| Clone Name | rbags28i03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT017760.1| Zea mays clone EL01N0501D07.c mRNA sequence Length = 865 Score = 71.9 bits (36), Expect = 1e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 235 atggctggggagtggacagccccactgattctgggatgtcaaggtcatcatt 286 |||||||||||| ||| |||||||||||||||||||||||||| ||| |||| Sbjct: 608 atggctggggagcggaaagccccactgattctgggatgtcaagatcaccatt 557
>emb|BX640408.8| Zebrafish DNA sequence from clone CH211-262L3 in linkage group 2, complete sequence Length = 123471 Score = 44.1 bits (22), Expect = 0.25 Identities = 22/22 (100%) Strand = Plus / Minus Query: 38 tgactaatgataataaacttaa 59 |||||||||||||||||||||| Sbjct: 55700 tgactaatgataataaacttaa 55679
>gb|AC131720.2| Mus musculus BAC clone RP23-137I3 from chromosome 10, complete sequence Length = 207949 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 44 atgataataaacttaattaaa 64 ||||||||||||||||||||| Sbjct: 207526 atgataataaacttaattaaa 207506
>gb|AC091614.3| Homo sapiens chromosome 1 clone RP4-665J23, complete sequence Length = 107764 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 50 ataaacttaattaaaacaaca 70 ||||||||||||||||||||| Sbjct: 66190 ataaacttaattaaaacaaca 66210
>gb|AC019103.8| Homo sapiens BAC clone RP11-460I19 from 4, complete sequence Length = 177950 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 238 gctggggagtggacagcccca 258 ||||||||||||||||||||| Sbjct: 48583 gctggggagtggacagcccca 48603
>gb|AC168058.4| Mus musculus BAC clone RP24-134D11 from chromosome 10, complete sequence Length = 199406 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 44 atgataataaacttaattaaa 64 ||||||||||||||||||||| Sbjct: 118517 atgataataaacttaattaaa 118537
>gb|AF503618.1| Felis catus survival of motor neuron (SMN) gene, exons 3, 4, 5 and partial cds Length = 3253 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 aataaacttaattaaaacaa 68 |||||||||||||||||||| Sbjct: 1554 aataaacttaattaaaacaa 1535
>gb|AC119861.8| Mus musculus chromosome 3, clone RP23-291P19, complete sequence Length = 206094 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 46 gataataaacttaattaaaa 65 |||||||||||||||||||| Sbjct: 151175 gataataaacttaattaaaa 151194
>emb|BX294012.1|NC80A10 Neurospora crassa DNA linkage group V Cosmid contig 80A10 Length = 161126 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 150 cgatggacagccagcttgac 169 |||||||||||||||||||| Sbjct: 19465 cgatggacagccagcttgac 19446
>emb|BX571949.19| Zebrafish DNA sequence from clone DKEY-25F1 in linkage group 11, complete sequence Length = 149012 Score = 40.1 bits (20), Expect = 4.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 44 atgataataaacttaattaaaacaacaa 71 ||||||||||| |||||||||| ||||| Sbjct: 4504 atgataataaaattaattaaaaaaacaa 4477
>ref|XM_623596.1| PREDICTED: Apis mellifera similar to SGT1, suppressor of G2 allele of SKP1 (LOC551201), mRNA Length = 1140 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 aataaacttaattaaaacaa 68 |||||||||||||||||||| Sbjct: 835 aataaacttaattaaaacaa 854
>emb|AL935160.11| Zebrafish DNA sequence from clone CH211-184C7 in linkage group 12, complete sequence Length = 140401 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 taatgataataaacttaatt 61 |||||||||||||||||||| Sbjct: 25452 taatgataataaacttaatt 25433 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,191,328 Number of Sequences: 3902068 Number of extensions: 2191328 Number of successful extensions: 43840 Number of sequences better than 10.0: 12 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43821 Number of HSP's gapped (non-prelim): 19 length of query: 303 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 281 effective length of database: 17,147,199,772 effective search space: 4818363135932 effective search space used: 4818363135932 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)