Clone Name	rbags27p23
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY109312.1| Zea mays PCO060510 mRNA sequence	115	7e-23
2	gb|BT019322.1| Zea mays clone Contig1009.F mRNA sequence	107	2e-20
3	gb|AC123525.2| Oryza sativa (japonica cultivar-group) chromosome...	100	4e-18
4	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	100	4e-18
5	dbj|AK059550.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	4e-18
6	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	100	4e-18
7	gb|BT018137.1| Zea mays clone EL01N0554G07.c mRNA sequence	98	2e-17
8	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	98	2e-17
9	dbj|AK121503.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	2e-17
10	dbj|AK058697.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	2e-17
11	gb|AY104417.1| Zea mays PCO060511 mRNA sequence	98	2e-17
12	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	98	2e-17
13	emb|BX000495.1|CNS08CDL Oryza sativa chromosome 12, . BAC OSJNBb...	98	2e-17
14	gb|L36313.1|RICRPSAAA Oryza sativa ribosomal protein S16 mRNA, c...	92	1e-15
15	gb|AY237101.1| Ceratocystis pinicola strain CMW3273 SSR 13-A/P13...	86	6e-14
16	gb|AY237100.1| Ceratocystis laricicola strain CMW7760 SSR 13-A/P...	86	6e-14
17	gb|AY237099.1| Ceratocystis laricicola strain CMW7759 SSR 13-A/P...	86	6e-14
18	gb|AY237098.1| Ceratocystis laricicola strain CMW3221 SSR 13-A/P...	86	6e-14
19	gb|AY237097.1| Ceratocystis laricicola strain CMW4513 SSR 13-A/P...	86	6e-14
20	gb|AY237096.1| Ceratocystis polonica strain CMW7133 SSR 13-A/P13...	86	6e-14
21	gb|AY237095.1| Ceratocystis fujiensis strain CMW1969 SSR 13-A/P1...	86	6e-14
22	gb|AY237094.1| Ceratocystis laricicola strain CMW4546 SSR 13-A/P...	86	6e-14
23	gb|AY237093.1| Ceratocystis fujiensis strain CMW1952 SSR 13-A/P1...	86	6e-14
24	gb|AY237092.1| Ceratocystis polonica strain CMW2210 SSR 13-A/P13...	86	6e-14
25	gb|AY237091.1| Ceratocystis fujiensis strain CMW1965 SSR 13-A/P1...	86	6e-14
26	gb|AY237090.1| Ceratocystis polonica strain CMW5026 SSR 13-A/P13...	86	6e-14
27	gb|AY237089.1| Ceratocystis polonica strain CMW10522 SSR 13-A/P1...	86	6e-14
28	gb|AY237088.1| Ceratocystis polonica strain CMW7148 SSR 13-A/P13...	86	6e-14
29	ref|XM_384312.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	82	9e-13
30	dbj|AK063008.1| Oryza sativa (japonica cultivar-group) cDNA clon...	80	4e-12
31	emb|BX064533.1|CNS09LYH Single read from an extremity of a full-...	78	1e-11
32	emb|BX051989.1|CNS09CA1 Single read from an extremity of a full-...	78	1e-11
33	emb|BX072255.1|CNS09RWZ Single read from an extremity of a full-...	76	6e-11
34	emb|BX072254.1|CNS09RWY Single read from an extremity of a full-...	76	6e-11
35	emb|BX064532.1|CNS09LYG Single read from an extremity of a full-...	76	6e-11
36	emb|BX030891.1|CNS08VZZ Single read from an extremity of a full-...	76	6e-11
37	emb|BX030890.1|CNS08VZY Single read from an extremity of a full-...	76	6e-11
38	emb|BX039074.1|CNS092BA Single read from an extremity of a full-...	76	6e-11
39	emb|BX038852.1|CNS09254 Single read from an extremity of a full-...	76	6e-11
40	emb|BX038851.1|CNS09253 Single read from an extremity of a full-...	76	6e-11
41	emb|BX038681.1|CNS0920D Single read from an extremity of a full-...	76	6e-11
42	emb|BX038680.1|CNS0920C Single read from an extremity of a full-...	76	6e-11
43	emb|BX038653.1|CNS091ZL Single read from an extremity of a full-...	76	6e-11
44	emb|BX038455.1|CNS091U3 Single read from an extremity of a full-...	76	6e-11
45	emb|BX038385.1|CNS091S5 Single read from an extremity of a full-...	76	6e-11
46	emb|BX038384.1|CNS091S4 Single read from an extremity of a full-...	76	6e-11
47	emb|BX037956.1|CNS091G8 Single read from an extremity of a full-...	76	6e-11
48	emb|BX037878.1|CNS091E2 Single read from an extremity of a full-...	76	6e-11
49	emb|BX037877.1|CNS091E1 Single read from an extremity of a full-...	76	6e-11
50	emb|BX037828.1|CNS091CO Single read from an extremity of a full-...	76	6e-11
51	emb|BX037827.1|CNS091CN Single read from an extremity of a full-...	76	6e-11
52	emb|BX037504.1|CNS0913O Single read from an extremity of a full-...	76	6e-11
53	emb|BX037503.1|CNS0913N Single read from an extremity of a full-...	76	6e-11
54	emb|BX036295.1|CNS09063 Single read from an extremity of a full-...	76	6e-11
55	emb|BX036294.1|CNS09062 Single read from an extremity of a full-...	76	6e-11
56	emb|BX035879.1|CNS08ZUJ Single read from an extremity of a full-...	76	6e-11
57	emb|BX035878.1|CNS08ZUI Single read from an extremity of a full-...	76	6e-11
58	emb|BX034939.1|CNS08Z4F Single read from an extremity of a full-...	76	6e-11
59	emb|BX034938.1|CNS08Z4E Single read from an extremity of a full-...	76	6e-11
60	emb|BX031699.1|CNS08WMF Single read from an extremity of a full-...	76	6e-11
61	emb|BX031698.1|CNS08WME Single read from an extremity of a full-...	76	6e-11
62	emb|BX022322.1|CNS08PDY Single read from an extremity of a full-...	76	6e-11
63	emb|BX026325.1|CNS08SH5 Single read from an extremity of a full-...	76	6e-11
64	emb|BX026247.1|CNS08SEZ Single read from an extremity of a full-...	76	6e-11
65	emb|BX025803.1|CNS08S2N Single read from an extremity of a full-...	76	6e-11
66	emb|BX023016.1|CNS08PX8 Single read from an extremity of a full-...	76	6e-11
67	emb|BX023015.1|CNS08PX7 Single read from an extremity of a full-...	76	6e-11
68	emb|BX021670.1|CNS08OVU Single read from an extremity of a full-...	76	6e-11
69	emb|BX021669.1|CNS08OVT Single read from an extremity of a full-...	76	6e-11
70	emb|BX019175.1|CNS08MYJ Single read from an extremity of a full-...	76	6e-11
71	emb|BX019174.1|CNS08MYI Single read from an extremity of a full-...	76	6e-11
72	emb|BX015143.1|CNS08JUJ Single read from an extremity of a full-...	76	6e-11
73	emb|BX014635.1|CNS08JGF Single read from an extremity of a full-...	76	6e-11
74	emb|BX014634.1|CNS08JGE Single read from an extremity of a full-...	76	6e-11
75	emb|BX014848.1|CNS08JMC Single read from an extremity of a full-...	76	6e-11
76	emb|BX009344.1|CNS08FDG Single read from an extremity of a full-...	76	6e-11
77	emb|BX007708.1|CNS08E40 Single read from an extremity of a full-...	76	6e-11
78	emb|BX007707.1|CNS08E3Z Single read from an extremity of a full-...	76	6e-11
79	emb|BX007131.1|CNS08DNZ Single read from an extremity of a full-...	76	6e-11
80	emb|BX007130.1|CNS08DNY Single read from an extremity of a full-...	76	6e-11
81	emb|BX006524.1|CNS08D74 Single read from an extremity of a full-...	76	6e-11
82	ref|XM_317881.2| Anopheles gambiae str. PEST ENSANGP00000023979 ...	76	6e-11
83	ref|XM_959735.1| Neurospora crassa OR74A hypothetical protein (N...	74	2e-10
84	ref|XM_329743.1| Neurospora crassa OR74A hypothetical protein (N...	74	2e-10
85	gb|AF548333.1| Branchiostoma belcheri ribosomal protein S16 mRNA...	74	2e-10
86	gb|AF108725.1|AF108725 Tortula ruralis ribosomal protein S16 mRN...	74	2e-10
87	gb|AF031546.1|AF031546 Fritillaria agrestis ribosomal protein S1...	74	2e-10
88	emb|CR646979.2|CNS0EY6H Tetraodon nigroviridis full-length cDNA	72	9e-10
89	emb|BX038247.1|CNS091OB Single read from an extremity of a full-...	68	1e-08
90	emb|BX038246.1|CNS091OA Single read from an extremity of a full-...	68	1e-08
91	dbj|AB226287.1| Aspergillus oryzae cDNA, contig sequence: AoEST3148	68	1e-08
92	dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011	68	1e-08
93	emb|BX014849.1|CNS08JMD Single read from an extremity of a full-...	66	5e-08
94	emb|CR734184.2|CNS0GT9Z Tetraodon nigroviridis full-length cDNA	64	2e-07
95	emb|CR732180.2|CNS0GRW9 Tetraodon nigroviridis full-length cDNA	64	2e-07
96	emb|CR732179.2|CNS0GRW8 Tetraodon nigroviridis full-length cDNA	64	2e-07
97	emb|CR723130.2|CNS0GKWW Tetraodon nigroviridis full-length cDNA	64	2e-07
98	emb|CR717359.2|CNS0GGGL Tetraodon nigroviridis full-length cDNA	64	2e-07
99	emb|CR717160.2|CNS0GGB5 Tetraodon nigroviridis full-length cDNA	64	2e-07
100	emb|CR716239.2|CNS0GFLK Tetraodon nigroviridis full-length cDNA	64	2e-07
101	emb|CR712402.2|CNS0GCN2 Tetraodon nigroviridis full-length cDNA	64	2e-07
102	emb|CR713566.2|CNS0GDJE Tetraodon nigroviridis full-length cDNA	64	2e-07
103	emb|CR713293.2|CNS0GDBT Tetraodon nigroviridis full-length cDNA	64	2e-07
104	emb|CR712014.2|CNS0GCCA Tetraodon nigroviridis full-length cDNA	64	2e-07
105	emb|CR711296.2|CNS0GBSC Tetraodon nigroviridis full-length cDNA	64	2e-07
106	emb|CR710740.2|CNS0GBCW Tetraodon nigroviridis full-length cDNA	64	2e-07
107	emb|CR710700.2|CNS0GBBS Tetraodon nigroviridis full-length cDNA	64	2e-07
108	emb|CR710499.2|CNS0GB67 Tetraodon nigroviridis full-length cDNA	64	2e-07
109	emb|CR708931.2|CNS0G9YN Tetraodon nigroviridis full-length cDNA	64	2e-07
110	emb|CR706586.2|CNS0G85I Tetraodon nigroviridis full-length cDNA	64	2e-07
111	emb|CR706436.2|CNS0G81C Tetraodon nigroviridis full-length cDNA	64	2e-07
112	emb|CR705597.2|CNS0G7E1 Tetraodon nigroviridis full-length cDNA	64	2e-07
113	emb|CR703218.2|CNS0G5JY Tetraodon nigroviridis full-length cDNA	64	2e-07
114	emb|CR703056.2|CNS0G5FG Tetraodon nigroviridis full-length cDNA	64	2e-07
115	emb|CR702237.2|CNS0G4SP Tetraodon nigroviridis full-length cDNA	64	2e-07
116	emb|CR702038.2|CNS0G4N6 Tetraodon nigroviridis full-length cDNA	64	2e-07
117	emb|CR701622.2|CNS0G4BM Tetraodon nigroviridis full-length cDNA	64	2e-07
118	emb|CR701493.2|CNS0G481 Tetraodon nigroviridis full-length cDNA	64	2e-07
119	emb|CR699284.2|CNS0G2IO Tetraodon nigroviridis full-length cDNA	64	2e-07
120	emb|CR698880.2|CNS0G27G Tetraodon nigroviridis full-length cDNA	64	2e-07
121	emb|CR698008.2|CNS0G1J8 Tetraodon nigroviridis full-length cDNA	64	2e-07
122	emb|CR697231.2|CNS0G0XN Tetraodon nigroviridis full-length cDNA	64	2e-07
123	emb|CR697055.2|CNS0G0SR Tetraodon nigroviridis full-length cDNA	64	2e-07
124	emb|CR697049.2|CNS0G0SL Tetraodon nigroviridis full-length cDNA	64	2e-07
125	emb|CR696837.2|CNS0G0MP Tetraodon nigroviridis full-length cDNA	64	2e-07
126	emb|CR696830.2|CNS0G0MI Tetraodon nigroviridis full-length cDNA	64	2e-07
127	emb|CR696424.2|CNS0G0B8 Tetraodon nigroviridis full-length cDNA	64	2e-07
128	emb|CR692111.2|CNS0FWZF Tetraodon nigroviridis full-length cDNA	64	2e-07
129	emb|CR694888.2|CNS0FZ4K Tetraodon nigroviridis full-length cDNA	64	2e-07
130	emb|CR694766.2|CNS0FZ16 Tetraodon nigroviridis full-length cDNA	64	2e-07
131	emb|CR693312.2|CNS0FXWS Tetraodon nigroviridis full-length cDNA	64	2e-07
132	emb|CR691023.2|CNS0FW57 Tetraodon nigroviridis full-length cDNA	64	2e-07
133	emb|CR690676.2|CNS0FVVK Tetraodon nigroviridis full-length cDNA	64	2e-07
134	emb|CR689460.2|CNS0FUXS Tetraodon nigroviridis full-length cDNA	64	2e-07
135	emb|CR688086.2|CNS0FTVM Tetraodon nigroviridis full-length cDNA	64	2e-07
136	emb|CR687878.2|CNS0FTPU Tetraodon nigroviridis full-length cDNA	64	2e-07
137	emb|CR687812.2|CNS0FTO0 Tetraodon nigroviridis full-length cDNA	64	2e-07
138	emb|CR687195.2|CNS0FT6V Tetraodon nigroviridis full-length cDNA	64	2e-07
139	emb|CR685549.2|CNS0FRX5 Tetraodon nigroviridis full-length cDNA	64	2e-07
140	emb|CR684044.2|CNS0FQRC Tetraodon nigroviridis full-length cDNA	64	2e-07
141	emb|CR683363.2|CNS0FQ8F Tetraodon nigroviridis full-length cDNA	64	2e-07
142	emb|CR683881.2|CNS0FQMT Tetraodon nigroviridis full-length cDNA	64	2e-07
143	emb|CR683712.2|CNS0FQI4 Tetraodon nigroviridis full-length cDNA	64	2e-07
144	emb|CR683275.2|CNS0FQ5Z Tetraodon nigroviridis full-length cDNA	64	2e-07
145	emb|CR682983.2|CNS0FPXV Tetraodon nigroviridis full-length cDNA	64	2e-07
146	emb|CR681646.2|CNS0FOWQ Tetraodon nigroviridis full-length cDNA	64	2e-07
147	emb|CR678949.2|CNS0FMTT Tetraodon nigroviridis full-length cDNA	64	2e-07
148	emb|CR676704.2|CNS0FL3W Tetraodon nigroviridis full-length cDNA	64	2e-07
149	emb|CR675828.2|CNS0FKFU Tetraodon nigroviridis full-length cDNA	64	2e-07
150	emb|CR673268.2|CNS0FIGQ Tetraodon nigroviridis full-length cDNA	64	2e-07
151	emb|CR665562.2|CNS0FCIO Tetraodon nigroviridis full-length cDNA	64	2e-07
152	emb|CR656646.2|CNS0F5N0 Tetraodon nigroviridis full-length cDNA	64	2e-07
153	emb|CR654212.2|CNS0F3RE Tetraodon nigroviridis full-length cDNA	64	2e-07
154	emb|CR653084.2|CNS0F2W2 Tetraodon nigroviridis full-length cDNA	64	2e-07
155	emb|CR651756.2|CNS0F1V6 Tetraodon nigroviridis full-length cDNA	64	2e-07
156	emb|CR649446.2|CNS0F030 Tetraodon nigroviridis full-length cDNA	64	2e-07
157	emb|CR648325.2|CNS0EZ7V Tetraodon nigroviridis full-length cDNA	64	2e-07
158	emb|CR646916.2|CNS0EY4Q Tetraodon nigroviridis full-length cDNA	64	2e-07
159	emb|CR643106.2|CNS0EV6W Tetraodon nigroviridis full-length cDNA	64	2e-07
160	emb|CR646577.2|CNS0EXVB Tetraodon nigroviridis full-length cDNA	64	2e-07
161	emb|CR645508.2|CNS0EX1M Tetraodon nigroviridis full-length cDNA	64	2e-07
162	emb|CR645036.2|CNS0EWOI Tetraodon nigroviridis full-length cDNA	64	2e-07
163	emb|CR644748.2|CNS0EWGI Tetraodon nigroviridis full-length cDNA	64	2e-07
164	emb|CR644154.2|CNS0EW00 Tetraodon nigroviridis full-length cDNA	64	2e-07
165	emb|CR643276.2|CNS0EVBM Tetraodon nigroviridis full-length cDNA	64	2e-07
166	emb|CR639546.2|CNS0ESG0 Tetraodon nigroviridis full-length cDNA	64	2e-07
167	emb|CR639445.2|CNS0ESD7 Tetraodon nigroviridis full-length cDNA	64	2e-07
168	emb|CR638723.2|CNS0ERT5 Tetraodon nigroviridis full-length cDNA	64	2e-07
169	emb|CR638257.2|CNS0ERG7 Tetraodon nigroviridis full-length cDNA	64	2e-07
170	emb|CR636566.2|CNS0EQ58 Tetraodon nigroviridis full-length cDNA	64	2e-07
171	emb|CR635719.2|CNS0EPHP Tetraodon nigroviridis full-length cDNA	64	2e-07
172	emb|CR632848.2|CNS0EN9Y Tetraodon nigroviridis full-length cDNA	64	2e-07
173	emb|CR632791.2|CNS0EN8D Tetraodon nigroviridis full-length cDNA	64	2e-07
174	emb|CR634156.2|CNS0EOAA Tetraodon nigroviridis full-length cDNA	64	2e-07
175	emb|CR634104.2|CNS0EO8U Tetraodon nigroviridis full-length cDNA	64	2e-07
176	emb|CR634018.2|CNS0EO6G Tetraodon nigroviridis full-length cDNA	64	2e-07
177	emb|CR633553.2|CNS0ENTJ Tetraodon nigroviridis full-length cDNA	64	2e-07
178	emb|CR633492.2|CNS0ENRU Tetraodon nigroviridis full-length cDNA	64	2e-07
179	emb|CR633316.2|CNS0ENMY Tetraodon nigroviridis full-length cDNA	64	2e-07
180	emb|CR633312.2|CNS0ENMU Tetraodon nigroviridis full-length cDNA	64	2e-07
181	emb|CR633124.2|CNS0ENHM Tetraodon nigroviridis full-length cDNA	64	2e-07
182	emb|CR633110.2|CNS0ENH8 Tetraodon nigroviridis full-length cDNA	64	2e-07
183	emb|CR633076.2|CNS0ENGA Tetraodon nigroviridis full-length cDNA	64	2e-07
184	emb|CR633010.2|CNS0ENEG Tetraodon nigroviridis full-length cDNA	64	2e-07
185	emb|CR632943.2|CNS0ENCL Tetraodon nigroviridis full-length cDNA	64	2e-07
186	emb|CR632661.2|CNS0EN4R Tetraodon nigroviridis full-length cDNA	64	2e-07
187	emb|CR632649.2|CNS0EN4F Tetraodon nigroviridis full-length cDNA	64	2e-07
188	emb|CR632616.2|CNS0EN3I Tetraodon nigroviridis full-length cDNA	64	2e-07
189	emb|CR632534.2|CNS0EN18 Tetraodon nigroviridis full-length cDNA	64	2e-07
190	emb|CR632466.2|CNS0EMZC Tetraodon nigroviridis full-length cDNA	64	2e-07
191	emb|CR631280.2|CNS0EM2D Tetraodon nigroviridis full-length cDNA	64	2e-07
192	emb|CR631261.2|CNS0EM1U Tetraodon nigroviridis full-length cDNA	64	2e-07
193	emb|CR632253.2|CNS0EMTF Tetraodon nigroviridis full-length cDNA	64	2e-07
194	emb|CR632053.2|CNS0EMNV Tetraodon nigroviridis full-length cDNA	64	2e-07
195	emb|CR631900.2|CNS0EMJM Tetraodon nigroviridis full-length cDNA	64	2e-07
196	emb|CR631805.2|CNS0EMGZ Tetraodon nigroviridis full-length cDNA	64	2e-07
197	emb|CR631495.2|CNS0EM8D Tetraodon nigroviridis full-length cDNA	64	2e-07
198	emb|CR631491.2|CNS0EM89 Tetraodon nigroviridis full-length cDNA	64	2e-07
199	emb|CR631401.2|CNS0EM5Q Tetraodon nigroviridis full-length cDNA	64	2e-07
200	emb|CR631368.2|CNS0EM4T Tetraodon nigroviridis full-length cDNA	64	2e-07
201	emb|CR631719.2|CNS0EMEL Tetraodon nigroviridis full-length cDNA	64	2e-07
202	emb|CR631709.2|CNS0EMEB Tetraodon nigroviridis full-length cDNA	64	2e-07
203	emb|CR631576.2|CNS0EMAM Tetraodon nigroviridis full-length cDNA	64	2e-07
204	emb|CR631558.2|CNS0EMA4 Tetraodon nigroviridis full-length cDNA	64	2e-07
205	emb|CR631556.2|CNS0EMA2 Tetraodon nigroviridis full-length cDNA	64	2e-07
206	emb|CR631534.2|CNS0EM9G Tetraodon nigroviridis full-length cDNA	64	2e-07
207	gb|AY769332.1| Bombyx mori ribosomal protein S16 (RpS16) mRNA, c...	62	8e-07
208	ref|XM_359488.1| Magnaporthe grisea 70-15 hypothetical protein (...	62	8e-07
209	ref|XM_863757.1| Aspergillus nidulans FGSC A4 hypothetical prote...	62	8e-07
210	emb|CR681316.2|CNS0FONK Tetraodon nigroviridis full-length cDNA	62	8e-07
211	ref|NM_137841.2| Drosophila melanogaster Ribosomal protein S16 C...	62	8e-07
212	gb|AY070671.1| Drosophila melanogaster RH07540 full length cDNA	62	8e-07
213	gb|AC008349.2|AC008349 Drosophila melanogaster, chromosome 2R, r...	62	8e-07
214	gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, r...	62	8e-07
215	gb|AY849625.1| Magnaporthe grisea 40S ribosomal protein S16-like...	62	8e-07
216	gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66...	62	8e-07
217	gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 ...	62	8e-07
218	ref|XM_751490.1| Ustilago maydis 521 hypothetical protein (UM004...	60	3e-06
219	ref|XM_750289.1| Aspergillus fumigatus Af293 hypothetical protei...	60	3e-06
220	ref|XM_750290.1| Aspergillus fumigatus Af293 ribosomal protein S...	60	3e-06
221	gb|AY232065.1| Drosophila yakuba clone yak-ad_CG4046 mRNA sequence	60	3e-06
222	gb|AY231801.1| Drosophila yakuba clone yak-em_CG4046 mRNA sequence	60	3e-06
223	gb|AF481058.1| Aplysia californica 40S ribosomal protein S16 mRN...	58	1e-05
224	emb|BX009345.1|CNS08FDH Single read from an extremity of a full-...	58	1e-05
225	ref|XM_568864.1| Cryptococcus neoformans var. neoformans JEC21 P...	56	5e-05
226	emb|CR707780.2|CNS0G92O Tetraodon nigroviridis full-length cDNA	56	5e-05
227	emb|CR706059.2|CNS0G7QV Tetraodon nigroviridis full-length cDNA	56	5e-05
228	emb|CR632880.2|CNS0ENAU Tetraodon nigroviridis full-length cDNA	56	5e-05
229	emb|CR632826.2|CNS0EN9C Tetraodon nigroviridis full-length cDNA	56	5e-05
230	emb|CR632969.2|CNS0ENDB Tetraodon nigroviridis full-length cDNA	56	5e-05
231	ref|XM_774944.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	5e-05
232	gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr...	56	5e-05
233	gb|AF429981.1| Spodoptera frugiperda ribosomal protein S16 mRNA,...	56	5e-05
234	gb|AY826142.1| Aedes albopictus clone AL_16240 ribosomal protein...	54	2e-04
235	gb|AF402825.1| Ictalurus punctatus 40S ribosomal protein S16 mRN...	54	2e-04
236	gb|AE010438.1| Methanopyrus kandleri AV19 section 137 of 157 of ...	52	8e-04
237	gb|AY441131.1| Armigeres subalbatus ASAP ID: 43813 cytocolic sma...	50	0.003
238	gb|AY973262.1| Leishmania major ribosomal protein S16 mRNA, comp...	50	0.003
239	gb|AY552053.1| Aedes aegypti 40S ribosomal protein S16 mRNA, com...	50	0.003
240	emb|CR680913.2|CNS0FOCD Tetraodon nigroviridis full-length cDNA	50	0.003
241	emb|CR665912.2|CNS0FCSE Tetraodon nigroviridis full-length cDNA	50	0.003
242	emb|CR938218.1| Single read from an extremity of a full-length c...	50	0.003
243	emb|CR938207.1| Single read from an extremity of a full-length c...	50	0.003
244	emb|CR734548.2|CNS0GTK3 Tetraodon nigroviridis full-length cDNA	48	0.013
245	emb|CR708313.2|CNS0G9HH Tetraodon nigroviridis full-length cDNA	48	0.013
246	emb|CR706880.2|CNS0G8DO Tetraodon nigroviridis full-length cDNA	48	0.013
247	emb|CR704854.2|CNS0G6TE Tetraodon nigroviridis full-length cDNA	48	0.013
248	dbj|AB229616.1| Aspergillus oryzae cDNA, contig sequence: AoEST6498	48	0.013
249	gb|DQ066260.1| Ixodes scapularis isolate ISN-L-141 ribosomal pro...	48	0.013
250	emb|X51766.1|LPRPS16 L.polyphyllus mRNA for ribosomal protein S16	48	0.013
251	ref|NM_111294.2| Arabidopsis thaliana structural constituent of ...	46	0.050
252	gb|BC106273.1| Xenopus laevis cDNA clone MGC:130741 IMAGE:797379...	46	0.050
253	gb|AC016829.7|ATAC016829 Arabidopsis thaliana chromosome III BAC...	46	0.050
254	gb|AY027434.1| Heteropneustes fossilis ribosomal protein S16 mRN...	46	0.050
255	gb|BT004760.1| Arabidopsis thaliana At3g04230 gene, complete cds	46	0.050
256	gb|AF227979.1|AF227979 Euphorbia esula 40S ribosomal protein S16...	46	0.050
257	gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	44	0.20
258	ref|NM_209707.1| Eremothecium gossypii ADR258Wp (ADR258W), mRNA	44	0.20
259	ref|NM_121843.2| Arabidopsis thaliana structural constituent of ...	42	0.79
260	ref|NM_126785.1| Arabidopsis thaliana structural constituent of ...	42	0.79
261	ref|XM_805777.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	42	0.79
262	ref|XM_805778.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	42	0.79
263	ref|XM_807704.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	42	0.79
264	ref|XM_807705.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	42	0.79
265	ref|XM_965684.1| PREDICTED: Tribolium castaneum similar to CG404...	42	0.79
266	gb|AY059138.1| Arabidopsis thaliana putative 40S ribosomal prote...	42	0.79
267	gb|AF370178.1| Arabidopsis thaliana putative 40S ribosomal prote...	42	0.79
268	gb|AC113603.6| Homo sapiens chromosome 8, clone RP11-101N9, comp...	42	0.79
269	gb|AC116154.2| Homo sapiens chromosome 8, clone RP11-927P11, com...	42	0.79
270	gb|AC006586.10| Arabidopsis thaliana chromosome 2 clone F7B19 ma...	42	0.79
271	gb|AC068102.5| Homo sapiens chromosome 8, clone RP11-333M8, comp...	42	0.79
272	ref|NM_001018885.1| Schizosaccharomyces pombe 972h- hypothetical...	42	0.79
273	emb|AL115540.1|CNS01CHO Botrytis cinerea strain T4 cDNA library	42	0.79
274	emb|AL116027.1|CNS01CV7 Botrytis cinerea strain T4 cDNA library	42	0.79
275	emb|AL116332.1|CNS01D3O Botrytis cinerea strain T4 cDNA library	42	0.79
276	emb|AL115098.1|CNS01C5E Botrytis cinerea strain T4 cDNA library	42	0.79
277	emb|AL114740.1|CNS01BVG Botrytis cinerea strain T4 cDNA library	42	0.79
278	emb|AL113863.1|CNS01B73 Botrytis cinerea strain T4 cDNA library	42	0.79
279	emb|AL113835.1|CNS01B6B Botrytis cinerea strain T4 cDNA library	42	0.79
280	emb|AL113498.1|CNS01AWY Botrytis cinerea strain T4 cDNA library	42	0.79
281	emb|AL112570.1|CNS01A76 Botrytis cinerea strain T4 cDNA library	42	0.79
282	emb|AL112258.1|CNS019YI Botrytis cinerea strain T4 cDNA library	42	0.79
283	emb|AL112243.1|CNS019Y3 Botrytis cinerea strain T4 cDNA library	42	0.79
284	emb|AL111821.1|CNS019MD Botrytis cinerea strain T4 cDNA library	42	0.79
285	emb|AL111328.1|CNS0198O Botrytis cinerea strain T4 cDNA library	42	0.79
286	gb|AF370576.1|AF370576 Arabidopsis thaliana 40S ribosomal protei...	42	0.79
287	emb|BX832108.1|CNS0A14L Arabidopsis thaliana Full-length cDNA Co...	42	0.79
288	emb|BX833964.1|CNS0A0JO Arabidopsis thaliana Full-length cDNA Co...	42	0.79
289	emb|BX833744.1|CNS0A0ER Arabidopsis thaliana Full-length cDNA Co...	42	0.79
290	gb|AY086902.1| Arabidopsis thaliana clone 29241 mRNA, complete s...	42	0.79
291	gb|AC051626.5|AC051626 Genomic Sequence For Arabidopsis thaliana...	42	0.79
292	dbj|AK118167.1| Arabidopsis thaliana mRNA, clone: RAFL19-48-K20	42	0.79
293	dbj|AP004389.2| Homo sapiens genomic DNA, chromosome 8q23, clone...	42	0.79
294	ref|NM_184333.2| Oryza sativa (japonica cultivar-group), mRNA	40	3.1
295	gb|AY618105.1| Sterkiella histriomuscorum clone UGC1O0005_E09_R ...	40	3.1
296	gb|AY618090.1| Sterkiella histriomuscorum clone UGC1O0004_I02_R ...	40	3.1
297	gb|AY617498.1| Sterkiella histriomuscorum clone UGC1O0002_N01_R ...	40	3.1
298	ref|XM_458833.1| Debaryomyces hansenii CBS767 hypothetical prote...	40	3.1
299	gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosom...	40	3.1
300	gb|AC153865.3| Mus musculus BAC RP23-373P9 (Roswell Park Cancer...	40	3.1
301	gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosom...	40	3.1
302	emb|Z78413.1|CET01C3 Caenorhabditis elegans Cosmid T01C3, comple...	40	3.1
303	ref|XM_949425.1| Theileria annulata strain Ankara 40s ribosomal ...	40	3.1
304	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	3.1
305	gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete s...	40	3.1
306	emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS...	40	3.1
307	gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold	40	3.1
308	ref|NM_001021636.1| Schizosaccharomyces pombe 972h- hypothetical...	40	3.1
309	ref|NM_074289.3| Caenorhabditis elegans Ribosomal Protein, Small...	40	3.1
310	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	40	3.1
311	gb|AC084193.5| Homo sapiens BAC clone RP11-545M11 from 2, comple...	40	3.1
312	gb|AC130784.3| Atelerix albiventris clone LB4-112D1, complete se...	40	3.1
313	emb|BX005472.11| Zebrafish DNA sequence from clone CH211-119C22 ...	40	3.1
314	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	40	3.1
315	dbj|AP003311.2| Oryza sativa (japonica cultivar-group) genomic D...	40	3.1
316	dbj|AK104051.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	3.1
317	dbj|AK068113.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	3.1
318	dbj|AK058909.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	3.1
319	gb|AC145597.4| Mus musculus BAC clone RP24-323M2 from Y, complet...	40	3.1
320	emb|AJ488155.1|PDA488155 Pachymedusa dacnicolor partial mRNA for...	40	3.1
321	dbj|AB017604.1| Schizosaccharomyces pombe mRNA for ribosomal pro...	40	3.1

---

>gb|AY109312.1| Zea mays PCO060510 mRNA sequence
          Length = 778

 Score =  115 bits (58), Expect = 7e-23
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||||||||||||||||||||| |  |||||||| ||||||||||||||||||||||||
Sbjct: 527 gctcaacggtaggacttctggaacctggcgcgggcgccgcgaccaccgaacttcttcggc 468

                                     
Query: 211 tcgcagcggcgcgggtcggcgacgag 236
           |||||||| |  ||||||||||||||
Sbjct: 467 tcgcagcgcctggggtcggcgacgag 442

---

>gb|BT019322.1| Zea mays clone Contig1009.F mRNA sequence
          Length = 674

 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||||||||||||||||||||| |  |||||||| || |||||||||||||||||||||
Sbjct: 429 gctcaacggtaggacttctggaacctggcgcgggcgccacgaccaccgaacttcttcggc 370

                                     
Query: 211 tcgcagcggcgcgggtcggcgacgag 236
           |||||||| |  ||||||||||||||
Sbjct: 369 tcgcagcgcctggggtcggcgacgag 344

---

>gb|AC123525.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0056E15,
              complete sequence
          Length = 147941

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 151    gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
              ||||||||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 103614 gctcaacggtacgacttctggaacctggcgcgggcgccgcgaccaccgaacttcttgggc 103555

                                        
Query: 211    tcgcagcggcgcgggtcggcgacgag 236
              |||||||| |  ||||||||||||||
Sbjct: 103554 tcgcagcgcctggggtcggcgacgag 103529

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                           
Query: 151     gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
               ||||||||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 1287001 gctcaacggtacgacttctggaacctggcgcgggcgccgcgaccaccgaacttcttgggc 1287060

                                         
Query: 211     tcgcagcggcgcgggtcggcgacgag 236
               |||||||| |  ||||||||||||||
Sbjct: 1287061 tcgcagcgcctggggtcggcgacgag 1287086

---

>dbj|AK059550.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-G01, full
           insert sequence
          Length = 800

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||||||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 532 gctcaacggtacgacttctggaacctggcgcgggcgccgcgaccaccgaacttcttgggc 473

                                     
Query: 211 tcgcagcggcgcgggtcggcgacgag 236
           |||||||| |  ||||||||||||||
Sbjct: 472 tcgcagcgcctggggtcggcgacgag 447

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                           
Query: 151     gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
               ||||||||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 1284722 gctcaacggtacgacttctggaacctggcgcgggcgccgcgaccaccgaacttcttgggc 1284781

                                         
Query: 211     tcgcagcggcgcgggtcggcgacgag 236
               |||||||| |  ||||||||||||||
Sbjct: 1284782 tcgcagcgcctggggtcggcgacgag 1284807

---

>gb|BT018137.1| Zea mays clone EL01N0554G07.c mRNA sequence
          Length = 767

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||||||||| ||||||||||| |  ||||||||||| || || |||||||||||||||
Sbjct: 499 gctcaacggtacgacttctggaacctggcgcgggcaccacgtccgccgaacttcttcggc 440

                                        
Query: 211 tcgcagcggcgcgggtcggcgacgaggag 239
           |||||||| || ||||| |||||||||||
Sbjct: 439 tcgcagcgccgggggtcagcgacgaggag 411

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Plus

                                                                           
Query: 151     gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
               ||||| ||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 1168926 gctcagcggtacgacttctggaaccttgcgcgggcgccgcgaccaccgaacttcttgggc 1168985

                                            
Query: 211     tcgcagcggcgcgggtcggcgacgaggag 239
               |||||||| |  |||||||||||||||||
Sbjct: 1168986 tcgcagcgcctggggtcggcgacgaggag 1169014

---

>dbj|AK121503.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033022H12, full
           insert sequence
          Length = 714

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||| ||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 535 gctcagcggtacgacttctggaaccttgcgcgggcgccgcgaccaccgaacttcttgggc 476

                                        
Query: 211 tcgcagcggcgcgggtcggcgacgaggag 239
           |||||||| |  |||||||||||||||||
Sbjct: 475 tcgcagcgcctggggtcggcgacgaggag 447

---

>dbj|AK058697.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-B10, full
           insert sequence
          Length = 723

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||| ||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 531 gctcagcggtacgacttctggaaccttgcgcgggcgccgcgaccaccgaacttcttgggc 472

                                        
Query: 211 tcgcagcggcgcgggtcggcgacgaggag 239
           |||||||| |  |||||||||||||||||
Sbjct: 471 tcgcagcgcctggggtcggcgacgaggag 443

---

>gb|AY104417.1| Zea mays PCO060511 mRNA sequence
          Length = 795

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||||||||| ||||||||||| |  ||||||||||| || || |||||||||||||||
Sbjct: 497 gctcaacggtacgacttctggaacctggcgcgggcaccacgtccgccgaacttcttcggc 438

                                        
Query: 211 tcgcagcggcgcgggtcggcgacgaggag 239
           |||||||| || ||||| |||||||||||
Sbjct: 437 tcgcagcgccgggggtcagcgacgaggag 409

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Plus

                                                                           
Query: 151     gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
               ||||| ||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 1168926 gctcagcggtacgacttctggaaccttgcgcgggcgccgcgaccaccgaacttcttgggc 1168985

                                            
Query: 211     tcgcagcggcgcgggtcggcgacgaggag 239
               |||||||| |  |||||||||||||||||
Sbjct: 1168986 tcgcagcgcctggggtcggcgacgaggag 1169014

---

>emb|BX000495.1|CNS08CDL Oryza sativa chromosome 12, . BAC OSJNBb0119L20 of library OSJNBb from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 126974

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 79/89 (88%)
 Strand = Plus / Plus

                                                                          
Query: 151    gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
              ||||| ||||| ||||||||||| |  |||||||| |||||||||||||||||||| |||
Sbjct: 107909 gctcagcggtacgacttctggaaccttgcgcgggcgccgcgaccaccgaacttcttgggc 107968

                                           
Query: 211    tcgcagcggcgcgggtcggcgacgaggag 239
              |||||||| |  |||||||||||||||||
Sbjct: 107969 tcgcagcgcctggggtcggcgacgaggag 107997

---

>gb|L36313.1|RICRPSAAA Oryza sativa ribosomal protein S16 mRNA, complete cds
          Length = 687

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 151 gctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggc 210
           ||||||||||| ||||||||||| |  |||||||| | |||||||||||||||||| |||
Sbjct: 521 gctcaacggtacgacttctggaacctggcgcgggcccggcgaccaccgaacttcttgggc 462

                                     
Query: 211 tcgcagcggcgcgggtcggcgacgag 236
           |||||||| |  ||||||||||||||
Sbjct: 461 tcgcagcgcctggggtcggcgacgag 436

---

>gb|AY237101.1| Ceratocystis pinicola strain CMW3273 SSR 13-A/P13-B sequence
          Length = 318

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 251 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 310

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 311 agcggcg 317

---

>gb|AY237100.1| Ceratocystis laricicola strain CMW7760 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237099.1| Ceratocystis laricicola strain CMW7759 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237098.1| Ceratocystis laricicola strain CMW3221 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237097.1| Ceratocystis laricicola strain CMW4513 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237096.1| Ceratocystis polonica strain CMW7133 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237095.1| Ceratocystis fujiensis strain CMW1969 SSR 13-A/P13-B sequence
          Length = 305

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 238 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 297

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 298 agcggcg 304

---

>gb|AY237094.1| Ceratocystis laricicola strain CMW4546 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237093.1| Ceratocystis fujiensis strain CMW1952 SSR 13-A/P13-B sequence
          Length = 305

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 238 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 297

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 298 agcggcg 304

---

>gb|AY237092.1| Ceratocystis polonica strain CMW2210 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237091.1| Ceratocystis fujiensis strain CMW1965 SSR 13-A/P13-B sequence
          Length = 305

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 238 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 297

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 298 agcggcg 304

---

>gb|AY237090.1| Ceratocystis polonica strain CMW5026 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237089.1| Ceratocystis polonica strain CMW10522 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>gb|AY237088.1| Ceratocystis polonica strain CMW7148 SSR 13-A/P13-B sequence
          Length = 303

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| |||| || ||||||||| |||||||||||||||| |||||||
Sbjct: 236 aacggtaagacttctggtaacgggcacgggcaccgggaccaccgaacttcttgggctcgc 295

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 296 agcggcg 302

---

>ref|XM_384312.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG04136.1)
           partial mRNA
          Length = 432

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||||| || || ||||||||| |||||||||||||||| |||||||
Sbjct: 430 aacggtaagacttctggaagcgggcacgggcaccgggaccaccgaacttcttgggctcgc 371

                                    
Query: 215 agcggcgcgggtcggcgacgaggag 239
           | |||||   |||||| ||||||||
Sbjct: 370 aacggcggttgtcggcaacgaggag 346

---

>dbj|AK063008.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-A01, full
           insert sequence
          Length = 599

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| |||||||||||||| || || || |   |||||||||||||||| | |||||
Sbjct: 458 aacggtacgacttctggaaacgagcacgcgcgctcggaccaccgaacttcttggcctcgc 399

                                       
Query: 215 agcggcgcgggtcggcgacgaggagcgt 242
           |||| ||||||||||||||||| |||||
Sbjct: 398 agcgacgcgggtcggcgacgagaagcgt 371

---

>emb|BX064533.1|CNS09LYH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 251 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 310

                      
Query: 215 agcggcgcggg 225
           |||| ||||||
Sbjct: 311 agcgacgcggg 321

---

>emb|BX051989.1|CNS09CA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 221 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 280

                      
Query: 215 agcggcgcggg 225
           |||| ||||||
Sbjct: 281 agcgacgcggg 291

---

>emb|BX072255.1|CNS09RWZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 271 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 330

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 331 agcgacgcgg 340

---

>emb|BX072254.1|CNS09RWY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 498 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 439

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 438 agcgacgcgg 429

---

>emb|BX064532.1|CNS09LYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 565

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 479 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 420

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 419 agcgacgcgg 410

---

>emb|BX030891.1|CNS08VZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 254 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 313

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 314 agcgacgcgg 323

---

>emb|BX030890.1|CNS08VZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 476 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 417

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 416 agcgacgcgg 407

---

>emb|BX039074.1|CNS092BA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 498 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 439

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 438 agcgacgcgg 429

---

>emb|BX038852.1|CNS09254 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 286 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 345

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 346 agcgacgcgg 355

---

>emb|BX038851.1|CNS09253 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 677

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 486 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 427

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 426 agcgacgcgg 417

---

>emb|BX038681.1|CNS0920D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 287 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 346

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 347 agcgacgcgg 356

---

>emb|BX038680.1|CNS0920C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 471 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 412

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 411 agcgacgcgg 402

---

>emb|BX038653.1|CNS091ZL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 494 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 435

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 434 agcgacgcgg 425

---

>emb|BX038455.1|CNS091U3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 405

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 209 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 150

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 149 agcgacgcgg 140

---

>emb|BX038385.1|CNS091S5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 679

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 287 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 346

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 347 agcgacgcgg 356

---

>emb|BX038384.1|CNS091S4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 468 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 409

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 408 agcgacgcgg 399

---

>emb|BX037956.1|CNS091G8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 496 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 437

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 436 agcgacgcgg 427

---

>emb|BX037878.1|CNS091E2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 279 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 338

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 339 agcgacgcgg 348

---

>emb|BX037877.1|CNS091E1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 495 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 436

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 435 agcgacgcgg 426

---

>emb|BX037828.1|CNS091CO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 620

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 282 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 341

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 342 agcgacgcgg 351

---

>emb|BX037827.1|CNS091CN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 495 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 436

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 435 agcgacgcgg 426

---

>emb|BX037504.1|CNS0913O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 275 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 334

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 335 agcgacgcgg 344

---

>emb|BX037503.1|CNS0913N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 494 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 435

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 434 agcgacgcgg 425

---

>emb|BX036295.1|CNS09063 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 239 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 298

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 299 agcgacgcgg 308

---

>emb|BX036294.1|CNS09062 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 777

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 483 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 424

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 423 agcgacgcgg 414

---

>emb|BX035879.1|CNS08ZUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 792

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 254 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 313

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 314 agcgacgcgg 323

---

>emb|BX035878.1|CNS08ZUI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 487 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 428

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 427 agcgacgcgg 418

---

>emb|BX034939.1|CNS08Z4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 416

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 235 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 294

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 295 agcgacgcgg 304

---

>emb|BX034938.1|CNS08Z4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 462 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 403

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 402 agcgacgcgg 393

---

>emb|BX031699.1|CNS08WMF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 766

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 240 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 299

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 300 agcgacgcgg 309

---

>emb|BX031698.1|CNS08WME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 471 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 412

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 411 agcgacgcgg 402

---

>emb|BX022322.1|CNS08PDY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 438 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 379

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 378 agcgacgcgg 369

---

>emb|BX026325.1|CNS08SH5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 770

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 471 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 412

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 411 agcgacgcgg 402

---

>emb|BX026247.1|CNS08SEZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 468 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 409

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 408 agcgacgcgg 399

---

>emb|BX025803.1|CNS08S2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 620

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 316 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 257

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 256 agcgacgcgg 247

---

>emb|BX023016.1|CNS08PX8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 445

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 242 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 301

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 302 agcgacgcgg 311

---

>emb|BX023015.1|CNS08PX7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 473 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 414

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 413 agcgacgcgg 404

---

>emb|BX021670.1|CNS08OVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 596

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 239 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 298

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 299 agcgacgcgg 308

---

>emb|BX021669.1|CNS08OVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 473 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 414

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 413 agcgacgcgg 404

---

>emb|BX019175.1|CNS08MYJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 229 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 288

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 289 agcgacgcgg 298

---

>emb|BX019174.1|CNS08MYI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 462 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 403

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 402 agcgacgcgg 393

---

>emb|BX015143.1|CNS08JUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 474 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 415

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 414 agcgacgcgg 405

---

>emb|BX014635.1|CNS08JGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 493

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 254 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 313

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 314 agcgacgcgg 323

---

>emb|BX014634.1|CNS08JGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 569

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 482 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 423

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 422 agcgacgcgg 413

---

>emb|BX014848.1|CNS08JMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 460 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 401

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 400 agcgacgcgg 391

---

>emb|BX009344.1|CNS08FDG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 464 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 405

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 404 agcgacgcgg 395

---

>emb|BX007708.1|CNS08E40 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 415

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 253 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 312

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 313 agcgacgcgg 322

---

>emb|BX007707.1|CNS08E3Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 474 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 415

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 414 agcgacgcgg 405

---

>emb|BX007131.1|CNS08DNZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 262 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 321

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 322 agcgacgcgg 331

---

>emb|BX007130.1|CNS08DNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 777

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 484 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 425

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 424 agcgacgcgg 415

---

>emb|BX006524.1|CNS08D74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 474 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 415

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 414 agcgacgcgg 405

---

>ref|XM_317881.2| Anopheles gambiae str. PEST ENSANGP00000023979
           (ENSANGG00000017534), partial mRNA
          Length = 696

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| |||||||||||||||||||
Sbjct: 445 aacggtaagacttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgc 386

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 385 agcgacgcgg 376

---

>ref|XM_959735.1| Neurospora crassa OR74A hypothetical protein (NCU08620.1) partial
           mRNA
          Length = 429

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||||| || | |||||||||   ||||||||||||||| |||||||
Sbjct: 427 aacggtaggacttctggaagcgagagcgggcacccttaccaccgaacttcttgggctcgc 368

                                    
Query: 215 agcggcgcgggtcggcgacgaggag 239
           | || |  || ||||||||||||||
Sbjct: 367 aacgtctgggatcggcgacgaggag 343

---

>ref|XM_329743.1| Neurospora crassa OR74A hypothetical protein (NCU08620.1) partial
           mRNA
          Length = 429

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 73/85 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||||| || | |||||||||   ||||||||||||||| |||||||
Sbjct: 427 aacggtaggacttctggaagcgagagcgggcacccttaccaccgaacttcttgggctcgc 368

                                    
Query: 215 agcggcgcgggtcggcgacgaggag 239
           | || |  || ||||||||||||||
Sbjct: 367 aacgtctgggatcggcgacgaggag 343

---

>gb|AF548333.1| Branchiostoma belcheri ribosomal protein S16 mRNA, complete cds
          Length = 531

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 153 tcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctc 212
           ||||||||| ||||||||| | || || ||||||||| |||||||||||||||| |||||
Sbjct: 466 tcaacggtacgacttctggtagcgtgcacgggcaccgggaccaccgaacttcttgggctc 407

                                
Query: 213 gcagcggcgcgggtcggcgac 233
            | |||||| || ||||||||
Sbjct: 406 tctgcggcgaggatcggcgac 386

---

>gb|AF108725.1|AF108725 Tortula ruralis ribosomal protein S16 mRNA, complete cds
          Length = 585

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 150 agctcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcgg 209
           |||| ||||||| ||||||||||| ||||  | ||| ||||| || ||||||||||| ||
Sbjct: 465 agcttaacggtacgacttctggaagcgcgacctggcgccgcggcctccgaacttcttggg 406

                                            
Query: 210 ctcgcagcggcgcgggtcggcgacgaggagcgt 242
           |||||||||||| ||||| ||||| || |||||
Sbjct: 405 ctcgcagcggcgggggtccgcgaccagcagcgt 373

---

>gb|AF031546.1|AF031546 Fritillaria agrestis ribosomal protein S16 (rps16) mRNA, complete
           cds
          Length = 660

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                       
Query: 153 tcaacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctc 212
           ||||||||||||||||||||| || | ||| ||||| || ||||| ||||||||||||||
Sbjct: 486 tcaacggtaggacttctggaaccgggagcgagcaccacgcccaccaaacttcttcggctc 427

                    
Query: 213 gcagcggcg 221
           ||| |||||
Sbjct: 426 gcaccggcg 418

---

>emb|CR646979.2|CNS0EY6H Tetraodon nigroviridis full-length cDNA
          Length = 559

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||| | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccgggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|BX038247.1|CNS091OB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 687

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 61/70 (87%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| | |||||||||||||||||
Sbjct: 272 aacggtaagacttctggtagcgggcgcgggcacctggaccgctgaacttcttcggctcgc 331

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 332 agcgacgcgg 341

---

>emb|BX038246.1|CNS091OA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || |||||||||||  |||| | |||||||||||||||||
Sbjct: 495 aacggtaagacttctggtagcgggcgcgggcacctggaccgctgaacttcttcggctcgc 436

                     
Query: 215 agcggcgcgg 224
           |||| |||||
Sbjct: 435 agcgacgcgg 426

---

>dbj|AB226287.1| Aspergillus oryzae cDNA, contig sequence: AoEST3148
          Length = 945

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctc 212
           |||||||||| |||||| | |  ||||||||||||||||||||||||||||| |||||
Sbjct: 526 aacggtaggatttctggtacctggcgcgggcaccgcgaccaccgaacttcttgggctc 469

---

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                         
Query: 155     aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctc 212
               |||||||||| |||||| | |  ||||||||||||||||||||||||||||| |||||
Sbjct: 1494347 aacggtaggatttctggtacctggcgcgggcaccgcgaccaccgaacttcttgggctc 1494290

---

>emb|BX014849.1|CNS08JMD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 127

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 164 acttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgcagcggcgcg 223
           |||||||| | || |||||||||||  |||| ||||||||||||||||||||||| ||||
Sbjct: 1   acttctggtagcgggcgcgggcacctggaccgccgaacttcttcggctcgcagcgacgcg 60

            
Query: 224 g 224
           |
Sbjct: 61  g 61

---

>emb|CR734184.2|CNS0GT9Z Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR732180.2|CNS0GRW9 Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR732179.2|CNS0GRW8 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR723130.2|CNS0GKWW Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR717359.2|CNS0GGGL Tetraodon nigroviridis full-length cDNA
          Length = 607

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 568 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 509

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 508 agcggcgtggatcggc 493

---

>emb|CR717160.2|CNS0GGB5 Tetraodon nigroviridis full-length cDNA
          Length = 481

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 440 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 381

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 380 agcggcgtggatcggc 365

---

>emb|CR716239.2|CNS0GFLK Tetraodon nigroviridis full-length cDNA
          Length = 507

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR712402.2|CNS0GCN2 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR713566.2|CNS0GDJE Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR713293.2|CNS0GDBT Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR712014.2|CNS0GCCA Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR711296.2|CNS0GBSC Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR710740.2|CNS0GBCW Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR710700.2|CNS0GBBS Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR710499.2|CNS0GB67 Tetraodon nigroviridis full-length cDNA
          Length = 481

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 440 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 381

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 380 agcggcgtggatcggc 365

---

>emb|CR708931.2|CNS0G9YN Tetraodon nigroviridis full-length cDNA
          Length = 505

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 466 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 407

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 406 agcggcgtggatcggc 391

---

>emb|CR706586.2|CNS0G85I Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR706436.2|CNS0G81C Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 475 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 416

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 415 agcggcgtggatcggc 400

---

>emb|CR705597.2|CNS0G7E1 Tetraodon nigroviridis full-length cDNA
          Length = 508

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 470 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 411

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 410 agcggcgtggatcggc 395

---

>emb|CR703218.2|CNS0G5JY Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR703056.2|CNS0G5FG Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR702237.2|CNS0G4SP Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR702038.2|CNS0G4N6 Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR701622.2|CNS0G4BM Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR701493.2|CNS0G481 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR699284.2|CNS0G2IO Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR698880.2|CNS0G27G Tetraodon nigroviridis full-length cDNA
          Length = 476

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 444 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 385

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 384 agcggcgtggatcggc 369

---

>emb|CR698008.2|CNS0G1J8 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR697231.2|CNS0G0XN Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR697055.2|CNS0G0SR Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR697049.2|CNS0G0SL Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR696837.2|CNS0G0MP Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR696830.2|CNS0G0MI Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR696424.2|CNS0G0B8 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR692111.2|CNS0FWZF Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR694888.2|CNS0FZ4K Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR694766.2|CNS0FZ16 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR693312.2|CNS0FXWS Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR691023.2|CNS0FW57 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR690676.2|CNS0FVVK Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR689460.2|CNS0FUXS Tetraodon nigroviridis full-length cDNA
          Length = 517

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR688086.2|CNS0FTVM Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR687878.2|CNS0FTPU Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR687812.2|CNS0FTO0 Tetraodon nigroviridis full-length cDNA
          Length = 507

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 468 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 409

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 408 agcggcgtggatcggc 393

---

>emb|CR687195.2|CNS0FT6V Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR685549.2|CNS0FRX5 Tetraodon nigroviridis full-length cDNA
          Length = 507

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 468 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 409

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 408 agcggcgtggatcggc 393

---

>emb|CR684044.2|CNS0FQRC Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR683363.2|CNS0FQ8F Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR683881.2|CNS0FQMT Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR683712.2|CNS0FQI4 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR683275.2|CNS0FQ5Z Tetraodon nigroviridis full-length cDNA
          Length = 556

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 468 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 409

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 408 agcggcgtggatcggc 393

---

>emb|CR682983.2|CNS0FPXV Tetraodon nigroviridis full-length cDNA
          Length = 542

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 503 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 444

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 443 agcggcgtggatcggc 428

---

>emb|CR681646.2|CNS0FOWQ Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR678949.2|CNS0FMTT Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR676704.2|CNS0FL3W Tetraodon nigroviridis full-length cDNA
          Length = 508

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 469 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 410

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 409 agcggcgtggatcggc 394

---

>emb|CR675828.2|CNS0FKFU Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR673268.2|CNS0FIGQ Tetraodon nigroviridis full-length cDNA
          Length = 556

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR665562.2|CNS0FCIO Tetraodon nigroviridis full-length cDNA
          Length = 502

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 465 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 406

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 405 agcggcgtggatcggc 390

---

>emb|CR656646.2|CNS0F5N0 Tetraodon nigroviridis full-length cDNA
          Length = 559

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR654212.2|CNS0F3RE Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR653084.2|CNS0F2W2 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR651756.2|CNS0F1V6 Tetraodon nigroviridis full-length cDNA
          Length = 508

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 471 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 412

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 411 agcggcgtggatcggc 396

---

>emb|CR649446.2|CNS0F030 Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR648325.2|CNS0EZ7V Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR646916.2|CNS0EY4Q Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR643106.2|CNS0EV6W Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR646577.2|CNS0EXVB Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR645508.2|CNS0EX1M Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR645036.2|CNS0EWOI Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR644748.2|CNS0EWGI Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR644154.2|CNS0EW00 Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR643276.2|CNS0EVBM Tetraodon nigroviridis full-length cDNA
          Length = 494

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 468 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 409

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 408 agcggcgtggatcggc 393

---

>emb|CR639546.2|CNS0ESG0 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR639445.2|CNS0ESD7 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR638723.2|CNS0ERT5 Tetraodon nigroviridis full-length cDNA
          Length = 507

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 468 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 409

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 408 agcggcgtggatcggc 393

---

>emb|CR638257.2|CNS0ERG7 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR636566.2|CNS0EQ58 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR635719.2|CNS0EPHP Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632848.2|CNS0EN9Y Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR632791.2|CNS0EN8D Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR634156.2|CNS0EOAA Tetraodon nigroviridis full-length cDNA
          Length = 507

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 470 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 411

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 410 agcggcgtggatcggc 395

---

>emb|CR634104.2|CNS0EO8U Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR634018.2|CNS0EO6G Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR633553.2|CNS0ENTJ Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR633492.2|CNS0ENRU Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR633316.2|CNS0ENMY Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR633312.2|CNS0ENMU Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR633124.2|CNS0ENHM Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR633110.2|CNS0ENH8 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR633076.2|CNS0ENGA Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR633010.2|CNS0ENEG Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632943.2|CNS0ENCL Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632661.2|CNS0EN4R Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632649.2|CNS0EN4F Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632616.2|CNS0EN3I Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR632534.2|CNS0EN18 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632466.2|CNS0EMZC Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631280.2|CNS0EM2D Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631261.2|CNS0EM1U Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR632253.2|CNS0EMTF Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632053.2|CNS0EMNV Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631900.2|CNS0EMJM Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631805.2|CNS0EMGZ Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631495.2|CNS0EM8D Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631491.2|CNS0EM89 Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631401.2|CNS0EM5Q Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR631368.2|CNS0EM4T Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631719.2|CNS0EMEL Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631709.2|CNS0EMEB Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR631576.2|CNS0EMAM Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631558.2|CNS0EMA4 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631556.2|CNS0EMA2 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR631534.2|CNS0EM9G Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>gb|AY769332.1| Bombyx mori ribosomal protein S16 (RpS16) mRNA, complete cds
          Length = 639

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 181 cgggcaccgcgaccaccgaacttcttcggctcgcagcggcgcgggtc 227
           ||||||||  |||||||||||||||| ||||||||||| ||||||||
Sbjct: 497 cgggcacctggaccaccgaacttcttgggctcgcagcgacgcgggtc 451

---

>ref|XM_359488.1| Magnaporthe grisea 70-15 hypothetical protein (MG05289.4) partial
           mRNA
          Length = 246

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||||| |  | |||||||||| |||| ||||||||||| |||||||
Sbjct: 244 aacggtaagacttctggaacctggagcgggcaccgggaccgccgaacttcttgggctcgc 185

                  
Query: 215 agcggcg 221
           | |||||
Sbjct: 184 aacggcg 178

---

>ref|XM_863757.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN9468.2), mRNA
          Length = 468

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcg 213
           |||||||||| |||||| | |  ||||| ||||||||||||||||||||||| ||||||
Sbjct: 466 aacggtaggatttctggtacctggcgcgagcaccgcgaccaccgaacttcttgggctcg 408

---

>emb|CR681316.2|CNS0FONK Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 156 acggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgca 215
           |||||||||||||||| | || |||||||| ||  | |||||||||||||| | ||||||
Sbjct: 471 acggtaggacttctggtagcgagcgcgggctccaggtccaccgaacttcttggactcgca 412

                          
Query: 216 gcggcgcgggtcggc 230
           |||||| || |||||
Sbjct: 411 gcggcgtggatcggc 397

---

>ref|NM_137841.2| Drosophila melanogaster Ribosomal protein S16 CG4046-RA (RpS16),
           mRNA
          Length = 585

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || || ||||||||  |||| ||||||||||| |||||||
Sbjct: 482 aacggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgc 423

                              
Query: 215 agcggcgcgggtcggcgac 233
           |||| ||||| ||| ||||
Sbjct: 422 agcgacgcggatcgccgac 404

---

>gb|AY070671.1| Drosophila melanogaster RH07540 full length cDNA
          Length = 596

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||| | || || ||||||||  |||| ||||||||||| |||||||
Sbjct: 482 aacggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgc 423

                              
Query: 215 agcggcgcgggtcggcgac 233
           |||| ||||| ||| ||||
Sbjct: 422 agcgacgcggatcgccgac 404

---

>gb|AC008349.2|AC008349 Drosophila melanogaster, chromosome 2R, region 58E-58E, BAC clone
              BACR01E01, complete sequence
          Length = 173373

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                          
Query: 155    aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
              ||||||| ||||||||| | || || ||||||||  |||| ||||||||||| |||||||
Sbjct: 163465 aacggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgc 163406

                                 
Query: 215    agcggcgcgggtcggcgac 233
              |||| ||||| ||| ||||
Sbjct: 163405 agcgacgcggatcgccgac 163387

---

>gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, region 58E-59A, BAC clone
            BACR11M08, complete sequence
          Length = 169534

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                        
Query: 155  aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
            ||||||| ||||||||| | || || ||||||||  |||| ||||||||||| |||||||
Sbjct: 3663 aacggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgc 3604

                               
Query: 215  agcggcgcgggtcggcgac 233
            |||| ||||| ||| ||||
Sbjct: 3603 agcgacgcggatcgccgac 3585

---

>gb|AY849625.1| Magnaporthe grisea 40S ribosomal protein S16-like protein mRNA,
           complete cds
          Length = 927

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||||| |  | |||||||||| |||| ||||||||||| |||||||
Sbjct: 532 aacggtaagacttctggaacctggagcgggcaccgggaccgccgaacttcttgggctcgc 473

                  
Query: 215 agcggcg 221
           | |||||
Sbjct: 472 aacggcg 466

---

>gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66 of 73 of the complete
             sequence
          Length = 302225

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                         
Query: 155   aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
             ||||||| ||||||||| | || || ||||||||  |||| ||||||||||| |||||||
Sbjct: 14145 aacggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgc 14086

                                
Query: 215   agcggcgcgggtcggcgac 233
             |||| ||||| ||| ||||
Sbjct: 14085 agcgacgcggatcgccgac 14067

---

>gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 DS00837 (D87)), complete
             sequence
          Length = 81677

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                         
Query: 155   aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
             ||||||| ||||||||| | || || ||||||||  |||| ||||||||||| |||||||
Sbjct: 50404 aacggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgc 50463

                                
Query: 215   agcggcgcgggtcggcgac 233
             |||| ||||| ||| ||||
Sbjct: 50464 agcgacgcggatcgccgac 50482

---

>ref|XM_751490.1| Ustilago maydis 521 hypothetical protein (UM00436.1) partial mRNA
          Length = 600

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           |||||||||| ||||||  ||| || || |||||| |||||||||||||||| |||||  
Sbjct: 598 aacggtaggatttctggcgacgagcacgcgcaccgtgaccaccgaacttcttgggctccg 539

                             
Query: 215 agcggcgcgggtcggcga 232
           | ||||||| ||||||||
Sbjct: 538 atcggcgcgtgtcggcga 521

---

>ref|XM_750289.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g10490)
           partial mRNA
          Length = 597

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctc 212
           |||||||||| |||||| | |  || |||||||||||||||||||||||||| |||||
Sbjct: 63  aacggtaggatttctggtacctggcacgggcaccgcgaccaccgaacttcttgggctc 120

---

>ref|XM_750290.1| Aspergillus fumigatus Af293 ribosomal protein S9 (Afu2g10500)
           partial mRNA
          Length = 432

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctc 212
           |||||||||| |||||| | |  || |||||||||||||||||||||||||| |||||
Sbjct: 430 aacggtaggatttctggtacctggcacgggcaccgcgaccaccgaacttcttgggctc 373

---

>gb|AY232065.1| Drosophila yakuba clone yak-ad_CG4046 mRNA sequence
          Length = 444

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 156 acggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgca 215
           |||||| ||||||||| | || || ||||||||  |||| ||||||||||| ||||||||
Sbjct: 444 acggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgca 385

                             
Query: 216 gcggcgcgggtcggcgac 233
           ||| ||||| ||| ||||
Sbjct: 384 gcgacgcggatcgccgac 367

---

>gb|AY231801.1| Drosophila yakuba clone yak-em_CG4046 mRNA sequence
          Length = 444

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 156 acggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgca 215
           |||||| ||||||||| | || || ||||||||  |||| ||||||||||| ||||||||
Sbjct: 444 acggtacgacttctggtagcgagcacgggcacctggaccgccgaacttcttgggctcgca 385

                             
Query: 216 gcggcgcgggtcggcgac 233
           ||| ||||| ||| ||||
Sbjct: 384 gcgacgcggatcgccgac 367

---

>gb|AF481058.1| Aplysia californica 40S ribosomal protein S16 mRNA, partial cds
          Length = 231

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| || |||||| |||| |||||||| ||| |||| || |||||||| |||||||
Sbjct: 229 aacggtaagatttctggtaacgagcgcgggctccgggacctccaaacttcttgggctcgc 170

                        
Query: 215 agcggcgcgggtc 227
           |||| | ||||||
Sbjct: 169 agcgcctcgggtc 157

---

>emb|BX009345.1|CNS08FDH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 309

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 57/65 (87%), Gaps = 1/65 (1%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcggg-caccgcgaccaccgaacttcttcggctcg 213
           ||||||| ||||||||| | || ||||||| ||||  |||| ||||||||||||||||||
Sbjct: 241 aacggtaagacttctggtagcgggcgcggggcacctggaccgccgaacttcttcggctcg 300

                
Query: 214 cagcg 218
           |||||
Sbjct: 301 cagcg 305

---

>ref|XM_568864.1| Cryptococcus neoformans var. neoformans JEC21 PRCDNA95 (CNB02750)
           partial mRNA
          Length = 549

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 181 cgggcaccgcgaccaccgaacttcttcggctc 212
           |||||||||||||||||||||||||| |||||
Sbjct: 395 cgggcaccgcgaccaccgaacttcttgggctc 364

---

>emb|CR707780.2|CNS0G92O Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || || ||||| ||  | |||||||||||||| | |||||
Sbjct: 470 aacggtaggacttctggtagcgagcacgggctccaggtccaccgaacttcttggactcgc 411

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 410 agcggcgtggatcggc 395

---

>emb|CR706059.2|CNS0G7QV Tetraodon nigroviridis full-length cDNA
          Length = 483

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || || ||||| ||  | |||||||||||||| | |||||
Sbjct: 444 aacggtaggacttctggtagcgagcacgggctccaggtccaccgaacttcttggactcgc 385

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 384 agcggcgtggatcggc 369

---

>emb|CR632880.2|CNS0ENAU Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || || ||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcacgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>emb|CR632826.2|CNS0EN9C Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           |||||||||||||||||   || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 472 aacggtaggacttctggtggcgagcgcgggctccaggtccaccgaacttcttggactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR632969.2|CNS0ENDB Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || || ||||| ||  | |||||||||||||| | |||||
Sbjct: 473 aacggtaggacttctggtagcgagcacgggctccaggtccaccgaacttcttggactcgc 414

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 413 agcggcgtggatcggc 398

---

>ref|XM_774944.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S16, transcript variant 1 (LOC577040), mRNA
          Length = 638

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || || ||||| ||  ||||||| |||||||| |||||||
Sbjct: 453 aacggtaggacttctggtagcgggcacgggctcctggaccaccaaacttcttgggctcgc 394

               
Query: 215 agcg 218
           ||||
Sbjct: 393 agcg 390

---

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
              sequence
          Length = 1632307

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                              
Query: 181    cgggcaccgcgaccaccgaacttcttcggctc 212
              |||||||||||||||||||||||||| |||||
Sbjct: 818895 cgggcaccgcgaccaccgaacttcttgggctc 818864

---

>gb|AF429981.1| Spodoptera frugiperda ribosomal protein S16 mRNA, complete cds
          Length = 594

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| || |||||| | || ||||| |||||  |||||||||||||||| |||||||
Sbjct: 478 aacggtaagatttctggtagcgggcgcgagcacctggaccaccgaacttcttgggctcgc 419

               
Query: 215 agcg 218
           ||||
Sbjct: 418 agcg 415

---

>gb|AY826142.1| Aedes albopictus clone AL_16240 ribosomal protein S16 mRNA,
           complete cds
          Length = 519

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 157 cggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgca 215
           ||||| || |||||| |||| |||||||||||  |||| |||||||||||||| |||||
Sbjct: 443 cggtacgatttctggtaacgagcgcgggcacctggacctccgaacttcttcggttcgca 385

---

>gb|AF402825.1| Ictalurus punctatus 40S ribosomal protein S16 mRNA, complete cds
          Length = 533

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || ||||| || ||  |||| ||||||||||| | |||||
Sbjct: 445 aacggtaggacttctggtagcgagcgcgagctcctggacctccgaacttcttggactcgc 386

                  
Query: 215 agcggcg 221
           |||||||
Sbjct: 385 agcggcg 379

---

>gb|AE010438.1| Methanopyrus kandleri AV19 section 137 of 157 of the complete genome
          Length = 13816

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 183   ggcaccgcgaccaccgaacttcttcggctc 212
             ||||||||| ||||||||||||||||||||
Sbjct: 13315 ggcaccgcggccaccgaacttcttcggctc 13286

---

>gb|AY441131.1| Armigeres subalbatus ASAP ID: 43813 cytocolic small ribosomal
           subunit S9 mRNA sequence
          Length = 674

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           |||| || ||||| ||| | || |||||||||||  |||| |||||||||||||| ||||
Sbjct: 478 aacgrtacgacttytggtagcgagcgcgggcacctggacctccgaacttcttcggttcgc 419

            
Query: 215 a 215
           |
Sbjct: 418 a 418

---

>gb|AY973262.1| Leishmania major ribosomal protein S16 mRNA, complete cds
          Length = 450

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 200 acttcttcggctcgcagcggcgcgggtcggcga 232
           |||||||||||||||||||||| || |||||||
Sbjct: 403 acttcttcggctcgcagcggcggggatcggcga 371

---

>gb|AY552053.1| Aedes aegypti 40S ribosomal protein S16 mRNA, complete cds
          Length = 674

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| || |||||| | || |||||||||||  |||| |||||||||||||| ||||
Sbjct: 474 aacggtacgatttctggtagcgagcgcgggcacctggacctccgaacttcttcggttcgc 415

            
Query: 215 a 215
           |
Sbjct: 414 a 414

---

>emb|CR680913.2|CNS0FOCD Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 65/77 (84%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgg-gcaccgcgaccaccgaacttcttcggctcg 213
           ||||||||||||||||| | || |||||| || ||  | |||||||||||||| | ||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcggcgctccaggtccaccgaacttcttggactcg 414

                            
Query: 214 cagcggcgcgggtcggc 230
           |||||||| || |||||
Sbjct: 413 cagcggcgtggatcggc 397

---

>emb|CR665912.2|CNS0FCSE Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 65/77 (84%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcggg-caccgcgaccaccgaacttcttcggctcg 213
           ||||||||||||||||| | || ||||||| | ||  | |||||||||||||| | ||||
Sbjct: 473 aacggtaggacttctggtagcgagcgcggggctccaggtccaccgaacttcttggactcg 414

                            
Query: 214 cagcggcgcgggtcggc 230
           |||||||| || |||||
Sbjct: 413 cagcggcgtggatcggc 397

---

>emb|CR938218.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YG17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 673

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| || |||||| | || |||||||||||  |||| |||||||||||||| ||||
Sbjct: 477 aacggtacgatttctggtagcgagcgcgggcacctggacctccgaacttcttcggttcgc 418

            
Query: 215 a 215
           |
Sbjct: 417 a 417

---

>emb|CR938207.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YH01BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 696

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| || |||||| | || |||||||||||  |||| |||||||||||||| ||||
Sbjct: 183 aacggtacgatttctggtagcgagcgcgggcacctggacctccgaacttcttcggttcgc 242

            
Query: 215 a 215
           |
Sbjct: 243 a 243

---

>emb|CR734548.2|CNS0GTK3 Tetraodon nigroviridis full-length cDNA
          Length = 511

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||  | || |||||||| ||    |||||||||||||||  |||||
Sbjct: 472 aacggtaggacttctgttagcgagcgcgggctccagttccaccgaacttcttccactcgc 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>emb|CR708313.2|CNS0G9HH Tetraodon nigroviridis full-length cDNA
          Length = 479

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || || ||||| ||  | |||||||||||||| | ||| |
Sbjct: 440 aacggtaggacttctggtagcgagcacgggctccaggtccaccgaacttcttggactcac 381

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 380 agcggcgtggatcggc 365

---

>emb|CR706880.2|CNS0G8DO Tetraodon nigroviridis full-length cDNA
          Length = 671

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||| ||| | || |||||||| ||  | |||||||||||||| | |||||
Sbjct: 535 aacggtaggacttttggtagcgagcgcgggctccaggtccaccgaacttcttggactcgc 476

                           
Query: 215 agcggcgcgggtcggc 230
           | ||||| || |||||
Sbjct: 475 atcggcgtggatcggc 460

---

>emb|CR704854.2|CNS0G6TE Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||||||||||||| | || || ||||| ||  | |||||||||||||| | ||| |
Sbjct: 472 aacggtaggacttctggtagcgagcacgggctccaggtccaccgaacttcttggactcac 413

                           
Query: 215 agcggcgcgggtcggc 230
           ||||||| || |||||
Sbjct: 412 agcggcgtggatcggc 397

---

>dbj|AB229616.1| Aspergillus oryzae cDNA, contig sequence: AoEST6498
          Length = 358

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 178 gcgcgggcaccgcgaccaccgaac 201
           ||||||||||||||||||||||||
Sbjct: 24  gcgcgggcaccgcgaccaccgaac 1

---

>gb|DQ066260.1| Ixodes scapularis isolate ISN-L-141 ribosomal protein S16 mRNA,
           complete cds
          Length = 447

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           |||| ||||| |||||| | || ||||| || ||| | |||||||||||||| |||||||
Sbjct: 445 aacgataggatttctggtagcgagcgcgtgctccgggtccaccgaacttcttgggctcgc 386

               
Query: 215 agcg 218
           ||||
Sbjct: 385 agcg 382

---

>emb|X51766.1|LPRPS16 L.polyphyllus mRNA for ribosomal protein S16
          Length = 588

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 aacggtaggacttctggaaacgcgcgcgggcaccgcgaccaccgaacttcttcggctcgc 214
           ||||||| ||||||||||| |  || || ||||| |||||||| |||||||| ||||| |
Sbjct: 441 aacggtaagacttctggaacctagcacgagcaccacgaccaccaaacttctttggctcac 382

               
Query: 215 agcg 218
           ||||
Sbjct: 381 agcg 378


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,563,751
Number of Sequences: 3902068
Number of extensions: 2563751
Number of successful extensions: 45970
Number of sequences better than 10.0: 321
Number of HSP's better than 10.0 without gapping: 320
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 45366
Number of HSP's gapped (non-prelim): 601
length of query: 242
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 220
effective length of database: 17,147,199,772
effective search space: 3772383949840
effective search space used: 3772383949840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---