| Clone Name | rbags28h12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY846828.1| Triticum aestivum ribosomal protein L7 mRNA, complete cds Length = 787 Score = 153 bits (77), Expect = 4e-34 Identities = 134/155 (86%) Strand = Plus / Minus Query: 123 tcaacctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtca 182 ||||||||||||||||| || || |||||||||||||||| ||||||||| || |||||| Sbjct: 784 tcaacctagttcatccttctaacaagctggttgatgtagttctcacggttcccagcgtca 725 Query: 183 ccaccctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttg 242 ||||||| |||| | || ||||||||||| ||||| || ||||| |||||||||||| Sbjct: 724 ccaccctcgacgtagtggttcctcttcttcttcaggccaccgagcggagccttgagcttg 665 Query: 243 aatggccacaggaagntgttggccttcttgaagtg 277 ||||||||||||||| |||| |||| ||| ||||| Sbjct: 664 aatggccacaggaagttgttcgcctccttaaagtg 630
>ref|XM_480842.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1084 Score = 145 bits (73), Expect = 9e-32 Identities = 130/151 (86%) Strand = Plus / Minus Query: 127 cctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccac 186 ||||||||||||||| || ||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 794 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 735 Query: 187 cctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatg 246 ||| ||| | || ||||||||||||||||| || || || ||||| | |||||| | Sbjct: 734 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 675 Query: 247 gccacaggaagntgttggccttcttgaagtg 277 ||||||||||| ||||||||| ||||||||| Sbjct: 674 gccacaggaagttgttggcctccttgaagtg 644
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 145 bits (73), Expect = 9e-32 Identities = 130/151 (86%) Strand = Plus / Minus Query: 127 cctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccac 186 ||||||||||||||| || ||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 8149182 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 8149123 Query: 187 cctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatg 246 ||| ||| | || ||||||||||||||||| || || || ||||| | |||||| | Sbjct: 8149122 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 8149063 Query: 247 gccacaggaagntgttggccttcttgaagtg 277 ||||||||||| ||||||||| ||||||||| Sbjct: 8149062 gccacaggaagttgttggcctccttgaagtg 8149032
>dbj|AP005603.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1047A05 Length = 157517 Score = 145 bits (73), Expect = 9e-32 Identities = 130/151 (86%) Strand = Plus / Minus Query: 127 cctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccac 186 ||||||||||||||| || ||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 117493 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 117434 Query: 187 cctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatg 246 ||| ||| | || ||||||||||||||||| || || || ||||| | |||||| | Sbjct: 117433 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 117374 Query: 247 gccacaggaagntgttggccttcttgaagtg 277 ||||||||||| ||||||||| ||||||||| Sbjct: 117373 gccacaggaagttgttggcctccttgaagtg 117343
>dbj|AK102873.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112B19, full insert sequence Length = 1084 Score = 145 bits (73), Expect = 9e-32 Identities = 130/151 (86%) Strand = Plus / Minus Query: 127 cctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccac 186 ||||||||||||||| || ||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 794 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 735 Query: 187 cctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatg 246 ||| ||| | || ||||||||||||||||| || || || ||||| | |||||| | Sbjct: 734 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 675 Query: 247 gccacaggaagntgttggccttcttgaagtg 277 ||||||||||| ||||||||| ||||||||| Sbjct: 674 gccacaggaagttgttggcctccttgaagtg 644
>dbj|AK061680.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A02, full insert sequence Length = 594 Score = 145 bits (73), Expect = 9e-32 Identities = 130/151 (86%) Strand = Plus / Minus Query: 127 cctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccac 186 ||||||||||||||| || ||||| ||||||||||||||||||||||||||| ||||||| Sbjct: 355 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 296 Query: 187 cctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatg 246 ||| ||| | || ||||||||||||||||| || || || ||||| | |||||| | Sbjct: 295 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 236 Query: 247 gccacaggaagntgttggccttcttgaagtg 277 ||||||||||| ||||||||| ||||||||| Sbjct: 235 gccacaggaagttgttggcctccttgaagtg 205
>gb|AY103677.1| Zea mays PCO099976 mRNA sequence Length = 1103 Score = 129 bits (65), Expect = 5e-27 Identities = 128/151 (84%) Strand = Plus / Minus Query: 127 cctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccac 186 |||||||||||||| ||| ||||| ||||||||||| ||||||||| ||||||||||| | Sbjct: 849 cctagttcatcctcttgatgagctcgttgatgtagttctcacggtttccggcgtcaccgc 790 Query: 187 cctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatg 246 ||| ||| | || ||||||||||||||||| || || || ||||| |||||||| | Sbjct: 789 cctccacgtagtggttcctcttcttcttgaggccgccgaggggtgccttcagcttgaacg 730 Query: 247 gccacaggaagntgttggccttcttgaagtg 277 |||| |||||| ||||||||| ||||||||| Sbjct: 729 gccagaggaagttgttggcctccttgaagtg 699
>gb|AY109992.1| Zea mays CL9168_1 mRNA sequence Length = 1226 Score = 109 bits (55), Expect = 5e-21 Identities = 127/153 (83%) Strand = Plus / Plus Query: 125 aacctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcacc 184 |||||| |||||||| ||| ||||| |||||||||| ||| ||||| ||||| ||||| Sbjct: 453 aacctaattcatccttttgatgagctcattgatgtagttctcgcggttaccggcatcacc 512 Query: 185 accctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaa 244 |||| || | || ||||||||||| |||||||||||||||||||| | |||||| Sbjct: 513 gccctccacatagtggttcctcttcttcttcaggcctcccagcggcgccttcaacttgaa 572 Query: 245 tggccacaggaagntgttggccttcttgaagtg 277 |||||| |||||| ||||||||| ||||||||| Sbjct: 573 tggccagaggaagttgttggcctccttgaagtg 605
>ref|XM_473801.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 105 bits (53), Expect = 7e-20 Identities = 122/147 (82%) Strand = Plus / Minus Query: 128 ctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccacc 187 |||||||||||| |||| ||| | ||||||||||| ||||||||| || || |||||||| Sbjct: 753 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 694 Query: 188 ctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatgg 247 || ||| | || ||||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 693 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 634 Query: 248 ccacaggaagntgttggccttcttgaa 274 ||| |||||| ||||||||| |||||| Sbjct: 633 ccagaggaagttgttggcctccttgaa 607
>emb|AL662996.3|OSJN00198 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0015N08, complete sequence Length = 129037 Score = 105 bits (53), Expect = 7e-20 Identities = 122/147 (82%) Strand = Plus / Minus Query: 128 ctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccacc 187 |||||||||||| |||| ||| | ||||||||||| ||||||||| || || |||||||| Sbjct: 111788 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 111729 Query: 188 ctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatgg 247 || ||| | || ||||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 111728 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 111669 Query: 248 ccacaggaagntgttggccttcttgaa 274 ||| |||||| ||||||||| |||||| Sbjct: 111668 ccagaggaagttgttggcctccttgaa 111642
>emb|AL662968.3|OSJN00168 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0035M09, complete sequence Length = 152732 Score = 105 bits (53), Expect = 7e-20 Identities = 122/147 (82%) Strand = Plus / Minus Query: 128 ctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccacc 187 |||||||||||| |||| ||| | ||||||||||| ||||||||| || || |||||||| Sbjct: 39811 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 39752 Query: 188 ctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatgg 247 || ||| | || ||||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 39751 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 39692 Query: 248 ccacaggaagntgttggccttcttgaa 274 ||| |||||| ||||||||| |||||| Sbjct: 39691 ccagaggaagttgttggcctccttgaa 39665
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 105 bits (53), Expect = 7e-20 Identities = 122/147 (82%) Strand = Plus / Minus Query: 128 ctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccacc 187 |||||||||||| |||| ||| | ||||||||||| ||||||||| || || |||||||| Sbjct: 30636080 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 30636021 Query: 188 ctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatgg 247 || ||| | || ||||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 30636020 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 30635961 Query: 248 ccacaggaagntgttggccttcttgaa 274 ||| |||||| ||||||||| |||||| Sbjct: 30635960 ccagaggaagttgttggcctccttgaa 30635934
>dbj|AK073472.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044G24, full insert sequence Length = 1040 Score = 105 bits (53), Expect = 7e-20 Identities = 122/147 (82%) Strand = Plus / Minus Query: 128 ctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccacc 187 |||||||||||| |||| ||| | ||||||||||| ||||||||| || || |||||||| Sbjct: 850 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 791 Query: 188 ctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatgg 247 || ||| | || ||||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 790 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 731 Query: 248 ccacaggaagntgttggccttcttgaa 274 ||| |||||| ||||||||| |||||| Sbjct: 730 ccagaggaagttgttggcctccttgaa 704
>gb|BT017565.1| Zea mays clone EL01N0425H11.c mRNA sequence Length = 922 Score = 101 bits (51), Expect = 1e-18 Identities = 68/74 (91%) Strand = Plus / Minus Query: 204 ctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccacaggaagntgttg 263 ||||||||||| |||||||||||||||||||| | |||||||||||| |||||| ||||| Sbjct: 654 ctcttcttcttcaggcctcccagcggcgccttcaacttgaatggccagaggaagttgttg 595 Query: 264 gccttcttgaagtg 277 |||| ||||||||| Sbjct: 594 gcctccttgaagtg 581
>gb|AY104655.1| Zea mays PCO101521 mRNA sequence Length = 1155 Score = 101 bits (51), Expect = 1e-18 Identities = 126/153 (82%) Strand = Plus / Minus Query: 125 aacctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcacc 184 |||||| |||||||| ||| ||||| ||||||||| | ||||||||| ||||| ||||| Sbjct: 798 aacctaattcatccttttgatgagctcgttgatgtaattctcacggttaccggcatcacc 739 Query: 185 accctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaa 244 ||||| || | || ||||||||||| || ||||||||||| ||||| ||||| || Sbjct: 738 accctccacatagtggttcctcttcttcttcagacctcccagcggtgccttcagcttaaa 679 Query: 245 tggccacaggaagntgttggccttcttgaagtg 277 |||||| |||||| |||| |||| ||||||||| Sbjct: 678 tggccaaaggaagttgttcgcctccttgaagtg 646
>dbj|D29720.1|RICYK33 Oryza sativa mRNA, partial homologous to ribosomal protein L7 gene Length = 297 Score = 97.6 bits (49), Expect = 2e-17 Identities = 115/139 (82%) Strand = Plus / Minus Query: 128 ctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccacc 187 |||||||||||| |||| ||| | ||||||||||| ||||||||| || || |||||||| Sbjct: 139 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 80 Query: 188 ctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatgg 247 || ||| | || ||||||||||| || || ||||| || ||||| ||||||||||| Sbjct: 79 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 20 Query: 248 ccacaggaagntgttggcc 266 ||| |||||| |||||||| Sbjct: 19 ccagaggaagttgttggcc 1
>gb|BT016468.1| Zea mays clone Contig301 mRNA sequence Length = 1198 Score = 93.7 bits (47), Expect = 3e-16 Identities = 125/153 (81%) Strand = Plus / Minus Query: 125 aacctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcacc 184 |||||| |||||||| ||| ||||| ||||||||| | ||||||||| ||||| ||||| Sbjct: 785 aacctaattcatccttttgatgagctcgttgatgtaattctcacggttaccggcatcacc 726 Query: 185 accctngacgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaa 244 ||||| || | || ||||||||||| || ||||||||||| ||||| ||||| || Sbjct: 725 accctccacatagtggttcctcttcttcttcagacctcccagcggggccttcagcttaaa 666 Query: 245 tggccacaggaagntgttggccttcttgaagtg 277 ||||| |||||| |||| |||| ||||||||| Sbjct: 665 aggccaaaggaagttgttcgcctccttgaagtg 633
>ref|NM_126186.2| Arabidopsis thaliana structural constituent of ribosome / transcription regulator AT2G01250 mRNA, complete cds Length = 1051 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 801 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 742 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 741 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 682 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 681 aggaagttgttggcttccttgaaatgagg 653
>gb|AY079328.1| Arabidopsis thaliana putative ribosomal protein L7 (At2g01250) mRNA, complete cds Length = 760 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 725 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 666 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 665 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 606 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 605 aggaagttgttggcttccttgaaatgagg 577
>gb|AY045994.1| Arabidopsis thaliana putative ribosomal protein L7 (At2g01250) mRNA, complete cds Length = 960 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 774 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 715 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 714 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 655 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 654 aggaagttgttggcttccttgaaatgagg 626
>gb|AC006200.3| Arabidopsis thaliana chromosome 2 clone F10A8 map rga, complete sequence Length = 94029 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Plus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 42543 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 42602 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 42603 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 42662 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 42663 aggaagttgttggcttccttgaaatgagg 42691
>gb|AY081698.1| Arabidopsis thaliana 60S ribosomal protein L7 (At2g01250) mRNA, complete cds Length = 751 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 725 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 666 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 665 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 606 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 605 aggaagttgttggcttccttgaaatgagg 577
>gb|AF370484.1|AF370484 Arabidopsis thaliana 60S ribosomal protein L7 (At2g01250; F10A8.13) mRNA, complete cds Length = 915 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 772 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 713 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 712 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 653 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 652 aggaagttgttggcttccttgaaatgagg 624
>emb|BX818796.1|CNS0A9X8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB14ZB01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 889 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 760 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 701 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 700 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 641 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 640 aggaagttgttggcttccttgaaatgagg 612
>gb|AY085139.1| Arabidopsis thaliana clone 13298 mRNA, complete sequence Length = 996 Score = 77.8 bits (39), Expect = 2e-11 Identities = 120/149 (80%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||||||||||| |||| |||||| ||| ||||||||| ||||| |||||||| | Sbjct: 801 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 742 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | | ||||||||||||||||| || || || ||||| |||| ||||||||| Sbjct: 741 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 682 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||| ||||| Sbjct: 681 aggaagttgttggcttccttgaaatgagg 653
>ref|NM_180079.1| Arabidopsis thaliana structural constituent of ribosome / transcription regulator AT2G44120 transcript variant AT2G44120.1 mRNA, complete cds Length = 981 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 804 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 745 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 744 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 685 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 684 aggaagttgttggcttccttgaagtgagg 656
>ref|NM_180080.1| Arabidopsis thaliana structural constituent of ribosome / transcription regulator AT2G44120 transcript variant AT2G44120.2 mRNA, complete cds Length = 1220 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 1031 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 972 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 971 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 912 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 911 aggaagttgttggcttccttgaagtgagg 883
>gb|AC004005.3| Arabidopsis thaliana chromosome 2 clone F6E13 map CIC10F02, CIC02E07, complete sequence Length = 109741 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Plus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 79498 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 79557 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 79558 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 79617 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 79618 aggaagttgttggcttccttgaagtgagg 79646
>gb|AY081474.1| Arabidopsis thaliana 60S ribosomal protein L7 (At2g44120) mRNA, complete cds Length = 782 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 725 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 666 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 665 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 606 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 605 aggaagttgttggcttccttgaagtgagg 577
>gb|AY065196.1| Arabidopsis thaliana 60S ribosomal protein L7 (F6E13.25; At2g44120) mRNA, complete cds Length = 888 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 767 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 708 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 707 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 648 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 647 aggaagttgttggcttccttgaagtgagg 619
>gb|AF446884.1|AF446884 Arabidopsis thaliana At2g44120/F6E13.25 mRNA, complete cds Length = 729 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 725 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 666 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 665 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 606 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 605 aggaagttgttggcttccttgaagtgagg 577
>gb|AY052724.1| Arabidopsis thaliana At2g44120/F6E13.25 mRNA, complete cds Length = 905 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 767 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 708 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 707 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 648 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 647 aggaagttgttggcttccttgaagtgagg 619
>gb|AY087583.1| Arabidopsis thaliana clone 36813 mRNA, complete sequence Length = 1221 Score = 61.9 bits (31), Expect = 1e-06 Identities = 118/149 (79%) Strand = Plus / Minus Query: 132 ttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccaccctng 191 ||||| |||||||| |||| ||||||| | | ||| | ||| || || |||||||| | | Sbjct: 1031 ttcattctcctgacaagctcgttgatgaaattctccctgtttccagcatcaccaccttcg 972 Query: 192 acgnngggggnnctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccac 251 ||| | || ||||||||||| ||||| || || || ||||| | | |||||||||| Sbjct: 971 acgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaattggaatggccac 912 Query: 252 aggaagntgttggccttcttgaagtgagg 280 |||||| ||||||| | |||||||||||| Sbjct: 911 aggaagttgttggcttccttgaagtgagg 883
>gb|BT002379.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 955 Score = 60.0 bits (30), Expect = 4e-06 Identities = 65/77 (84%) Strand = Plus / Minus Query: 204 ctcttcttcttgaggcctcccagcggcgccttgagcttgaatggccacaggaagntgttg 263 ||||||||||| ||||| || || || ||||| | | |||||||||||||||| ||||| Sbjct: 728 ctcttcttcttaaggccaccgagtggtgccttcaattggaatggccacaggaagttgttg 669 Query: 264 gccttcttgaagtgagg 280 || | |||||||||||| Sbjct: 668 gcttccttgaagtgagg 652
>gb|AY617897.1| Sterkiella histriomuscorum clone UGC1O0006_E04_F genomic sequence Length = 674 Score = 58.0 bits (29), Expect = 2e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 234 ttgagcttgaatggccacaggaagntgttggccttcttgaagtgaggg 281 ||||||||||||||||| |||||| |||| || | ||||||||||||| Sbjct: 274 ttgagcttgaatggccagaggaagttgttagcttccttgaagtgaggg 321
>gb|DQ066291.1| Ixodes scapularis isolate is-all-399 ribosomal protein L7-like mRNA, complete cds Length = 756 Score = 58.0 bits (29), Expect = 2e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggccttcttgaagt 276 |||||||| ||||||||||| |||||||||||||||||| Sbjct: 647 agcttgaagtgccacaggaagttgttggccttcttgaagt 608
>gb|AY433771.1| Aedes aegypti ASAP ID: 34421 cytosolic large ribosomal subunit L7 mRNA sequence Length = 453 Score = 56.0 bits (28), Expect = 6e-05 Identities = 33/35 (94%) Strand = Plus / Minus Query: 234 ttgagcttgaatggccacaggaagntgttggcctt 268 ||||||||||| |||||||||||| |||||||||| Sbjct: 252 ttgagcttgaacggccacaggaagttgttggcctt 218
>gb|DQ440213.1| Aedes aegypti clone AET-2196 ribosomal protein L7 mRNA, complete cds Length = 792 Score = 56.0 bits (28), Expect = 6e-05 Identities = 33/35 (94%) Strand = Plus / Minus Query: 234 ttgagcttgaatggccacaggaagntgttggcctt 268 ||||||||||| |||||||||||| |||||||||| Sbjct: 686 ttgagcttgaacggccacaggaagttgttggcctt 652
>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI, complete sequence Length = 1813164 Score = 56.0 bits (28), Expect = 6e-05 Identities = 36/39 (92%) Strand = Plus / Minus Query: 239 cttgaatggccacaggaagntgttggccttcttgaagtg 277 |||||||||||||| |||| ||||||||| ||||||||| Sbjct: 285770 cttgaatggccacaagaagttgttggcctgcttgaagtg 285732
>ref|NM_210820.1| Eremothecium gossypii AFL082Wp (AFL082W), mRNA Length = 732 Score = 56.0 bits (28), Expect = 6e-05 Identities = 36/39 (92%) Strand = Plus / Minus Query: 239 cttgaatggccacaggaagntgttggccttcttgaagtg 277 |||||||||||||| |||| ||||||||| ||||||||| Sbjct: 615 cttgaatggccacaagaagttgttggcctgcttgaagtg 577
>ref|XM_453218.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D03410g predicted mRNA Length = 768 Score = 54.0 bits (27), Expect = 2e-04 Identities = 38/42 (90%) Strand = Plus / Minus Query: 239 cttgaatggccacaggaagntgttggccttcttgaagtgagg 280 |||||||||||||| |||| ||||||| | |||||||||||| Sbjct: 651 cttgaatggccacaagaagttgttggcttgcttgaagtgagg 610
>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1715506 Score = 54.0 bits (27), Expect = 2e-04 Identities = 38/42 (90%) Strand = Plus / Minus Query: 239 cttgaatggccacaggaagntgttggccttcttgaagtgagg 280 |||||||||||||| |||| ||||||| | |||||||||||| Sbjct: 286228 cttgaatggccacaagaagttgttggcttgcttgaagtgagg 286187
>gb|AY130402.1| Branchiostoma lanceolatum ribosomal protein L7 mRNA, partial cds Length = 718 Score = 52.0 bits (26), Expect = 0.001 Identities = 28/29 (96%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 ||||||||||||||||||||| ||||||| Sbjct: 614 agcttgaatggccacaggaagttgttggc 586
>gb|AF003139.2| Caenorhabditis elegans cosmid F53G12, complete sequence Length = 41553 Score = 50.1 bits (25), Expect = 0.004 Identities = 39/44 (88%) Strand = Plus / Minus Query: 234 ttgagcttgaatggccacaggaagntgttggccttcttgaagtg 277 ||||||||||| ||||||| |||| || |||||| ||||||||| Sbjct: 4441 ttgagcttgaagggccacaagaagttggtggcctccttgaagtg 4398
>ref|NM_058275.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family member (rpl-7) (rpl-7) mRNA, complete cds Length = 822 Score = 50.1 bits (25), Expect = 0.004 Identities = 39/44 (88%) Strand = Plus / Minus Query: 234 ttgagcttgaatggccacaggaagntgttggccttcttgaagtg 277 ||||||||||| ||||||| |||| || |||||| ||||||||| Sbjct: 648 ttgagcttgaagggccacaagaagttggtggcctccttgaagtg 605
>ref|XM_779123.1| PREDICTED: Strongylocentrotus purpuratus similar to 60S ribosomal protein L7 (LOC578988), mRNA Length = 300 Score = 48.1 bits (24), Expect = 0.015 Identities = 56/67 (83%) Strand = Plus / Minus Query: 128 ctagttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtcaccacc 187 ||||||||||||||||| || | ||||||| | | ||| ||||||||| ||||||||| Sbjct: 300 ctagttcatcctcctgatgaagtcgttgatgaacttctcgcggttgccgtagtcaccacc 241 Query: 188 ctngacg 194 || |||| Sbjct: 240 ctcgacg 234
>gb|AY130404.1| Petromyzon marinus ribosomal protein L7 mRNA, partial cds Length = 652 Score = 48.1 bits (24), Expect = 0.015 Identities = 35/39 (89%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggccttcttgaag 275 |||||||| |||||||||||| |||||||| ||||||| Sbjct: 579 agcttgaagggccacaggaagttgttggccaacttgaag 541
>gb|AY130403.1| Myxine glutinosa ribosomal protein L7-like mRNA, partial sequence Length = 621 Score = 48.1 bits (24), Expect = 0.015 Identities = 26/27 (96%) Strand = Plus / Minus Query: 239 cttgaatggccacaggaagntgttggc 265 ||||||||||||||||||| ||||||| Sbjct: 515 cttgaatggccacaggaagttgttggc 489
>ref|XM_359540.1| Magnaporthe grisea 70-15 hypothetical protein (MG05237.4) partial mRNA Length = 741 Score = 46.1 bits (23), Expect = 0.059 Identities = 37/42 (88%) Strand = Plus / Minus Query: 235 tgagcttgaatggccacaggaagntgttggccttcttgaagt 276 |||||||||| |||||||||||| || ||||| |||||||| Sbjct: 631 tgagcttgaagggccacaggaagttggaggcctgcttgaagt 590
>gb|DQ118296.2| Oryzias latipes ribosomal protein L7 mRNA, complete cds Length = 841 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 667 agcttgaagggccacaggaagttgttggc 639
>emb|CR735071.2|CNS0GTYM Tetraodon nigroviridis full-length cDNA Length = 762 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 611 agcttgaagggccacaggaagttgttggc 583
>emb|CR734244.2|CNS0GTBN Tetraodon nigroviridis full-length cDNA Length = 796 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR734522.2|CNS0GTJD Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR733965.2|CNS0GT3W Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR733632.2|CNS0GSUN Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR733687.2|CNS0GSW6 Tetraodon nigroviridis full-length cDNA Length = 666 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 510 agcttgaagggccacaggaagttgttggc 482
>emb|AJ245656.1|CPA245656 Cyanophora paradoxa partial mRNA for 60S ribosomal protein L7 Length = 447 Score = 44.1 bits (22), Expect = 0.23 Identities = 36/41 (87%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggccttcttgaagtg 277 |||| ||| |||||||||||| |||| |||| ||||||||| Sbjct: 338 agctggaagggccacaggaagttgttcgcctccttgaagtg 298
>emb|CR731264.2|CNS0GR6T Tetraodon nigroviridis full-length cDNA Length = 762 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR727947.2|CNS0GOMP Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR720280.2|CNS0GIPQ Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 646 agcttgaagggccacaggaagttgttggc 618 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR720053.2|CNS0GIJF Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR723153.2|CNS0GKXJ Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR723125.2|CNS0GKWR Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR722468.2|CNS0GKEI Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620
>emb|CR722292.2|CNS0GK9M Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 646 agcttgaagggccacaggaagttgttggc 618
>emb|CR722107.2|CNS0GK4H Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR722072.2|CNS0GK3I Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 757 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 706
>emb|CR721869.2|CNS0GJXV Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR721467.2|CNS0GJMP Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR721426.2|CNS0GJLK Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR721359.2|CNS0GJJP Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR721235.2|CNS0GJG9 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR721092.2|CNS0GJCA Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR721030.2|CNS0GJAK Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR720799.2|CNS0GJ45 Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR720623.2|CNS0GIZ9 Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR720322.2|CNS0GIQW Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR720019.2|CNS0GIIH Tetraodon nigroviridis full-length cDNA Length = 798 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR719901.2|CNS0GIF7 Tetraodon nigroviridis full-length cDNA Length = 773 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 619 agcttgaagggccacaggaagttgttggc 591 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 726 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 675
>emb|CR719414.2|CNS0GI1O Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 650 agcttgaagggccacaggaagttgttggc 622 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 757 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 706
>emb|CR717867.2|CNS0GGUP Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619
>emb|CR717180.2|CNS0GGBP Tetraodon nigroviridis full-length cDNA Length = 797 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 644 agcttgaagggccacaggaagttgttggc 616 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 751 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 700
>emb|CR716913.2|CNS0GG4A Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR715495.2|CNS0GF0Z Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR714419.2|CNS0GE73 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR714409.2|CNS0GE6T Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR713663.2|CNS0GDM3 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR713179.2|CNS0GD8N Tetraodon nigroviridis full-length cDNA Length = 529 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 375 agcttgaagggccacaggaagttgttggc 347 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 482 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 431
>emb|CR711113.2|CNS0GBN9 Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR711074.2|CNS0GBM6 Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR710328.2|CNS0GB1G Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR710197.2|CNS0GAXT Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR710165.2|CNS0GAWX Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR709755.2|CNS0GALJ Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR709637.2|CNS0GAI9 Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR708154.2|CNS0G9D2 Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR707639.2|CNS0G8YR Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR707158.2|CNS0G8LE Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617
>emb|CR706075.2|CNS0G7RB Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR705816.2|CNS0G7K4 Tetraodon nigroviridis full-length cDNA Length = 692 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 537 agcttgaagggccacaggaagttgttggc 509 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 644 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 593
>emb|CR705749.2|CNS0G7I9 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR705576.2|CNS0G7DG Tetraodon nigroviridis full-length cDNA Length = 673 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 518 agcttgaagggccacaggaagttgttggc 490 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 625 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 574
>emb|CR705447.2|CNS0G79V Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR705159.2|CNS0G71V Tetraodon nigroviridis full-length cDNA Length = 798 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR703372.2|CNS0G5O8 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR703049.2|CNS0G5F9 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR702705.2|CNS0G55P Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR701243.2|CNS0G413 Tetraodon nigroviridis full-length cDNA Length = 1552 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 1400 agcttgaagggccacaggaagttgttggc 1372
>emb|CR701137.2|CNS0G3Y5 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR700155.2|CNS0G36V Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR699988.2|CNS0G328 Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR699071.2|CNS0G2CR Tetraodon nigroviridis full-length cDNA Length = 771 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 617 agcttgaagggccacaggaagttgttggc 589 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 724 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 673
>emb|CR698906.2|CNS0G286 Tetraodon nigroviridis full-length cDNA Length = 509 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 354 agcttgaagggccacaggaagttgttggc 326 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 461 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 410
>emb|CR698811.2|CNS0G25J Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR698131.2|CNS0G1MN Tetraodon nigroviridis full-length cDNA Length = 798 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR697519.2|CNS0G15N Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR697678.2|CNS0G1A2 Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR697078.2|CNS0G0TE Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR696465.2|CNS0G0CD Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR695696.2|CNS0FZR0 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR695158.2|CNS0FZC2 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR694919.2|CNS0FZ5F Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR694817.2|CNS0FZ2L Tetraodon nigroviridis full-length cDNA Length = 770 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 617 agcttgaagggccacaggaagttgttggc 589 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 724 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 673
>emb|CR694401.2|CNS0FYR1 Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR694394.2|CNS0FYQU Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR693496.2|CNS0FY1W Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR692707.2|CNS0FXFZ Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR690835.2|CNS0FVZZ Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 646 agcttgaagggccacaggaagttgttggc 618 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR690523.2|CNS0FVRB Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR690410.2|CNS0FVO6 Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620
>emb|CR690209.2|CNS0FVIL Tetraodon nigroviridis full-length cDNA Length = 1320 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 1172 agcttgaagggccacaggaagttgttggc 1144 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 1279 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 1228
>emb|CR690153.2|CNS0FVH1 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR689667.2|CNS0FV3J Tetraodon nigroviridis full-length cDNA Length = 796 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR689556.2|CNS0FV0G Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR688595.2|CNS0FU9R Tetraodon nigroviridis full-length cDNA Length = 807 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR688085.2|CNS0FTVL Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 644 agcttgaagggccacaggaagttgttggc 616 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 751 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 700
>emb|CR687197.2|CNS0FT6X Tetraodon nigroviridis full-length cDNA Length = 558 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 406 agcttgaagggccacaggaagttgttggc 378
>emb|CR687158.2|CNS0FT5U Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR687062.2|CNS0FT36 Tetraodon nigroviridis full-length cDNA Length = 797 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR686995.2|CNS0FT1B Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR686123.2|CNS0FSD3 Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR685444.2|CNS0FRU8 Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR684092.2|CNS0FQSO Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR683582.2|CNS0FQEI Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR682167.2|CNS0FPB7 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR681765.2|CNS0FP01 Tetraodon nigroviridis full-length cDNA Length = 807 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR681001.2|CNS0FOET Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR680447.2|CNS0FNZF Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR680257.2|CNS0FNU5 Tetraodon nigroviridis full-length cDNA Length = 759 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR680229.2|CNS0FNTD Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR680029.2|CNS0FNNT Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR680002.2|CNS0FNN2 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 646 agcttgaagggccacaggaagttgttggc 618 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR679345.2|CNS0FN4T Tetraodon nigroviridis full-length cDNA Length = 820 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 667 agcttgaagggccacaggaagttgttggc 639
>emb|CR679485.2|CNS0FN8P Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR678807.2|CNS0FMPV Tetraodon nigroviridis full-length cDNA Length = 796 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR678806.2|CNS0FMPU Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR677485.2|CNS0FLPL Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR677349.2|CNS0FLLT Tetraodon nigroviridis full-length cDNA Length = 729 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 616 agcttgaagggccacaggaagttgttggc 588 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 723 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 672
>emb|CR677233.2|CNS0FLIL Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR677134.2|CNS0FLFU Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR676498.2|CNS0FKY6 Tetraodon nigroviridis full-length cDNA Length = 776 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR676452.2|CNS0FKWW Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR676335.2|CNS0FKTN Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR676204.2|CNS0FKQ0 Tetraodon nigroviridis full-length cDNA Length = 810 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 652 agcttgaagggccacaggaagttgttggc 624
>emb|CR676066.2|CNS0FKMG Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR675695.2|CNS0FKC5 Tetraodon nigroviridis full-length cDNA Length = 837 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 683 agcttgaagggccacaggaagttgttggc 655 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 790 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 739
>emb|CR675346.2|CNS0FK2G Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 651 agcttgaagggccacaggaagttgttggc 623 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 758 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 707
>emb|CR675343.2|CNS0FK2D Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR675169.2|CNS0FJXJ Tetraodon nigroviridis full-length cDNA Length = 762 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR675495.2|CNS0FK6L Tetraodon nigroviridis full-length cDNA Length = 770 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR675401.2|CNS0FK3Z Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR674719.2|CNS0FJL1 Tetraodon nigroviridis full-length cDNA Length = 673 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 518 agcttgaagggccacaggaagttgttggc 490 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 625 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 574
>emb|CR674663.2|CNS0FJJH Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR674602.2|CNS0FJHS Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR673831.2|CNS0FIWD Tetraodon nigroviridis full-length cDNA Length = 791 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 639 agcttgaagggccacaggaagttgttggc 611 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 746 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 695
>emb|CR673802.2|CNS0FIVK Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR673176.2|CNS0FIE6 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR672844.2|CNS0FI4Y Tetraodon nigroviridis full-length cDNA Length = 728 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR672753.2|CNS0FI2F Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR672663.2|CNS0FHZX Tetraodon nigroviridis full-length cDNA Length = 807 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR672176.2|CNS0FHME Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR672248.2|CNS0FHOE Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR671591.2|CNS0FH65 Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR671897.2|CNS0FHEN Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR671079.2|CNS0FGRX Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR671508.2|CNS0FH3U Tetraodon nigroviridis full-length cDNA Length = 810 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR671422.2|CNS0FH1G Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR671362.2|CNS0FGZS Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR671274.2|CNS0FGXC Tetraodon nigroviridis full-length cDNA Length = 797 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617
>emb|CR670789.2|CNS0FGJV Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR670891.1|CNS0FGMP Tetraodon nigroviridis full-length cDNA Length = 788 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 643 agcttgaagggccacaggaagttgttggc 615 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 750 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 699
>emb|CR670277.2|CNS0FG5N Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR670098.2|CNS0FG0O Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR670040.2|CNS0FFZ2 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR669953.2|CNS0FFWN Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 646 agcttgaagggccacaggaagttgttggc 618 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR669839.2|CNS0FFTH Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR669837.2|CNS0FFTF Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617
>emb|CR669733.2|CNS0FFQJ Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR669429.2|CNS0FFI3 Tetraodon nigroviridis full-length cDNA Length = 806 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 645 agcttgaagggccacaggaagttgttggc 617 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 752 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 701
>emb|CR669106.2|CNS0FF94 Tetraodon nigroviridis full-length cDNA Length = 673 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 518 agcttgaagggccacaggaagttgttggc 490 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 625 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 574
>emb|CR669069.2|CNS0FF83 Tetraodon nigroviridis full-length cDNA Length = 805 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR668997.2|CNS0FF63 Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR668957.2|CNS0FF4Z Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR668563.2|CNS0FEU1 Tetraodon nigroviridis full-length cDNA Length = 767 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR668271.2|CNS0FELX Tetraodon nigroviridis full-length cDNA Length = 798 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 644 agcttgaagggccacaggaagttgttggc 616 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 751 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 700
>emb|CR668260.2|CNS0FELM Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620
>emb|CR668169.2|CNS0FEJ3 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR668093.2|CNS0FEGZ Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR667940.2|CNS0FECQ Tetraodon nigroviridis full-length cDNA Length = 807 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR668199.1|CNS0FEJX Tetraodon nigroviridis full-length cDNA Length = 1093 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 951 agcttgaagggccacaggaagttgttggc 923 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 1058 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 1007
>emb|CR667497.2|CNS0FE0F Tetraodon nigroviridis full-length cDNA Length = 770 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR667461.2|CNS0FDZF Tetraodon nigroviridis full-length cDNA Length = 798 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 646 agcttgaagggccacaggaagttgttggc 618 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR667328.2|CNS0FDVQ Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 647 agcttgaagggccacaggaagttgttggc 619 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 754 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 703
>emb|CR667777.1|CNS0FE87 Tetraodon nigroviridis full-length cDNA Length = 792 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 640 agcttgaagggccacaggaagttgttggc 612
>emb|CR666842.2|CNS0FDI8 Tetraodon nigroviridis full-length cDNA Length = 761 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR667060.2|CNS0FDOA Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR666791.2|CNS0FDGT Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 646 agcttgaagggccacaggaagttgttggc 618 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 753 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 702
>emb|CR664669.2|CNS0FBTV Tetraodon nigroviridis full-length cDNA Length = 571 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 419 agcttgaagggccacaggaagttgttggc 391 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 526 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 475
>emb|CR666563.2|CNS0FDAH Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR666171.2|CNS0FCZL Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR666164.2|CNS0FCZE Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR666078.2|CNS0FCX0 Tetraodon nigroviridis full-length cDNA Length = 763 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 609 agcttgaagggccacaggaagttgttggc 581
>emb|CR666023.2|CNS0FCVH Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR665923.2|CNS0FCSP Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR665918.2|CNS0FCSK Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR665611.2|CNS0FCK1 Tetraodon nigroviridis full-length cDNA Length = 1108 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 956 agcttgaagggccacaggaagttgttggc 928 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 1063 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 1012
>emb|CR665502.2|CNS0FCH0 Tetraodon nigroviridis full-length cDNA Length = 767 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR665489.2|CNS0FCGN Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR665370.2|CNS0FCDC Tetraodon nigroviridis full-length cDNA Length = 803 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621
>emb|CR665361.2|CNS0FCD3 Tetraodon nigroviridis full-length cDNA Length = 769 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587
>emb|CR665316.2|CNS0FCBU Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR665004.2|CNS0FC36 Tetraodon nigroviridis full-length cDNA Length = 769 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR664817.2|CNS0FBXZ Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR664279.2|CNS0FBJ1 Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR663724.2|CNS0FB3M Tetraodon nigroviridis full-length cDNA Length = 799 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR663301.2|CNS0FARV Tetraodon nigroviridis full-length cDNA Length = 809 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR663512.2|CNS0FAXQ Tetraodon nigroviridis full-length cDNA Length = 761 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR663223.2|CNS0FAPP Tetraodon nigroviridis full-length cDNA Length = 795 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 642 agcttgaagggccacaggaagttgttggc 614 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 749 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 698
>emb|CR663193.2|CNS0FAOV Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 650 agcttgaagggccacaggaagttgttggc 622 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 757 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 706
>emb|CR663019.2|CNS0FAK1 Tetraodon nigroviridis full-length cDNA Length = 767 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR662961.2|CNS0FAIF Tetraodon nigroviridis full-length cDNA Length = 753 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 597 agcttgaagggccacaggaagttgttggc 569 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 705 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 654
>emb|CR662321.2|CNS0FA0N Tetraodon nigroviridis full-length cDNA Length = 800 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR662286.2|CNS0F9ZO Tetraodon nigroviridis full-length cDNA Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705
>emb|CR662097.2|CNS0F9UF Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR662093.2|CNS0F9UB Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR661909.2|CNS0F9P7 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR661030.2|CNS0F90S Tetraodon nigroviridis full-length cDNA Length = 762 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 608 agcttgaagggccacaggaagttgttggc 580 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 715 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 664
>emb|CR660684.2|CNS0F8R6 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 648 agcttgaagggccacaggaagttgttggc 620 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 755 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 704
>emb|CR660572.2|CNS0F8O2 Tetraodon nigroviridis full-length cDNA Length = 770 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 615 agcttgaagggccacaggaagttgttggc 587 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 722 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 671
>emb|CR660538.2|CNS0F8N4 Tetraodon nigroviridis full-length cDNA Length = 804 Score = 44.1 bits (22), Expect = 0.23 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 agcttgaatggccacaggaagntgttggc 265 |||||||| |||||||||||| ||||||| Sbjct: 649 agcttgaagggccacaggaagttgttggc 621 Score = 40.1 bits (20), Expect = 3.7 Identities = 44/52 (84%) Strand = Plus / Minus Query: 130 agttcatcctcctgacgagctggttgatgtagtcctcacggttgccggcgtc 181 |||||||||||||||| ||| |||||| | |||||| | |||||| ||||| Sbjct: 756 agttcatcctcctgaccagcctgttgatctggtcctccctgttgccagcgtc 705 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,802,478 Number of Sequences: 3902068 Number of extensions: 2802478 Number of successful extensions: 47607 Number of sequences better than 10.0: 391 Number of HSP's better than 10.0 without gapping: 391 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 46827 Number of HSP's gapped (non-prelim): 768 length of query: 281 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 259 effective length of database: 17,147,199,772 effective search space: 4441124740948 effective search space used: 4441124740948 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)