>gb|AC153369.4| Mus musculus 10 BAC RP23-103E4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 197003

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 37    atatatacaccaaggaccaaggtgt 61
             |||||||||||||| ||||||||||
Sbjct: 61219 atatatacaccaagcaccaaggtgt 61243

>emb|AL135928.6| Human DNA sequence from clone RP4-534P7 on chromosome 1 Contains the
            5' end of a gene for a beta
            1,3-N-acetylgalactosaminyltransferase-II (MGC39558)
            protein and a mitochondrial cytochrome b (MTCYB) pocessed
            pseudogene, complete sequence
          Length = 82939

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 120  tgcgaccaaacaaacaaacac 140
            |||||||||||||||||||||
Sbjct: 7726 tgcgaccaaacaaacaaacac 7746

>gb|AC089994.2| Felis catus clone RP86-181L4, complete sequence
          Length = 142512

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 144   gaaatgtcagacaagccttc 163
             ||||||||||||||||||||
Sbjct: 86579 gaaatgtcagacaagccttc 86560

>gb|AC078855.13| Homo sapiens 3 BAC RP11-558M24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 173849

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 178   agtcttgcaaaccaaaacaacaaa 201
             |||| |||||||||||||||||||
Sbjct: 36346 agtcctgcaaaccaaaacaacaaa 36323

>emb|AL512304.10| Human DNA sequence from clone RP11-460D17 on chromosome 10 Contains
             part of a novel gene (KIAA0534), complete sequence
          Length = 70637

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   tcagataatatgcctgactt 120
             ||||||||||||||||||||
Sbjct: 42276 tcagataatatgcctgactt 42257

>emb|AL161772.17| Human DNA sequence from clone RP11-172H24 on chromosome 13 Contains the
             3' end of the gene for polycystic kidney disease,
             autosomal recessive (Probe hTg737) (TG737), a novel
             pseudogene (FLJ124251 and FLJ14793), the 5' end of the
             IL17D gene for interleukin 17D and a CpG island, complete
             sequence
          Length = 125579

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 26    cagaaggacatatatatacaccaa 49
             |||||||||| |||||||||||||
Sbjct: 63568 cagaaggacagatatatacaccaa 63545

>gb|AC016042.8| Homo sapiens chromosome 10 clone RP11-87P3, complete sequence
          Length = 184689

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   tcagataatatgcctgactt 120
             ||||||||||||||||||||
Sbjct: 10900 tcagataatatgcctgactt 10919

>gb|AC156984.9| Mus musculus chromosome 5, clone RP23-418H8, complete sequence
          Length = 171080

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   ccaagtcttgcaaaccaaaa 194
             ||||||||||||||||||||
Sbjct: 41589 ccaagtcttgcaaaccaaaa 41608

>ref|XM_626567.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd2_3830),
            partial mRNA
          Length = 1806

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 73   caaatcctaataatagttta 92
            ||||||||||||||||||||
Sbjct: 1472 caaatcctaataatagttta 1491

>gb|AC018366.39| Mus musculus strain 129/SvJ chromosome 5 clone mgs1-458e5, complete
              sequence
          Length = 126143

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 175    ccaagtcttgcaaaccaaaa 194
              ||||||||||||||||||||
Sbjct: 119882 ccaagtcttgcaaaccaaaa 119863

>gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome
          Length = 892758

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     gcaaatcctaataatagttt 91
              ||||||||||||||||||||
Sbjct: 822042 gcaaatcctaataatagttt 822023

>gb|AC079445.28| Mus musculus strain C57BL/6J chromosome 5 clone rp23-403l21, complete
              sequence
          Length = 189517

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    ccaagtcttgcaaaccaaaa 194
              ||||||||||||||||||||
Sbjct: 121329 ccaagtcttgcaaaccaaaa 121348


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,081,554
Number of Sequences: 3902068
Number of extensions: 4081554
Number of successful extensions: 934964
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 934779
Number of HSP's gapped (non-prelim): 185
length of query: 201
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 179
effective length of database: 17,147,199,772
effective search space: 3069348759188
effective search space used: 3069348759188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)