>ref|NM_189935.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 183 tagcaccagcggatgtcttcccattgacggcgatgagctccgtgtc 228
           |||||||| ||| |||||| |||||||||||||| |||||||||||
Sbjct: 415 tagcaccaccggttgtctttccattgacggcgataagctccgtgtc 370

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                              
Query: 183      tagcaccagcggatgtcttcccattgacggcgatgagctccgtgtc 228
                |||||||| ||| |||||| |||||||||||||| |||||||||||
Sbjct: 39907688 tagcaccaccggttgtctttccattgacggcgataagctccgtgtc 39907733

>dbj|AP003433.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0004D12
          Length = 138136

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 183   tagcaccagcggatgtcttcccattgacggcgatgagctccgtgtc 228
             |||||||| ||| |||||| |||||||||||||| |||||||||||
Sbjct: 88396 tagcaccaccggttgtctttccattgacggcgataagctccgtgtc 88441

>dbj|AK103859.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148P20, full
           insert sequence
          Length = 713

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 183 tagcaccagcggatgtcttcccattgacggcgatgagctccgtgtc 228
           |||||||| ||| |||||| |||||||||||||| |||||||||||
Sbjct: 474 tagcaccaccggttgtctttccattgacggcgataagctccgtgtc 429

>gb|AY111350.1| Zea mays CL38842_-2 mRNA sequence
          Length = 526

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 194 gatgtcttcccattgacggcgatgagctccgtgtcgaaaacca 236
           ||||||||||| ||||||| ||| ||||||| |||||| ||||
Sbjct: 320 gatgtcttcccgttgacggggataagctccgggtcgaagacca 362

>gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7, complete
             sequence
          Length = 1347793

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 200   ttcccattgacggcgatgagct 221
             ||||||||||||||||||||||
Sbjct: 44523 ttcccattgacggcgatgagct 44544

>gb|AY449658.1| Cryptococcus neoformans var. neoformans alpha-aminoadipate reductase
            (LYS2) gene, partial cds
          Length = 4235

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 200  ttcccattgacggcgatgagct 221
            ||||||||||||||||||||||
Sbjct: 2301 ttcccattgacggcgatgagct 2322

>ref|XM_571745.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7
          Length = 4279

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 200  ttcccattgacggcgatgagct 221
            ||||||||||||||||||||||
Sbjct: 2372 ttcccattgacggcgatgagct 2393


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,841,932
Number of Sequences: 3902068
Number of extensions: 1841932
Number of successful extensions: 25826
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25804
Number of HSP's gapped (non-prelim): 22
length of query: 236
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 214
effective length of database: 17,147,199,772
effective search space: 3669500751208
effective search space used: 3669500751208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)