ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags28g09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009641.1| Triticum aestivum clone wre1n.pk191.c6:fis, full ... 270 2e-69
2ref|XM_369364.1| Magnaporthe grisea 70-15 chromosome III hypothe... 40 3.1
3gb|AC122492.3| Mus musculus BAC clone RP24-390N7 from chromosome... 40 3.1
4gb|AC160414.4| Mus musculus 10 BAC RP24-166O23 (Roswell Park Can... 40 3.1
5gb|AC162308.2| Mus musculus BAC clone RP23-109E9 from chromosome... 40 3.1
6emb|AL844891.7| Mouse DNA sequence from clone RP23-350N21 on chr... 40 3.1

>gb|BT009641.1| Triticum aestivum clone wre1n.pk191.c6:fis, full insert mRNA sequence
          Length = 1222

 Score =  270 bits (136), Expect = 2e-69
 Identities = 191/208 (91%), Gaps = 1/208 (0%)
 Strand = Plus / Minus

                                                                        
Query: 35   aagcagaagcagtgcttcacaagaccagtgtttgacacctgacaagaggggtttaattat 94
            ||||||||| |||||||||||||||||||  || || |||| ||||||| ||||||||||
Sbjct: 1082 aagcagaagtagtgcttcacaagaccagtacttaacgcctggcaagaggcgtttaattat 1023

                                                                        
Query: 95   gcatagttccatagccactatccatcacaaccatcagtcagtggtgcaaa-ctaaatggc 153
            |||||  |||| || |||||||||| |||||||||||||| ||| ||||| |||||||||
Sbjct: 1022 gcataactccagagtcactatccattacaaccatcagtcaatggggcaaaactaaatggc 963

                                                                        
Query: 154  agctggaataacagaggtaaaaatgcctgtcctggaagcaaaagatatgcttcaggacaa 213
            ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 962  agctggaataacagaggtaaagatgcctgccctggaagcaaaagatatgcttcaggacaa 903

                                        
Query: 214  gcacaaatcacaagaaatccgcttcttg 241
            ||||||||||||||||||||||||||||
Sbjct: 902  gcacaaatcacaagaaatccgcttcttg 875



to top

>ref|XM_369364.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
            (MG06100.4) partial mRNA
          Length = 4707

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 51   tcacaagaccagtgtttgac 70
            ||||||||||||||||||||
Sbjct: 2252 tcacaagaccagtgtttgac 2271



to top

>gb|AC122492.3| Mus musculus BAC clone RP24-390N7 from chromosome 5, complete sequence
          Length = 196275

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 90     attatgcatagttccatagccact 113
              |||||||||| |||||||||||||
Sbjct: 104127 attatgcataattccatagccact 104150



to top

>gb|AC160414.4| Mus musculus 10 BAC RP24-166O23 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 150002

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   aagcacaaatcacaagaaat 231
             ||||||||||||||||||||
Sbjct: 49248 aagcacaaatcacaagaaat 49267



to top

>gb|AC162308.2| Mus musculus BAC clone RP23-109E9 from chromosome 5, complete sequence
          Length = 218501

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 90    attatgcatagttccatagccact 113
             |||||||||| |||||||||||||
Sbjct: 19180 attatgcataattccatagccact 19203



to top

>emb|AL844891.7| Mouse DNA sequence from clone RP23-350N21 on chromosome 2, complete
             sequence
          Length = 138602

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   tcctggaagcaaaagatatg 202
             ||||||||||||||||||||
Sbjct: 86046 tcctggaagcaaaagatatg 86065


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,689,907
Number of Sequences: 3902068
Number of extensions: 2689907
Number of successful extensions: 49104
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49095
Number of HSP's gapped (non-prelim): 8
length of query: 244
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 222
effective length of database: 17,147,199,772
effective search space: 3806678349384
effective search space used: 3806678349384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top