagggggttggtggcgccaatgatctt 338
           ||||||| || ||  | ||  ||| ||||||||| || |||||||||||
Sbjct: 350 ggatggtaccaggagcagattccaaggggttggttgctccaatgatctt 302



to top

>dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886
          Length = 635

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 276 ggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||||||||||||||||||||||| ||  ||||||| || |||||||||||
Sbjct: 361 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttggtggc 311



to top

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                  
Query: 276     ggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
               |||||||||||||||||||||||| ||  ||||||| || |||||||||||
Sbjct: 1532690 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttggtggc 1532740



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 201     gaaccagagggcgatctccttcctggcattctc 233
               |||||||||||| ||||||||| |||| |||||
Sbjct: 1532554 gaaccagagggcaatctccttcttggcgttctc 1532586



to top

>ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21
           nucleoside-diphosphate kinase (CNE02610) partial mRNA
          Length = 530

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 193 ccctcagggaaccagagggcgatctccttc 222
           ||||||||||||||||||||||||||||||
Sbjct: 425 ccctcagggaaccagagggcgatctccttc 396



to top

>dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043K17, full
            insert sequence
          Length = 2012

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 173  tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttc 222
            |||||||||||||||| |  || |||||||||||||| ||||||||||||
Sbjct: 1752 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttc 1703



to top

>ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (MG08622.4) partial
           cds
          Length = 726

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 270 gtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           ||||| |||| ||||||||||||||||||| ||  | ||||| ||||||||||||||
Sbjct: 594 gtcgatggcgtagtcaccacggatggtgccaggggccgaggcaagggggttggtggc 538



to top

>gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndpk) mRNA, partial
           cds
          Length = 178

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 150 ctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagag 209
           |||||||||||||| ||   ||||||| |||||  || || |||| || |||||||| ||
Sbjct: 119 ctcatagatccagtggttaaggctgctgctccaggcaacagggccttctgggaaccacag 60

                                                                    
Query: 210 ggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgcc 266
            || ||||||||||| ||| || | |||||||| || ||||| || |||||||||||
Sbjct: 59  tgctatctccttccttgcactccccactgagtcactcccatgaatcacattcctgcc 3



to top

>ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus similar to
           nucleoside-diphosphate kinase 1 isoform a (LOC580218),
           mRNA
          Length = 546

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 264 gccgatgtcgacggcgaagtcaccacggatggtgccgggct 304
           |||||||||||||| | ||||||||||||||||||| ||||
Sbjct: 420 gccgatgtcgacggagtagtcaccacggatggtgccaggct 380



to top

>gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 661

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 186 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 245
           |||| |||||||||||||||| |  || || |||||  | ||| |||||||||| || ||
Sbjct: 430 agcagggccctcagggaaccacaatgcaatttccttgttagcactctcaactgaatcact 371

                                                        
Query: 246 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacg 290
           ||||||||| |||||||| || ||||| |  || |||||||||||
Sbjct: 370 tccatggataacattccttccaatgtcaatagcaaagtcaccacg 326



to top

>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7
          Length = 344615

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 250    tggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 305
              |||||||| || | |||||||| |||||| |  |||||||||||||||||||||||
Sbjct: 172638 tggatgacgttgcggccgatgttgacggccagatcaccacggatggtgccgggctc 172693



to top

>gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 655

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 186 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 245
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 436 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 377

                                                           
Query: 246 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 293
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 376 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 329



to top

>gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 771

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 186 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 245
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 445 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 386

                                                           
Query: 246 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 293
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 385 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 338



to top

>gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 753

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/127 (80%)
 Strand = Plus / Minus

                                                                       
Query: 170 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 229
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaattccttcggggaaccaaagagcaatctccttcctagcac 421

                                                                       
Query: 230 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 289
           ||||||| |  || |||||||| || ||||||||||| || || |  || || |||||||
Sbjct: 420 tctcaacagcatcacttccatgaataacattcctgccaatatcaatagcaaaatcaccac 361

                  
Query: 290 ggatggt 296
           |||||||
Sbjct: 360 ggatggt 354



to top

>ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05972.1)
           partial mRNA
          Length = 717

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 264 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 323
           ||||| ||||| |||| |||||||||||||||| |||||    ||||| |||||||||||
Sbjct: 591 gccgacgtcgatggcgtagtcaccacggatggtaccgggggaagaggcaagggggttggt 532

              
Query: 324 ggc 326
           |||
Sbjct: 531 ggc 529



to top

>gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate kinase mRNA, complete cds
          Length = 653

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 252
           |||||||||||||| ||  | ||||||||| | ||| | ||||| |  || |||||||| 
Sbjct: 428 ccctcagggaaccacagaccaatctccttctttgcactttcaacagcatcacttccatga 369

                                                          
Query: 253 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 299
           || ||||| ||||| |||||||  || || |||||||||||||||||
Sbjct: 368 atcacatttctgccaatgtcgattgcaaaatcaccacggatggtgcc 322



to top

>emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphosphate kinase
          Length = 639

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 244 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 293
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 377 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 328



to top

>gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase mRNA, partial cds
          Length = 355

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 238 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 297
           ||||||||||||||||| || || |  |||||||||| |  |||||| || |||||||||
Sbjct: 324 gagtcgcttccatggatcacgtttcgcccgatgtcgatgcagaagtccccgcggatggtg 265

                 
Query: 298 ccgggc 303
           ||||||
Sbjct: 264 ccgggc 259



to top

>dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds
          Length = 629

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 244 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 293
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 365 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 316



to top

>ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM02776.1) partial mRNA
          Length = 609

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 265 ccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtg 324
           |||| ||||| ||||||||| ||||||||||| |||||  | ||| | || |||||||||
Sbjct: 485 ccgacgtcgatggcgaagtcgccacggatggttccgggggcagagtcgagcgggttggtg 426

                
Query: 325 gcgcc 329
           |||||
Sbjct: 425 gcgcc 421



to top

>dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside diphosphate kinase
           1, complete cds
          Length = 635

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 247 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 299
           ||||| |||||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 417 ccatgaatgacattcctgccaatgtcaatagcaaaatcaccacggatggtgcc 365



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 199    gggaaccagagggcgatctccttc 222
              ||||||||||||||||||||||||
Sbjct: 701410 gggaaccagagggcgatctccttc 701433



to top

>emb|BX072516.1|CNS09S48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 442 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 485



to top

>emb|BX072515.1|CNS09S47 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 329



to top

>emb|BX063953.1|CNS09LID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 433 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 476



to top

>emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 250

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 225 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 182



to top

>emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 329



to top

>emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 340 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 297



to top

>emb|BX048701.1|CNS099QP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 197 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 154



to top

>emb|BX044675.1|CNS096MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 341 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 298



to top

>emb|BX039425.1|CNS092L1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 349 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 306



to top

>emb|BX038906.1|CNS0926M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 298

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 243 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 286



to top

>emb|BX038905.1|CNS0926L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 402 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 359



to top

>emb|BX038259.1|CNS091ON Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 422 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 465



to top

>emb|BX038258.1|CNS091OM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 361 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 318



to top

>emb|BX038116.1|CNS091KO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 247 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 290



to top

>emb|BX038115.1|CNS091KN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 329



to top

>emb|BX037581.1|CNS0915T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 429 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 472



to top

>emb|BX037580.1|CNS0915S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 329



to top

>emb|BX036658.1|CNS090G6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 313 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 270



to top

>emb|BX032742.1|CNS08XFE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 219



to top

>emb|BX031659.1|CNS08WLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 400 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 443



to top

>emb|BX031658.1|CNS08WLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 346 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 303



to top

>emb|BX025663.1|CNS08RYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 425 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 468



to top

>emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 581

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 363 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 320



to top

>emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 532

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 219



to top

>emb|BX024508.1|CNS08R2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 419 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 462



to top

>emb|BX024507.1|CNS08R2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 365 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 322



to top

>emb|BX023654.1|CNS08QEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 418 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 461



to top

>emb|BX022916.1|CNS08PUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 344 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 387



to top

>emb|BX022915.1|CNS08PUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 585

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 379 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 336



to top

>emb|BX021481.1|CNS08OQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 410 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 453



to top

>emb|BX021480.1|CNS08OQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 390 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 347



to top

>emb|BX021303.1|CNS08OLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 390



to top

>emb|BX021302.1|CNS08OLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 286 ccacggatggtgccgggctcggag 309
           ||||||||||||||||||||||||
Sbjct: 613 ccacggatggtgccgggctcggag 590



to top

>emb|BX021192.1|CNS08OIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 339 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 296



to top

>emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 149

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 103 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 146



to top

>emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 219



to top

>emb|BX018153.1|CNS08M65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 304



to top

>emb|BX018054.1|CNS08M3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 219



to top

>emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 405 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 448



to top

>emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 360 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 317



to top

>emb|BX017207.1|CNS08LFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 590

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 223 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 266



to top

>emb|BX017206.1|CNS08LFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 354 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 311



to top

>emb|BX016645.1|CNS08L09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 409 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 452



to top

>emb|BX014282.1|CNS08J6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 304



to top

>emb|BX013424.1|CNS08IIS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 350 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 307



to top

>emb|BX009576.1|CNS08FJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 396 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 439



to top

>emb|BX009575.1|CNS08FJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 387 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 344



to top

>emb|BX009569.1|CNS08FJP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 219



to top

>emb|BX009487.1|CNS08FHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 357 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 314



to top

>emb|BX007945.1|CNS08EAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 407 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 450



to top

>emb|BX007944.1|CNS08EAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 219



to top

>emb|BX006734.1|CNS08DCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 394 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 437



to top

>emb|BX006733.1|CNS08DCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 348 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 305



to top

>emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 219



to top

>ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253
           (ENSANGG00000008764), mRNA
          Length = 873

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 467 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 424



to top

>ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucleoside diphosphate
           kinase AT4G09320 (NDPK1) mRNA, complete cds
          Length = 700

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 482 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 423

                                                                       
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 422 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 363

                                  
Query: 316 gggttggtggcgccaatgatctt 338
           |||||||| || |||||||||||
Sbjct: 362 gggttggtagctccaatgatctt 340



to top

>gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence
          Length = 450

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 279 gaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           ||||||||| |||||||||||||||  |||| |   |||||||||||||||
Sbjct: 318 gaagtcaccgcggatggtgccgggcagggagtcggcggggttggtggcgcc 268



to top

>emb|BX025692.1|CNS08RZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 508

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 287 cacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           ||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 369 cacggatggtgccgggctcggagtcggccgggttggtggcgcc 327



to top

>emb|X69376.1|ATNDK13 A.thaliana gene for nucleoside diphosphate kinase, exons 1-3
          Length = 3132

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                        
Query: 196  tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
            ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 1191 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 1132

                                                                        
Query: 256  acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
            || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 1131 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 1072

                                   
Query: 316  gggttggtggcgccaatgatctt 338
            |||||||| || |||||||||||
Sbjct: 1071 gggttggtagctccaatgatctt 1049



to top

>emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate kinase
          Length = 536

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| |  || |||||||| |||||| |||| || ||||| || || ||||| 
Sbjct: 392 tcagggaaccacaaagcaatctcctttctggcactctcgacagagtcactaccgtggatc 333

                                                                       
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
           |||||||| || ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 332 acattccttccaatgtcaatagcaaagtccccacggatagttcccggctcagaagctgct 273

                                  
Query: 316 gggttggtggcgccaatgatctt 338
           |||||||| || |||||||||||
Sbjct: 272 gggttggtagctccaatgatctt 250



to top

>emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 26
          Length = 199754

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                          
Query: 196    tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
              ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 136684 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 136625

                                                                          
Query: 256    acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
              || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 136624 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 136565

                                     
Query: 316    gggttggtggcgccaatgatctt 338
              |||||||| || |||||||||||
Sbjct: 136564 gggttggtagctccaatgatctt 136542



to top

>emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, BAC clone T30A10 (ESSA project)
          Length = 83369

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                         
Query: 196   tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
             ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 69413 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 69354

                                                                         
Query: 256   acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
             || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 69353 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 69294

                                    
Query: 316   gggttggtggcgccaatgatctt 338
             |||||||| || |||||||||||
Sbjct: 69293 gggttggtagctccaatgatctt 69271



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 275     cggcgaagtcaccacggatggtgccgg 301
               ||||||||||| |||||||||||||||
Sbjct: 5713180 cggcgaagtcagcacggatggtgccgg 5713206



to top

>gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 475

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 380 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 321

                                                                       
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 320 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 261

                                  
Query: 316 gggttggtggcgccaatgatctt 338
           |||||||| || |||||||||||
Sbjct: 260 gggttggtagctccaatgatctt 238



to top

>dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside diphosphate kinase 1,
           complete cds
          Length = 640

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 230 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 272
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 388 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 346



to top

>gb|AF370529.1|AF370529 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 528

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 391 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 332

                                                                       
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 331 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 272

                                  
Query: 316 gggttggtggcgccaatgatctt 338
           |||||||| || |||||||||||
Sbjct: 271 gggttggtagctccaatgatctt 249



to top

>emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 518

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                                       
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 274

                                  
Query: 316 gggttggtggcgccaatgatctt 338
           |||||||| || |||||||||||
Sbjct: 273 gggttggtagctccaatgatctt 251



to top

>emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL69ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 593

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                                       
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 274

                                  
Query: 316 gggttggtggcgccaatgatctt 338
           |||||||| || |||||||||||
Sbjct: 273 gggttggtagctccaatgatctt 251



to top

>gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase mRNA, complete cds
          Length = 704

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 101/127 (79%)
 Strand = Plus / Minus

                                                                       
Query: 170 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 229
           ||||||||  |||||| ||||  || || |||||||| || || || |||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatttccttccttgcac 421

                                                                       
Query: 230 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 289
           |||||||||  || |||||||| || || |||||||| ||||| |  ||  | |||||||
Sbjct: 420 tctcaactgcatcacttccatgaataacgttcctgccaatgtcaatagcataatcaccac 361

                  
Query: 290 ggatggt 296
           |||||||
Sbjct: 360 ggatggt 354



to top

>dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 420

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 278 cgaagtcaccacggatggtgccgggctcgga 308
           |||||||||| ||||||||||||||| ||||
Sbjct: 313 cgaagtcaccgcggatggtgccgggcgcgga 283



to top

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 278     cgaagtcaccacggatggtgccgggctcgga 308
               |||||||||| ||||||||||||||| ||||
Sbjct: 1771041 cgaagtcaccgcggatggtgccgggcgcgga 1771011



to top

>gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphosphate kinase (ndk) gene,
           complete cds
          Length = 608

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 276 ggcgaagtcaccacggatggtgccggg 302
           |||||||||||| ||||||||||||||
Sbjct: 464 ggcgaagtcaccgcggatggtgccggg 438



to top

>gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphosphate kinase type 1 (NDPK1)
           gene, complete cds
          Length = 450

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 255
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 398 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 339

                                                                       
Query: 256 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 315
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 338 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 279

                                  
Query: 316 gggttggtggcgccaatgatctt 338
           |||||||| || |||||||||||
Sbjct: 278 gggttggtagctccaatgatctt 256



to top

>dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds
          Length = 628

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 230 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 272
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 394 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 352



to top

>gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expressed in mRNA,
           complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:11088 IMAGE:3830205), complete cds
          Length = 1045

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 466 tggatgacattcctgctgatgtggacgctgaagtcacc 429



to top

>ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein expressed in (NME4),
           mRNA
          Length = 1059

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446



to top

>ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphosphate kinase
           (Tb11.01.7800) partial mRNA
          Length = 462

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 274 acggcgaagtcaccacggatggtgcc 299
           ||||||||||||||||| ||||||||
Sbjct: 326 acggcgaagtcaccacgaatggtgcc 301



to top

>ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053503697.100) partial mRNA
          Length = 5331

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 266  cgatgtcgacggcgaagtcacc 287
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240



to top

>ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053504105.200) partial mRNA
          Length = 5334

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 266  cgatgtcgacggcgaagtcacc 287
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240



to top

>emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 600

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 182 tggatgacattcctgctgatgtggacgctgaagtcacc 145



to top

>emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal brain of Homo sapiens
           (human)
          Length = 873

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 353 tggatgacattcctgctgatgtggacgctgaagtcacc 316



to top

>dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE2022389, highly similar to
            NUCLEOSIDE DIPHOSPHATE KINASE, MITOCHONDRIAL PRECURSOR
            (EC 2.7.4.6)
          Length = 1861

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 250  tggatgacattcctgccgatgtcgacggcgaagtcacc 287
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1342 tggatgacattcctgctgatgtggacgctgaagtcacc 1305



to top

>emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 467 tggatgacattcctgctgatgtggacgctgaagtcacc 430



to top

>emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 566 tggatgacattcctgctgatgtggacgctgaagtcacc 529



to top

>emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal brain of Homo sapiens
            (human)
          Length = 1652

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 250  tggatgacattcctgccgatgtcgacggcgaagtcacc 287
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1249 tggatgacattcctgctgatgtggacgctgaagtcacc 1212



to top

>gb|AF295650.1| Beta vulgaris nucleotide diphosphate kinase (ndk) gene, partial cds
          Length = 806

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 261 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 320
           |||||| ||||| | ||| || || ||||||||||| || ||||| || || || |||||
Sbjct: 126 cctgccaatgtcaatggcaaaatcgccacggatggtaccaggctcagaagcaagagggtt 67

                             
Query: 321 ggtggcgccaatgatctt 338
           |||||| || ||||||||
Sbjct: 66  ggtggctccgatgatctt 49



to top

>gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic cells
           nucleoside-diphosphate kinase 6 (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:JCM 11048
          Length = 689

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 281 agtcaccacggatggtgccggg 302
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419



to top

>dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:ATCC 33800
          Length = 689

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 281 agtcaccacggatggtgccggg 302
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419



to top

>gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replication protein CDC47 (CDC47) and
            nucleoside diphosphate kinase (NDPK) genes, complete cds
          Length = 3852

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 274  acggcgaagtcaccacggatggtgcc 299
            ||||||||||||||||| ||||||||
Sbjct: 3427 acggcgaagtcaccacgaatggtgcc 3402



to top

>gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415



to top

>dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 591

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 281 agtcaccacggatggtgccggg 302
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289



to top

>dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 281 agtcaccacggatggtgccggg 302
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289



to top

>dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 281 agtcaccacggatggtgccggg 302
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289



to top

>dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 423

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 281 agtcaccacggatggtgccggg 302
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 281   agtcaccacggatggtgccggg 302
             ||||||||||||||||||||||
Sbjct: 89088 agtcaccacggatggtgccggg 89067



to top

>gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA clone ZA87H07
          Length = 714

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 181 tggatgacattcctgctgatgtggacgctgaagtcacc 144



to top

>gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:9630 IMAGE:3913604), complete cds
          Length = 973

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446



to top

>emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1
          Length = 831

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 201 gaaccagagggcgatctccttc 222
           ||||||||||||||||||||||
Sbjct: 483 gaaccagagggcgatctccttc 462



to top

>emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1
          Length = 853

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 201 gaaccagagggcgatctccttc 222
           ||||||||||||||||||||||
Sbjct: 480 gaaccagagggcgatctccttc 459



to top

>emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1
          Length = 851

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 201 gaaccagagggcgatctccttc 222
           ||||||||||||||||||||||
Sbjct: 470 gaaccagagggcgatctccttc 449



to top

>emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate kinase
          Length = 879

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 250 tggatgacattcctgccgatgtcgacggcgaagtcacc 287
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 463 tggatgacattcctgctgatgtggacgctgaagtcacc 426



to top

>gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, complete sequence
          Length = 215131

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 243    gcttccatggatgacattcct 263
              |||||||||||||||||||||
Sbjct: 175569 gcttccatggatgacattcct 175589



to top

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 277     gcgaagtcaccacggatggtgccgg 301
               ||||||||| |||||||||||||||
Sbjct: 1400267 gcgaagtcagcacggatggtgccgg 1400243



to top

>gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, complete sequence
          Length = 207310

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 243    gcttccatggatgacattcct 263
              |||||||||||||||||||||
Sbjct: 205795 gcttccatggatgacattcct 205775



to top

>emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chromosome 1 Contains the
             3' end of the RPS6KC1 gene for ribosomal protein S6 kinase
             52kDa polypeptide 1, complete sequence
          Length = 122208

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   cagttgtgctggctgctcctc 180
             |||||||||||||||||||||
Sbjct: 42834 cagttgtgctggctgctcctc 42854



to top

>ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus similar to Nucleoside
           diphosphate kinase A (NDK A) (NDP kinase A) (Tumor
           metastatic process-associated protein) (Metastasis
           inhibition factor nm23) (nm23-H1) (Granzyme A-activated
           DNase) (GAAD) (LOC580157), mRNA
          Length = 537

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 267 gatgtcgacggcgaagtcaccacggatggtgcc 299
           ||||||||| | | |||||||||||||||||||
Sbjct: 408 gatgtcgacagagtagtcaccacggatggtgcc 376



to top

>emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal wing disc )
          Length = 573

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 279 gaagtcaccacggatggtgccgggc 303
           ||||||||| |||||||||||||||
Sbjct: 352 gaagtcaccgcggatggtgccgggc 328



to top

>gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA
          Length = 650

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 279 gaagtcaccacggatggtgccgggc 303
           ||||||||| |||||||||||||||
Sbjct: 413 gaagtcaccgcggatggtgccgggc 389



to top

>ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2210-RA (awd), mRNA
          Length = 683

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 279 gaagtcaccacggatggtgccgggc 303
           ||||||||| |||||||||||||||
Sbjct: 462 gaagtcaccgcggatggtgccgggc 438



to top

>gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside diphosphate kinase
           (ndkA) mRNA, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 199 gggaaccagagggcgatctccttcctggcattctcaactgagtcg 243
           |||||||| |||||||||||||||  ||| ||||| || ||||||
Sbjct: 455 gggaaccaaagggcgatctccttctcggcgttctcgacggagtcg 411



to top

>gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, region 100D1-100F2, BAC clone
              BACR48C22, complete sequence
          Length = 181446

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 279    gaagtcaccacggatggtgccgggc 303
              ||||||||| |||||||||||||||
Sbjct: 115598 gaagtcaccgcggatggtgccgggc 115622



to top

>gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 117 of 118 of the complete
              sequence
          Length = 232050

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 279    gaagtcaccacggatggtgccgggc 303
              ||||||||| |||||||||||||||
Sbjct: 154870 gaagtcaccgcggatggtgccgggc 154894



to top

>gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 573

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 247 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 299
           ||||| || ||||| ||||| |||||||  || || |||||||||||||||||
Sbjct: 352 ccatgaatcacatttctgccaatgtcgattgcaaaatcaccacggatggtgcc 300



to top

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 286     ccacggatggtgccgggctc 305
               ||||||||||||||||||||
Sbjct: 2073845 ccacggatggtgccgggctc 2073864



to top

>gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kinase mRNA, partial
           cds
          Length = 679

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 192 gccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatg 251
           |||||| |||||||| ||  | ||||||||||| ||| ||||||| | |||||| |||||
Sbjct: 435 gccctctgggaaccacagcccaatctccttcctcgcactctcaaccgcgtcgctcccatg 376



to top

>gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosome 16, complete
             sequence
          Length = 198296

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   ggctgctcctccactcagca 189
             ||||||||||||||||||||
Sbjct: 12027 ggctgctcctccactcagca 12008



to top

>gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome 1, complete sequence
          Length = 141921

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    aatacaaatctcaaaactgt 80
             ||||||||||||||||||||
Sbjct: 50683 aatacaaatctcaaaactgt 50702



to top

>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete
              sequence
          Length = 233365

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 59     gaaatacaaatctcaaaactgtaa 82
              |||||||||||||||| |||||||
Sbjct: 161004 gaaatacaaatctcaatactgtaa 161027



to top

>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence
          Length = 205642

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 248    catggatgacattcctgccgatgt 271
              |||||||||||||||||| |||||
Sbjct: 161801 catggatgacattcctgctgatgt 161778



to top

>gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, complete sequence
          Length = 170622

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 61   aatacaaatctcaaaactgt 80
            ||||||||||||||||||||
Sbjct: 5137 aatacaaatctcaaaactgt 5118



to top

>emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chromosome 1 Contains the 5'
              end of a novel gene (FLJ45235), a novel gene, the 5' end of
              the gene for Kelch motif containing protein, a ribosomal
              protein S27 (metallopanstimulin 1)  (RPS27) pseudogene and
              a CpG island, complete sequence
          Length = 127227

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 60     aaatacaaatctcaaaactgtaaa 83
              |||||||||||||||||| |||||
Sbjct: 118372 aaatacaaatctcaaaacagtaaa 118349



to top

>emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J4 on chromosome 1q24.1-24.3
             Contains two genes for novel proteins (FLJ10514) and two
             CpG islands, complete sequence
          Length = 133936

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 60    aaatacaaatctcaaaactgtaaa 83
             |||||||||||||||||| |||||
Sbjct: 24849 aaatacaaatctcaaaacagtaaa 24826



to top

>emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P24 on chromosome 20 Contains STSs
             and GSSs, complete sequence
          Length = 78371

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 207   gagggcgatctccttcctggcatt 230
             |||| |||||||||||||||||||
Sbjct: 53754 gaggccgatctccttcctggcatt 53731



to top

>emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 292

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 286 ccacggatggtgccgggctc 305
           ||||||||||||||||||||
Sbjct: 20  ccacggatggtgccgggctc 1



to top

>emb|BX018154.1|CNS08M66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 213

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 286 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 329
           ||||||||||||||| |||||||| |    ||||||||||||||
Sbjct: 139 ccacggatggtgccgagctcggagtcggccgggttggtggcgcc 182



to top

>emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on chromosome 11 Contains the
             gene for a novel protein simialr to cell division cycle
             associated 4 Cdca4, a ribosomal protein L15 (Rpl15)
             pseudogene, the 3' end of a novel gene and two CpG
             islands, complete sequence
          Length = 183089

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    tcagttcacacaaacaaggt 54
             ||||||||||||||||||||
Sbjct: 11641 tcagttcacacaaacaaggt 11660



to top

>emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, complete sequence
          Length = 131030

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   gctgctcctccactcagcaa 190
             ||||||||||||||||||||
Sbjct: 81587 gctgctcctccactcagcaa 81568



to top

>emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in linkage group 5,
             complete sequence
          Length = 124378

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    aaatacaaatctcaaaactg 79
             ||||||||||||||||||||
Sbjct: 23939 aaatacaaatctcaaaactg 23920



to top

>emb|AL116259.1|CNS01D1N Botrytis cinerea strain T4 cDNA library
          Length = 650

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 271 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 422 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 367



to top

>emb|AL116136.1|CNS01CY8 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 271 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 376 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 321



to top

>emb|AL115859.1|CNS01CQJ Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 271 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 364 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 309



to top

>emb|AL115323.1|CNS01CBN Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 271 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 390 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 335



to top

>emb|AL114869.1|CNS01BZ1 Botrytis cinerea strain T4 cDNA library
          Length = 650

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 271 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 408 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 353



to top

>emb|AL114309.1|CNS01BJH Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 271 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 394 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 339



to top

>emb|AL111481.1|CNS019CX Botrytis cinerea strain T4 cDNA library
          Length = 576

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 271 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 326
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 380 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 325



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 265     ccgatgtcgacggcgaagtc 284
               ||||||||||||||||||||
Sbjct: 7419314 ccgatgtcgacggcgaagtc 7419295



to top

>gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783, complete sequence
          Length = 41150

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   gccctcagggaaccagaggg 211
             ||||||||||||||||||||
Sbjct: 13565 gccctcagggaaccagaggg 13584



to top

>gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons 26, 27, and 28
          Length = 840

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 192 gccctcagggaaccagaggg 211
           ||||||||||||||||||||
Sbjct: 468 gccctcagggaaccagaggg 449



to top

>gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete cds
          Length = 8091

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 192  gccctcagggaaccagaggg 211
            ||||||||||||||||||||
Sbjct: 5115 gccctcagggaaccagaggg 5096



to top

>gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, complete sequence
          Length = 209201

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 170    ggctgctcctccactcagca 189
              ||||||||||||||||||||
Sbjct: 186624 ggctgctcctccactcagca 186605



to top

>ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTCH3), mRNA
          Length = 8091

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 192  gccctcagggaaccagaggg 211
            ||||||||||||||||||||
Sbjct: 5115 gccctcagggaaccagaggg 5096



to top

>gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 601

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 193 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 252
           ||||| |||||||| ||  ||||| ||||||| ||  ||||||| |  || || ||||| 
Sbjct: 406 ccctcggggaaccacagaccgatcaccttcctcgcgctctcaaccgcatcactaccatga 347

                                                       
Query: 253 atgacattcctgccgatgtcgacggcgaagtcaccacggatggt 296
           || ||||| ||||| |||||||  || || ||||||||||||||
Sbjct: 346 atcacatttctgccaatgtcgattgcaaaatcaccacggatggt 303


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,558,317
Number of Sequences: 3902068
Number of extensions: 2558317
Number of successful extensions: 45063
Number of sequences better than 10.0: 206
Number of HSP's better than 10.0 without gapping: 203
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 44599
Number of HSP's gapped (non-prelim): 440
length of query: 344
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 322
effective length of database: 17,147,199,772
effective search space: 5521398326584
effective search space used: 5521398326584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top