ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags28e21 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds Length = 1630 Score = 854 bits (431), Expect = 0.0 Identities = 431/431 (100%) Strand = Plus / Minus Query: 24 caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 83 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1394 caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 1335 Query: 84 atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 143 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1334 atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 1275 Query: 144 aactggaaggcttcgacgcgtagctatgcaaaggaagcagccagccggagccggcggctc 203 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1274 aactggaaggcttcgacgcgtagctatgcaaaggaagcagccagccggagccggcggctc 1215 Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1214 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 1155 Query: 264 cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1154 cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 1095 Query: 324 atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1094 atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 1035 Query: 384 ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 443 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1034 ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 975 Query: 444 cctcggaggac 454 ||||||||||| Sbjct: 974 cctcggaggac 964
>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds Length = 1791 Score = 846 bits (427), Expect = 0.0 Identities = 430/431 (99%) Strand = Plus / Minus Query: 24 caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 83 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1334 caagaacacacaaacataaacacaacgcacgctgtatacagaaaagtgtccccgacacag 1275 Query: 84 atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 143 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1274 atgaaatcagaggcaacgtttcgttcagcttcatcttattattgaatgaagatcacgtgg 1215 Query: 144 aactggaaggcttcgacgcgtagctatgcaaaggaagcagccagccggagccggcggctc 203 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1214 aactggaaggcttcgacgcgtagctatgcaaagaaagcagccagccggagccggcggctc 1155 Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1154 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 1095 Query: 264 cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1094 cggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcccggcccgt 1035 Query: 324 atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1034 atgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtggccgccgg 975 Query: 384 ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 443 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 974 ggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgt 915 Query: 444 cctcggaggac 454 ||||||||||| Sbjct: 914 cctcggaggac 904
>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 945 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 885 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 825 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 765 tcccgcccatgccgtcgtcctcggaggac 737
>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 947 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 887 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 827 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 767 tcccgcccatgccgtcgtcctcggaggac 739
>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 945 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 885 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 825 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 765 tcccgcccatgccgtcgtcctcggaggac 737
>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 945 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 885 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 825 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 765 tcccgcccatgccgtcgtcctcggaggac 737
>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9) gene, complete cds Length = 992 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 992 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 933 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 932 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 873 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 872 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 813 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 812 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 753 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 752 tcccgcccatgccgtcgtcctcggaggac 724
>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9) gene, complete cds Length = 994 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 994 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 935 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 934 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 875 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 874 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 815 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 814 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 755 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 754 tcccgcccatgccgtcgtcctcggaggac 726
>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 945 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 885 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 825 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 765 tcccgcccatgccgtcgtcctcggaggac 737
>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9) gene, complete cds Length = 1000 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1000 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 941 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 940 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 881 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 880 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 821 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 820 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 761 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 760 tcccgcccatgccgtcgtcctcggaggac 732
>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1005 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 946 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 945 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 886 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 885 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 826 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 825 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 766 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 765 tcccgcccatgccgtcgtcctcggaggac 737
>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 947 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 887 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 827 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 767 tcccgcccatgccgtcgtcctcggaggac 739
>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 947 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 887 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 827 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 767 tcccgcccatgccgtcgtcctcggaggac 739
>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9) gene, complete cds Length = 1004 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1004 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 945 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 944 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 885 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 884 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 825 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 824 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 765 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 764 tcccgcccatgccgtcgtcctcggaggac 736
>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 947 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 887 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 827 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 767 tcccgcccatgccgtcgtcctcggaggac 739
>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1001 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 942 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 882 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 822 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 821 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 762 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 761 tcccgcccatgccgtcgtcctcggaggac 733
>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 533 bits (269), Expect = e-148 Identities = 269/269 (100%) Strand = Plus / Minus Query: 186 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1007 agccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccatgatcc 948 Query: 246 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 947 ccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccag 888 Query: 306 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 887 ttccagttcccggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggt 828 Query: 366 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 827 tgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 768 Query: 426 tcccgcccatgccgtcgtcctcggaggac 454 ||||||||||||||||||||||||||||| Sbjct: 767 tcccgcccatgccgtcgtcctcggaggac 739
>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e Length = 751 Score = 327 bits (165), Expect = 2e-86 Identities = 203/216 (93%) Strand = Plus / Minus Query: 256 gccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcc 315 ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| || Sbjct: 439 gccggcgccggccattcctgcgtggccttgctgcccgtaggctccaccagttccagtccc 380 Query: 316 cggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtg 375 ||||||||| |||||||| || || || || ||||||||||||||||||||||||||||| Sbjct: 379 cggcccgtaggctcctccagtccctgtaccagtcgccatgtgctgctggttgtccttgtg 320 Query: 376 gccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccat 435 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 319 gccgccggggagcttctccttgatcttctctttcatgcccttcttcctcctcccgcccat 260 Query: 436 gccgtcgtcctcggaggacgagctntagctggagct 471 ||||||||||||||| |||||||| |||||||||| Sbjct: 259 gccgtcgtcctcggaagacgagctggagctggagct 224 Score = 260 bits (131), Expect = 4e-66 Identities = 208/231 (90%), Gaps = 7/231 (3%) Strand = Plus / Minus Query: 41 aaacacaacgcacgctgtatacagaaaagtgtccccgacacagatgaaatcagaggcaac 100 |||||| |||||||||||||||||||||||||||| |||||||| || ||||||| ||| Sbjct: 673 aaacacgacgcacgctgtatacagaaaagtgtccctgacacagacgagatcagagacaag 614 Query: 101 gtttcgttcagcttcatcttattatt---gaatgaa--gatcacgtggaactggaaggct 155 |||||||| |||||||||||||||| ||| || |||||||||||||| |||||| Sbjct: 613 ttttcgttctgcttcatcttattattattgaacaaaaagatcacgtggaactagaaggca 554 Query: 156 tcgacgcgt--agctatgcaaaggaagcagccagccggagccggcggctcagtgctgtcc 213 | ||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||| Sbjct: 553 ttgacgcgtgtagctatgcaaaggaagcggccagccggagccgtcggctcagtgctgtcc 494 Query: 214 cggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgcc 264 ||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 493 cggcagcttctccttaatcttgtccatgatccccttcttctcgccggtgcc 443
>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab Length = 781 Score = 319 bits (161), Expect = 5e-84 Identities = 202/216 (93%) Strand = Plus / Minus Query: 256 gccggtgccggccattcctgcgtgcccttgctgcccgtaggctccaccagttccagttcc 315 ||||| |||||||||||||| ||| |||||||||||||||||||||||||| |||||||| Sbjct: 408 gccggcgccggccattcctgtgtggccttgctgcccgtaggctccaccagtcccagttcc 349 Query: 316 cggcccgtatgctcctccggttccagtccccgtcgccatgtgctgctggttgtccttgtg 375 ||||||||| |||||||| || || |||||||||||||| |||||||||||||||||||| Sbjct: 348 cggcccgtaggctcctccagtccctgtccccgtcgccatatgctgctggttgtccttgtg 289 Query: 376 gccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccat 435 ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 288 gccaccggggagcttctccttgatcttctccttcatgcccttctttctcctcccgcccat 229 Query: 436 gccgtcgtcctcggaggacgagctntagctggagct 471 ||||||||||||||| |||||||| |||||||||| Sbjct: 228 gccgtcgtcctcggaagacgagctggagctggagct 193 Score = 264 bits (133), Expect = 2e-67 Identities = 204/225 (90%), Gaps = 7/225 (3%) Strand = Plus / Minus Query: 43 acacaacgcacgctgtatacagaaaagtgtccccgacacagatgaaatcagaggcaacgt 102 ||||||||||||||||||||||||||||||||| ||| | |||| ||||||| |||| | Sbjct: 632 acacaacgcacgctgtatacagaaaagtgtccctgacgcggatgcgatcagagacaactt 573 Query: 103 ttcgttcagcttcatcttattatt---gaatgaagatcacgtggaactggaaggcttcga 159 |||||||||||||||||||||||| ||| ||||||||||||||||||||||||| || Sbjct: 572 ttcgttcagcttcatcttattattattgaacaaagatcacgtggaactggaaggctttga 513 Query: 160 cgcgtagctatgcaaaggaagcagccagccggagccggcggctcagtgctgtcccggcag 219 | |||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| Sbjct: 512 cccgtagctac---aaggaagcagccagccgga-ccggtggctcagtgctgtcccggcag 457 Query: 220 cttctccttgatcttgtccatgatccccttcttctcgccggtgcc 264 ||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 456 cttctccttgatcttgtccatgatccccttcttctcgcccgtgcc 412 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||||||| ||| | || ||||||||| Sbjct: 458 agcttctccttgatcttgtccatgatccccttcttc 423
>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds Length = 1124 Score = 159 bits (80), Expect = 1e-35 Identities = 94/99 (94%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 366 gtggccaccggggagcttctccttgatcttctccttcatgcccttctttctcctcccgcc 307 Query: 433 catgccgtcgtcctcggaggacgagctntagctggagct 471 |||||||||||||||||| |||||||| |||||||||| Sbjct: 306 catgccgtcgtcctcggaagacgagctggagctggagct 268 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 782 gctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttctcgccg 723 Query: 260 gtg 262 ||| Sbjct: 722 gtg 720 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 767 gggagcttctccttgatcttgtccatgatgcccttcttc 729 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 608 ccggtgccggccatcccggtgtggccttgctgtccgtagg 569
>gb|AY266052.1| Deschampsia antarctica dehydrin-like protein pseudogene, partial sequence Length = 454 Score = 143 bits (72), Expect = 6e-31 Identities = 99/108 (91%) Strand = Plus / Minus Query: 341 gtccccgtcgccatgtgctgctggttgtccttgtggccgccggggagcttctccttgatc 400 |||||||| |||||||||||||||||||| |||||||| || || | ||||||||||||| Sbjct: 329 gtccccgtggccatgtgctgctggttgtctttgtggccaccaggaatcttctccttgatc 270 Query: 401 ttctccttcatgcccttcttcctcctcccgcccatgccgtcgtcctcg 448 || || |||||||| ||||||||||||||||||||||||||||||||| Sbjct: 269 ttatctttcatgcctttcttcctcctcccgcccatgccgtcgtcctcg 222 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 256 gccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 ||||||||||| ||||||| ||||||||||||||||||||| Sbjct: 396 gccggtgccggtcattccttcgtgcccttgctgcccgtagg 356 Score = 46.1 bits (23), Expect = 0.10 Identities = 42/47 (89%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgcc 264 ||||||||||| ||||||||||||| || ||||||||||| ||||| Sbjct: 451 agcttctcctt-atcttgtccatgagtcctttcttctcgcctgtgcc 406
>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene, partial sequence Length = 4636 Score = 137 bits (69), Expect = 4e-29 Identities = 84/89 (94%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 418 |||||||||||||||||||| ||||| ||||||||||||||||||||||| || |||||| Sbjct: 1372 tgctggttgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttc 1313 Query: 419 ttcctcctcccgcccatgccgtcgtcctc 447 |||||||| |||||||||||||||||||| Sbjct: 1312 ttcctccttccgcccatgccgtcgtcctc 1284 Score = 97.6 bits (49), Expect = 3e-17 Identities = 58/61 (95%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||| Sbjct: 1509 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtgc 1450 Query: 264 c 264 | Sbjct: 1449 c 1449 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||| ||||||||| Sbjct: 1348 ggcagcttctccttgatcttctccttgattcccttcttc 1310 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | ||||| |||||| Sbjct: 1501 ccgggcagcttctccttgatcttgtccatgatgcctttcttc 1460
>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds Length = 549 Score = 137 bits (69), Expect = 4e-29 Identities = 84/89 (94%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 418 |||||||||||||||||||| ||||| ||||||||||||||||||||||| || |||||| Sbjct: 186 tgctggttgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttc 127 Query: 419 ttcctcctcccgcccatgccgtcgtcctc 447 |||||||| |||||||||||||||||||| Sbjct: 126 ttcctccttccgcccatgccgtcgtcctc 98 Score = 97.6 bits (49), Expect = 3e-17 Identities = 58/61 (95%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||| Sbjct: 320 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtgc 261 Query: 264 c 264 | Sbjct: 260 c 260 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||| ||||||||| Sbjct: 162 ggcagcttctccttgatcttctccttgattcccttcttc 124 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | ||||| |||||| Sbjct: 312 ccgggcagcttctccttgatcttgtccatgatgcctttcttc 271
>emb|AJ622891.1| Triticum durum partial mRNA for DRP4 protein (drg4 gene) Length = 221 Score = 133 bits (67), Expect = 6e-28 Identities = 84/90 (93%) Strand = Plus / Minus Query: 382 ggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtc 441 |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| Sbjct: 221 ggggagcttctccttgatcttctccttcattcccttcttcttcctcccgcccatgccgtc 162 Query: 442 gtcctcggaggacgagctntagctggagct 471 |||||| || |||||||| |||||||||| Sbjct: 161 gtcctccgaagacgagctggagctggagct 132 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttct 254 ||||||||||||||||| ||| | || |||||||||| Sbjct: 217 agcttctccttgatcttctccttcattcccttcttct 181
>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds Length = 616 Score = 131 bits (66), Expect = 2e-27 Identities = 92/100 (92%), Gaps = 3/100 (3%) Strand = Plus / Minus Query: 354 tgtgctgctggttg---tccttgtggccgccggggagcttctccttgatcttctccttca 410 |||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||| | Sbjct: 367 tgtgctgctggttgccatccttgttgcctccggggagcttctccttgatcttctccttga 308 Query: 411 tgcccttcttcctcctcccgcccatgccgtcgtcctcgga 450 |||| |||||||||||||||||||||||||| |||||||| Sbjct: 307 tgcctttcttcctcctcccgcccatgccgtcatcctcgga 268 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||||| || || ||||||||||||||||||||||||| ||||||||||| ||||||| Sbjct: 499 agtgctgcccgggaagcttctccttgatcttgtccatgagtcccttcttctctccggtgc 440 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| || |||||| Sbjct: 332 agcttctccttgatcttctccttgatgcctttcttc 297
>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full insert sequence Length = 795 Score = 131 bits (66), Expect = 2e-27 Identities = 106/119 (89%), Gaps = 3/119 (2%) Strand = Plus / Minus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 407 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 348 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctcggaggacgagctntagctggagct 471 ||||||||||||||||| ||||| ||||||||||| || |||||||| |||| ||||| Sbjct: 347 cccttcttcctcctccctcccatcccgtcgtcctcagacgacgagctggagcttgagct 289 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||| || || ||||| ||||||||||||||||||| |||||||||||||||||| Sbjct: 571 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 513 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 374 agcttctccttgatcttctccttgattcccttcttc 339
>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene) Length = 852 Score = 129 bits (65), Expect = 9e-27 Identities = 83/89 (93%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 418 ||||||| |||||||||||| ||||| ||||||||||||||||||||||| || |||||| Sbjct: 433 tgctggtcgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttc 374 Query: 419 ttcctcctcccgcccatgccgtcgtcctc 447 |||||||| |||||||||||||||||||| Sbjct: 373 ttcctccttccgcccatgccgtcgtcctc 345 Score = 89.7 bits (45), Expect = 8e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 |||||||||||||| ||||||||||| |||||||||||||| || || |||||||||||| Sbjct: 601 gctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgccg 542 Query: 260 gtgcc 264 ||||| Sbjct: 541 gtgcc 537 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||| ||||||||| Sbjct: 409 ggcagcttctccttgatcttctccttgattcccttcttc 371
>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 125 bits (63), Expect = 1e-25 Identities = 75/79 (94%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgc 431 ||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 383 tgtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgc 324 Query: 432 ccatgccgtcgtcctcgga 450 ||||||| ||||||||||| Sbjct: 323 ccatgccatcgtcctcgga 305 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 724 Query: 260 gtg 262 ||| Sbjct: 723 gtg 721 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttc 730 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 549 ccggtgccggccatcccagtgtggccttgctgtccgtagg 510
>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8) Length = 683 Score = 123 bits (62), Expect = 6e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 348 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 289 Query: 440 tcgtcctcggagga 453 |||||||| ||||| Sbjct: 288 tcgtcctcagagga 275 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 496 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 437 Query: 256 gccggtg 262 ||||||| Sbjct: 436 gccggtg 430 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 483 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 439 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 342 agcttctccttgatcttctccttcatccccttcttc 307
>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin Length = 671 Score = 123 bits (62), Expect = 6e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 334 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 275 Query: 440 tcgtcctcggagga 453 |||||||| ||||| Sbjct: 274 tcgtcctcagagga 261 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 485 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 426 Query: 256 gccggtg 262 ||||||| Sbjct: 425 gccggtg 419 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 472 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 428 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 328 agcttctccttgatcttctccttcatccccttcttc 293
>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds Length = 1637 Score = 123 bits (62), Expect = 6e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 368 tccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctc 427 ||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||| Sbjct: 1158 tccttgttaccgccggggagcttctccttgatcttctgcttcatgcctttcttcctcctg 1099 Query: 428 ccgcccatgccgtcgtcctcggagga 453 |||||||| ||||||||||||||||| Sbjct: 1098 ccgcccatcccgtcgtcctcggagga 1073 Score = 89.7 bits (45), Expect = 8e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1474 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 1426 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 354 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 413 ||||| || |||||| |||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 1316 tgtgcggcgggttgttcttgtgcccgccagggagcttctccttgatcttctccatgacgc 1257 Query: 414 ccttcttc 421 |||||||| Sbjct: 1256 ccttcttc 1249 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 1461 agcttctccttgatcttctccatcatgcccttcttctcg 1423 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 1284 agcttctccttgatcttctccatgacgcccttcttctcg 1246
>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds Length = 512 Score = 123 bits (62), Expect = 6e-25 Identities = 71/74 (95%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 302 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 243 Query: 440 tcgtcctcggagga 453 |||||||| ||||| Sbjct: 242 tcgtcctcagagga 229 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 450 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 391 Query: 256 gccggtg 262 ||||||| Sbjct: 390 gccggtg 384 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 437 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 393 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 296 agcttctccttgatcttctccttcatccccttcttc 261
>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 123 bits (62), Expect = 6e-25 Identities = 74/78 (94%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 323 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 322 catgccatcgtcctcgga 305 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 724 Query: 260 gtg 262 ||| Sbjct: 723 gtg 721 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttc 730 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 549 ccggtgccggccatcccagtgtggccttgctgtccgtagg 510
>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 123 bits (62), Expect = 6e-25 Identities = 74/78 (94%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 323 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 322 catgccatcgtcctcgga 305 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 783 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 724 Query: 260 gtg 262 ||| Sbjct: 723 gtg 721 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttc 730 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4 (Dhn4) gene, complete cds Length = 906 Score = 123 bits (62), Expect = 6e-25 Identities = 74/78 (94%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 323 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 322 catgccatcgtcctcgga 305 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 768 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 709 Query: 260 gtg 262 ||| Sbjct: 708 gtg 706 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 753 gggagcttctccttgatcttgtccatgatgcccttcttc 715 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 369 agcttctccttgatcttctccttgatgcccttcttc 334
>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds Length = 3086 Score = 123 bits (62), Expect = 6e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 368 tccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctc 427 ||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||| Sbjct: 2073 tccttgttaccgccggggagcttctccttgatcttctgcttcatgcctttcttcctcctg 2014 Query: 428 ccgcccatgccgtcgtcctcggagga 453 |||||||| ||||||||||||||||| Sbjct: 2013 ccgcccatcccgtcgtcctcggagga 1988 Score = 89.7 bits (45), Expect = 8e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 2389 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 2341 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 354 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 413 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 2231 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 2172 Query: 414 ccttcttc 421 |||||||| Sbjct: 2171 ccttcttc 2164 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 2376 agcttctccttgatcttctccatcatgcccttcttctcg 2338 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 2199 agcttctccttgatcttctccatgacgcccttcttctcg 2161
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0034E03 map near 50283S, complete sequence Length = 134074 Score = 121 bits (61), Expect = 2e-24 Identities = 87/95 (91%), Gaps = 3/95 (3%) Strand = Plus / Minus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 75332 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 75273 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 ||||||||||||||||| ||||| ||||||||||| Sbjct: 75272 cccttcttcctcctccctcccatcccgtcgtcctc 75238 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 423 |||| |||||| ||||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 66884 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 66825 Query: 424 cctcccgcccatgccgtcgtcctc 447 |||||| ||||| ||||||||||| Sbjct: 66824 cctccctcccatcccgtcgtcctc 66801 Score = 105 bits (53), Expect = 1e-19 Identities = 85/95 (89%), Gaps = 3/95 (3%) Strand = Plus / Minus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 82738 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 82679 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 |||||||||||||| || ||||| || |||||||| Sbjct: 82678 cccttcttcctccttcctcccatcccatcgtcctc 82644 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 60357 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 60298 Query: 416 ttcttcctcctcccgcccat 435 |||||||||||||| ||||| Sbjct: 60297 ttcttcctcctccctcccat 60278 Score = 101 bits (51), Expect = 2e-18 Identities = 60/63 (95%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 60516 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 60457 Query: 260 gtg 262 ||| Sbjct: 60456 gtg 60454 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||| || |||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 67053 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 66997 Score = 79.8 bits (40), Expect = 7e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 82912 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 82853 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||| || || ||||| ||||||||||||||||||| |||||||||||||||||| Sbjct: 75496 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 75438 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 82705 agcttctccttgatcttctccttgatccccttcttc 82670 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 60327 agcttctccttgatcttctccttgatccccttcttc 60292 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||| ||| |||||||||||| Sbjct: 82901 gccggggagcttctccttgatcttgtccacgatgcccttcttc 82859 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||| ||||||||| Sbjct: 66865 ggcagcttctccttgatcttctccttgattcccttcttc 66827 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 60505 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 60463 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 75299 agcttctccttgatcttctccttgattcccttcttc 75264 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatctt 402 |||||| ||||||||||||||||| Sbjct: 67046 gccgggcagcttctccttgatctt 67023
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 121 bits (61), Expect = 2e-24 Identities = 87/95 (91%), Gaps = 3/95 (3%) Strand = Plus / Plus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 14751728 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 14751787 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 ||||||||||||||||| ||||| ||||||||||| Sbjct: 14751788 cccttcttcctcctccctcccatcccgtcgtcctc 14751822 Score = 119 bits (60), Expect = 9e-24 Identities = 84/92 (91%) Strand = Plus / Plus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 ||||||||| | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 14645808 tgctgctggccgcccttgttgccgccggggagcttctccttgatcttctccttgattccc 14645867 Query: 416 ttcttcctcctcccgcccatgccgtcgtcctc 447 |||||||||||||| ||||| ||||||||||| Sbjct: 14645868 ttcttcctcctccctcccatcccgtcgtcctc 14645899 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 423 |||| |||||| ||||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 14760176 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 14760235 Query: 424 cctcccgcccatgccgtcgtcctc 447 |||||| ||||| ||||||||||| Sbjct: 14760236 cctccctcccatcccgtcgtcctc 14760259 Score = 105 bits (53), Expect = 1e-19 Identities = 85/95 (89%), Gaps = 3/95 (3%) Strand = Plus / Plus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 14744322 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 14744381 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 |||||||||||||| || ||||| || |||||||| Sbjct: 14744382 cccttcttcctccttcctcccatcccatcgtcctc 14744416 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 14766703 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 14766762 Query: 416 ttcttcctcctcccgcccat 435 |||||||||||||| ||||| Sbjct: 14766763 ttcttcctcctccctcccat 14766782 Score = 101 bits (51), Expect = 2e-18 Identities = 60/63 (95%) Strand = Plus / Plus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 14766544 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 14766603 Query: 260 gtg 262 ||| Sbjct: 14766604 gtg 14766606 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Plus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||| || |||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 14760007 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 14760063 Score = 79.8 bits (40), Expect = 7e-12 Identities = 55/60 (91%) Strand = Plus / Plus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 14744148 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 14744207 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||| || || ||||| ||||||||||||||||||| |||||||||||||||||| Sbjct: 14751564 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 14751622 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 14645646 ccggggagcttctccttgatcttctccatcatacccttcttc 14645687 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 14766733 agcttctccttgatcttctccttgatccccttcttc 14766768 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 14744355 agcttctccttgatcttctccttgatccccttcttc 14744390 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 14766555 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 14766597 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||| ||||||||| Sbjct: 14760195 ggcagcttctccttgatcttctccttgattcccttcttc 14760233 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||| ||| |||||||||||| Sbjct: 14744159 gccggggagcttctccttgatcttgtccacgatgcccttcttc 14744201 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 14645652 agcttctccttgatcttctccatcatacccttcttctcg 14645690 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14751761 agcttctccttgatcttctccttgattcccttcttc 14751796 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14645838 agcttctccttgatcttctccttgattcccttcttc 14645873 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 26581429 cccttcttcctcctcccgcc 26581410 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 26045343 cccttcttcctcctcccgcc 26045324 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 26038739 cccttcttcctcctcccgcc 26038720 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 25979411 cccttcttcctcctcccgcc 25979392 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 24086818 cccttcttcctcctcccgcc 24086837 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatctt 402 |||||| ||||||||||||||||| Sbjct: 14760014 gccgggcagcttctccttgatctt 14760037 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 7077786 cccttcttcctcctcccgcc 7077805 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 2024748 cccttcttcctcctcccgcc 2024729 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 2018061 cccttcttcctcctcccgcc 2018042 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 555291 cccttcttcctcctcccgcc 555272
>emb|X15994.1|ZMRAB17G Maize RAB-17 gene Length = 1986 Score = 121 bits (61), Expect = 2e-24 Identities = 82/89 (92%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 418 ||||||| |||||||||||| ||||| |||||||| |||||||||||||| || |||||| Sbjct: 1131 tgctggtcgtccttgtggcctccgggcagcttctctttgatcttctccttgattcccttc 1072 Query: 419 ttcctcctcccgcccatgccgtcgtcctc 447 |||||||| |||||||||||||||||||| Sbjct: 1071 ttcctccttccgcccatgccgtcgtcctc 1043 Score = 97.6 bits (49), Expect = 3e-17 Identities = 61/65 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 |||||||||||||| |||||||||||||||||||||||||| || || |||||||||||| Sbjct: 1299 gctcagtgctgtccgggcagcttctccttgatcttgtccataatgcctttcttctcgccg 1240 Query: 260 gtgcc 264 ||||| Sbjct: 1239 gtgcc 1235 Score = 46.1 bits (23), Expect = 0.10 Identities = 35/39 (89%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 1107 ggcagcttctctttgatcttctccttgattcccttcttc 1069 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | ||||| |||||| Sbjct: 1287 ccgggcagcttctccttgatcttgtccataatgcctttcttc 1246
>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full insert sequence Length = 872 Score = 121 bits (61), Expect = 2e-24 Identities = 96/108 (88%) Strand = Plus / Minus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 423 |||| |||||| ||||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 459 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 400 Query: 424 cctcccgcccatgccgtcgtcctcggaggacgagctntagctggagct 471 |||||| ||||| ||||||||||| || |||||||| |||| ||||| Sbjct: 399 cctccctcccatcccgtcgtcctcagacgacgagctggagcttgagct 352 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||| || |||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 628 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 572 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||| ||||||||| Sbjct: 440 ggcagcttctccttgatcttctccttgattcccttcttc 402 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatctt 402 |||||| ||||||||||||||||| Sbjct: 621 gccgggcagcttctccttgatctt 598
>gb|AY104757.1| Zea mays PCO142314 mRNA sequence Length = 899 Score = 121 bits (61), Expect = 2e-24 Identities = 82/89 (92%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 418 ||||||| |||||||||||| ||||| |||||||| |||||||||||||| || |||||| Sbjct: 430 tgctggtcgtccttgtggcctccgggcagcttctctttgatcttctccttgattcccttc 371 Query: 419 ttcctcctcccgcccatgccgtcgtcctc 447 |||||||| |||||||||||||||||||| Sbjct: 370 ttcctccttccgcccatgccgtcgtcctc 342 Score = 89.7 bits (45), Expect = 8e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 |||||||||||||| ||||||||||| |||||||||||||| || || |||||||||||| Sbjct: 598 gctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgccg 539 Query: 260 gtgcc 264 ||||| Sbjct: 538 gtgcc 534 Score = 46.1 bits (23), Expect = 0.10 Identities = 35/39 (89%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||| |||||||| ||| |||| ||||||||| Sbjct: 406 ggcagcttctctttgatcttctccttgattcccttcttc 368
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 121 bits (61), Expect = 2e-24 Identities = 87/95 (91%), Gaps = 3/95 (3%) Strand = Plus / Plus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 14832165 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatt 14832224 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 ||||||||||||||||| ||||| ||||||||||| Sbjct: 14832225 cccttcttcctcctccctcccatcccgtcgtcctc 14832259 Score = 119 bits (60), Expect = 9e-24 Identities = 84/92 (91%) Strand = Plus / Plus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 ||||||||| | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 14727809 tgctgctggccgcccttgttgccgccggggagcttctccttgatcttctccttgattccc 14727868 Query: 416 ttcttcctcctcccgcccatgccgtcgtcctc 447 |||||||||||||| ||||| ||||||||||| Sbjct: 14727869 ttcttcctcctccctcccatcccgtcgtcctc 14727900 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 423 |||| |||||| ||||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 14840613 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttcct 14840672 Query: 424 cctcccgcccatgccgtcgtcctc 447 |||||| ||||| ||||||||||| Sbjct: 14840673 cctccctcccatcccgtcgtcctc 14840696 Score = 105 bits (53), Expect = 1e-19 Identities = 85/95 (89%), Gaps = 3/95 (3%) Strand = Plus / Plus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 14824759 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 14824818 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 |||||||||||||| || ||||| || |||||||| Sbjct: 14824819 cccttcttcctccttcctcccatcccatcgtcctc 14824853 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 14847140 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 14847199 Query: 416 ttcttcctcctcccgcccat 435 |||||||||||||| ||||| Sbjct: 14847200 ttcttcctcctccctcccat 14847219 Score = 101 bits (51), Expect = 2e-18 Identities = 60/63 (95%) Strand = Plus / Plus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 14846981 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 14847040 Query: 260 gtg 262 ||| Sbjct: 14847041 gtg 14847043 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Plus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||| || |||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 14840444 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 14840500 Score = 79.8 bits (40), Expect = 7e-12 Identities = 55/60 (91%) Strand = Plus / Plus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 14824585 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 14824644 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||| || || ||||| ||||||||||||||||||| |||||||||||||||||| Sbjct: 14832001 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 14832059 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 14727647 ccggggagcttctccttgatcttctccatcatacccttcttc 14727688 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 14847170 agcttctccttgatcttctccttgatccccttcttc 14847205 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 14824792 agcttctccttgatcttctccttgatccccttcttc 14824827 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 14846992 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 14847034 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||| ||||||||| Sbjct: 14840632 ggcagcttctccttgatcttctccttgattcccttcttc 14840670 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||| ||| |||||||||||| Sbjct: 14824596 gccggggagcttctccttgatcttgtccacgatgcccttcttc 14824638 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 14727653 agcttctccttgatcttctccatcatacccttcttctcg 14727691 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14832198 agcttctccttgatcttctccttgattcccttcttc 14832233 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 14727839 agcttctccttgatcttctccttgattcccttcttc 14727874 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 26906693 cccttcttcctcctcccgcc 26906674 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 26364039 cccttcttcctcctcccgcc 26364020 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 26357435 cccttcttcctcctcccgcc 26357416 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 26298109 cccttcttcctcctcccgcc 26298090 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 24398487 cccttcttcctcctcccgcc 24398506 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatctt 402 |||||| ||||||||||||||||| Sbjct: 14840451 gccgggcagcttctccttgatctt 14840474 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 7143757 cccttcttcctcctcccgcc 7143776 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 2032529 cccttcttcctcctcccgcc 2032510 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 2025842 cccttcttcctcctcccgcc 2025823 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 555291 cccttcttcctcctcccgcc 555272
>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0037B06 map near 50283S, complete sequence Length = 149398 Score = 119 bits (60), Expect = 9e-24 Identities = 84/92 (91%) Strand = Plus / Minus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 ||||||||| | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 88908 tgctgctggccgcccttgttgccgccggggagcttctccttgatcttctccttgattccc 88849 Query: 416 ttcttcctcctcccgcccatgccgtcgtcctc 447 |||||||||||||| ||||| ||||||||||| Sbjct: 88848 ttcttcctcctccctcccatcccgtcgtcctc 88817 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 89070 ccggggagcttctccttgatcttctccatcatacccttcttc 89029 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 89064 agcttctccttgatcttctccatcatacccttcttctcg 89026 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 88878 agcttctccttgatcttctccttgattcccttcttc 88843
>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7 Length = 2138 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 1375 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 1316 Query: 440 tcgtcctc 447 |||||||| Sbjct: 1315 tcgtcctc 1308 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 1523 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1464 Query: 256 gccggtg 262 ||||||| Sbjct: 1463 gccggtg 1457 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 1510 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 1466 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 1369 agcttctccttgatcttctccttcatccccttcttc 1334
>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene Length = 2493 Score = 119 bits (60), Expect = 9e-24 Identities = 78/84 (92%) Strand = Plus / Minus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcct 423 |||| |||||| ||||||||||||||||||||||||||||||||| || ||||||||||| Sbjct: 1879 gttggccttgttgccgccggggagcttctccttgatcttctccttgattcccttcttcct 1820 Query: 424 cctcccgcccatgccgtcgtcctc 447 |||||| ||||| ||||||||||| Sbjct: 1819 cctccctcccatcccgtcgtcctc 1796 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||| || || ||||| ||||||||||||||||||| |||||||||||||||||| Sbjct: 2054 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtg 1996 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1857 agcttctccttgatcttctccttgattcccttcttc 1822
>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1 (Dhn1) gene, partial cds Length = 1446 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1 (Dhn1) gene, partial cds Length = 1291 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1 (Dhn1) gene, partial cds Length = 1202 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1 (Dhn1) gene, partial cds Length = 1330 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 291 Query: 440 tcgtcctc 447 |||||||| Sbjct: 290 tcgtcctc 283 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439 Query: 256 gccggtg 262 ||||||| Sbjct: 438 gccggtg 432 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 441 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 344 agcttctccttgatcttctccttcatccccttcttc 309
>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1 (Dhn1) gene, partial cds Length = 1417 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 291 Query: 440 tcgtcctc 447 |||||||| Sbjct: 290 tcgtcctc 283 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439 Query: 256 gccggtg 262 ||||||| Sbjct: 438 gccggtg 432 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 441 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 344 agcttctccttgatcttctccttcatccccttcttc 309
>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 291 Query: 440 tcgtcctc 447 |||||||| Sbjct: 290 tcgtcctc 283 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 498 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439 Query: 256 gccggtg 262 ||||||| Sbjct: 438 gccggtg 432 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 441 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 344 agcttctccttgatcttctccttcatccccttcttc 309
>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1 (Dhn1) gene, partial cds Length = 1230 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 360 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 301 Query: 440 tcgtcctc 447 |||||||| Sbjct: 300 tcgtcctc 293 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 508 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449 Query: 256 gccggtg 262 ||||||| Sbjct: 448 gccggtg 442 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 451 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 354 agcttctccttgatcttctccttcatccccttcttc 319
>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 360 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 301 Query: 440 tcgtcctc 447 |||||||| Sbjct: 300 tcgtcctc 293 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 508 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449 Query: 256 gccggtg 262 ||||||| Sbjct: 448 gccggtg 442 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 451 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 354 agcttctccttgatcttctccttcatccccttcttc 319
>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 297 Query: 440 tcgtcctc 447 |||||||| Sbjct: 296 tcgtcctc 289 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 504 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445 Query: 256 gccggtg 262 ||||||| Sbjct: 444 gccggtg 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 447 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 350 agcttctccttgatcttctccttcatccccttcttc 315
>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds Length = 2717 Score = 119 bits (60), Expect = 9e-24 Identities = 66/68 (97%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| Sbjct: 1632 ccggggagcttctccttgatcttctccttcatccccttcttcctcctcccgcccacgccg 1573 Query: 440 tcgtcctc 447 |||||||| Sbjct: 1572 tcgtcctc 1565 Score = 73.8 bits (37), Expect = 5e-10 Identities = 60/67 (89%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 199 ggctcagtgctgt---cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||| || || ||||||||||||||||||||||||| ||||||||||| Sbjct: 1780 ggctcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1721 Query: 256 gccggtg 262 ||||||| Sbjct: 1720 gccggtg 1714 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||| ||||||||||||||||| ||| | | |||||||||| Sbjct: 1767 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttc 1723 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | |||||||||||| Sbjct: 1626 agcttctccttgatcttctccttcatccccttcttc 1591
>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA Length = 1068 Score = 117 bits (59), Expect = 3e-23 Identities = 71/75 (94%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 351 gtggccaccggggagcttctccttgatcttctccttgatgcccttcttcctcctcccgcc 292 Query: 433 catgccgtcgtcctc 447 |||||| || ||||| Sbjct: 291 catgccatcatcctc 277 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 767 gctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttctcgccg 708 Query: 260 gtg 262 ||| Sbjct: 707 gtg 705 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 752 gggagcttctccttgatcttgtccatgatgcccttcttc 714 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 338 agcttctccttgatcttctccttgatgcccttcttc 303 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 593 ccggtgccggccatcccggtgtggccttgctgtccgtagg 554
>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full insert sequence Length = 852 Score = 115 bits (58), Expect = 1e-22 Identities = 104/119 (87%), Gaps = 3/119 (2%) Strand = Plus / Minus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| |||||| |||||||||||||||||||||||||| || Sbjct: 389 tgctgctggttgttgcccttgttgccgcctgggagcttctccttgatcttctccttgatc 330 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctcggaggacgagctntagctggagct 471 |||||||||||||| || ||||| || |||||||| ||||| ||||| |||||||||| Sbjct: 329 cccttcttcctccttcctcccatcccatcgtcctcagaggatgagctggagctggagct 271 Score = 79.8 bits (40), Expect = 7e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 563 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 504 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 356 agcttctccttgatcttctccttgatccccttcttc 321 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||| ||| |||||||||||| Sbjct: 552 gccggggagcttctccttgatcttgtccacgatgcccttcttc 510
>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds Length = 2890 Score = 115 bits (58), Expect = 1e-22 Identities = 117/137 (85%), Gaps = 6/137 (4%) Strand = Plus / Minus Query: 181 cagccagccggagccggcggctcagtgctgtcccggcagcttctccttgatcttgtccat 240 ||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| Sbjct: 1916 cagccagccggggccggtagctcagtgctgtccgggcagcttctccttgatcttgtccac 1857 Query: 241 gatccccttcttctcgccggtgccggccattcctgcgtgcccttgctgcccgtaggctcc 300 || ||||||| ||| ||||||||||||||||| |||||||||||||||| |||| Sbjct: 1856 gactcccttctcctc------gccggccattcctgcgttcccttgctgcccgtagtctcc 1803 Query: 301 accagttccagttcccg 317 || | |||||||||| Sbjct: 1802 gccggccccagttcccg 1786 Score = 103 bits (52), Expect = 5e-19 Identities = 64/68 (94%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 ||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||| Sbjct: 1726 ccggggagcttctccttgaccttctccttcacgcccttctccctcctcccgcccatgccg 1667 Query: 440 tcgtcctc 447 || ||||| Sbjct: 1666 tcatcctc 1659
>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene Length = 2459 Score = 113 bits (57), Expect = 5e-22 Identities = 86/95 (90%), Gaps = 3/95 (3%) Strand = Plus / Minus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 1355 tgctgctggttgttgcccttgttgccgccggggagcttctccttgatcttctccttgatc 1296 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 |||||||||||||| || ||||| ||||||||||| Sbjct: 1295 cccttcttcctccttcctcccatcccgtcgtcctc 1261 Score = 79.8 bits (40), Expect = 7e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 1529 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 1470 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 1322 agcttctccttgatcttctccttgatccccttcttc 1287 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||| ||| |||||||||||| Sbjct: 1518 gccggggagcttctccttgatcttgtccacgatgcccttcttc 1476
>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene Length = 2890 Score = 113 bits (57), Expect = 5e-22 Identities = 86/95 (90%), Gaps = 3/95 (3%) Strand = Plus / Minus Query: 356 tgctgctggttgt---ccttgtggccgccggggagcttctccttgatcttctccttcatg 412 ||||||||||||| |||||| ||||||||| ||||||||||||||||||||||| || Sbjct: 1825 tgctgctggttgttgcccttgttgccgccgggcagcttctccttgatcttctccttgatc 1766 Query: 413 cccttcttcctcctcccgcccatgccgtcgtcctc 447 ||||||||||||||||| ||||| ||||||||||| Sbjct: 1765 cccttcttcctcctccctcccatcccgtcgtcctc 1731 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||| || |||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 1983 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 1927 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| ||| |||||||||||||| Sbjct: 1795 ggcagcttctccttgatcttctccttgatccccttcttc 1757 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatctt 402 |||||| ||||||||||||||||| Sbjct: 1976 gccgggcagcttctccttgatctt 1953
>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3) mRNA, complete cds Length = 793 Score = 109 bits (55), Expect = 8e-21 Identities = 64/67 (95%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| || Sbjct: 486 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcacc 427 Query: 259 ggtgccg 265 ||||||| Sbjct: 426 ggtgccg 420 Score = 85.7 bits (43), Expect = 1e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || || ||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 309 gtggccacccggaagcttctccttgatcttatccttgattcccttcttcctcctcccgcc 250 Query: 433 catgccgtcgtcctc 447 |||||| || ||||| Sbjct: 249 catgccatcatcctc 235 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 432 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 212 cccggcagcttctccttgatcttgtccatgatccccttcttc 253 ||||| ||||||||||||||||| ||| |||| ||||||||| Sbjct: 302 cccggaagcttctccttgatcttatccttgattcccttcttc 261 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 255 cgccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 ||||||||||||||||||| | || |||||||| ||||||| Sbjct: 376 cgccggtgccggccattccagtatgaccttgctgtccgtagg 335
>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) Length = 1049 Score = 109 bits (55), Expect = 8e-21 Identities = 61/63 (96%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 754 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 695 Query: 260 gtg 262 ||| Sbjct: 694 gtg 692 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 353 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 294 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 293 catgccatcgtcctcgga 276 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 701 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 340 agcttctccttgatcttctccttgatgcccttcttc 305 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 520 ccggtgccggccatcccagtgtggccttgctgtccgtagg 481
>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) Length = 812 Score = 109 bits (55), Expect = 8e-21 Identities = 70/75 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| ||||||||||||||||||||||| ||||| | ||||||||||||||||||||| Sbjct: 332 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttcctcctcccgcc 273 Query: 433 catgccgtcgtcctc 447 ||||||||| ||||| Sbjct: 272 catgccgtcatcctc 258 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 548 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 489 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 494 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||||||| ||| ||||||||| Sbjct: 319 agcttctccttgatcttgtccttgaggcccttcttc 284
>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds Length = 1575 Score = 109 bits (55), Expect = 8e-21 Identities = 70/75 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| ||||||||||||||||||||||| ||||| | ||||||||||||||||||||| Sbjct: 1147 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttcctcctcccgcc 1088 Query: 433 catgccgtcgtcctc 447 ||||||||| ||||| Sbjct: 1087 catgccgtcatcctc 1073 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1363 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 1304 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 1309 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||||||| ||| ||||||||| Sbjct: 1134 agcttctccttgatcttgtccttgaggcccttcttc 1099
>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7 (Dhn7) gene, complete cds Length = 1357 Score = 109 bits (55), Expect = 8e-21 Identities = 70/75 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| ||||||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 583 gtggccaccggggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 524 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 523 catgccatcgtcctc 509 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 841 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 782 Query: 259 ggtgccg 265 ||||||| Sbjct: 781 ggtgccg 775 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 570 agcttctccttgatcttatccttgatacccttcttc 535 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 828 ccgggcagcttctccttgattttgtccatgatgcccttctt 788
>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds Length = 1560 Score = 109 bits (55), Expect = 8e-21 Identities = 70/75 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| ||||||||||||||||||||||| ||||| | ||||||||||||||||||||| Sbjct: 1110 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttcctcctcccgcc 1051 Query: 433 catgccgtcgtcctc 447 ||||||||| ||||| Sbjct: 1050 catgccgtcatcctc 1036 Score = 103 bits (52), Expect = 5e-19 Identities = 58/60 (96%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1326 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 1267 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 1272 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||||||| ||| ||||||||| Sbjct: 1097 agcttctccttgatcttgtccttgaggcccttcttc 1062
>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds Length = 2440 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 1216 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 1157 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 1156 catgccatcgtcctcgga 1139 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 1557 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 1498 Query: 260 gtg 262 ||| Sbjct: 1497 gtg 1495 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 1542 gggagcttctccttgatcttgtccatgatgcccttcttc 1504 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1203 agcttctccttgatcttctccttgatgcccttcttc 1168 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 1383 ccggtgccggccatcccagtgtggccttgctgtccgtagg 1344
>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4 (Dhn4) gene, complete cds Length = 920 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 381 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 322 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 321 catgccatcgtcctcgga 304 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 782 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 723 Query: 260 gtg 262 ||| Sbjct: 722 gtg 720 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 767 gggagcttctccttgatcttgtccatgatgcccttcttc 729 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 368 agcttctccttgatcttctccttgatgcccttcttc 333 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 548 ccggtgccggccatcccagtgtggccttgctgtccgtagg 509
>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4 (Dhn4) gene, complete cds Length = 924 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4 (Dhn4) gene, complete cds Length = 919 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 380 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 321 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 320 catgccatcgtcctcgga 303 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 781 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 722 Query: 260 gtg 262 ||| Sbjct: 721 gtg 719 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 766 gggagcttctccttgatcttgtccatgatgcccttcttc 728 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 367 agcttctccttgatcttctccttgatgcccttcttc 332 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 547 ccggtgccggccatcccagtgtggccttgctgtccgtagg 508
>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4 (Dhn4) gene, complete cds Length = 910 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 386 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 327 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 326 catgccatcgtcctcgga 309 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 772 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 713 Query: 260 gtg 262 ||| Sbjct: 712 gtg 710 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 757 gggagcttctccttgatcttgtccatgatgcccttcttc 719 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 373 agcttctccttgatcttctccttgatgcccttcttc 338
>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710 Query: 260 gtg 262 ||| Sbjct: 709 gtg 707 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710 Query: 260 gtg 262 ||| Sbjct: 709 gtg 707 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4 (Dhn4) gene, complete cds Length = 980 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 381 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 322 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 321 catgccatcgtcctcgga 304 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 842 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 783 Query: 260 gtg 262 ||| Sbjct: 782 gtg 780 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 827 gggagcttctccttgatcttgtccatgatgcccttcttc 789 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 368 agcttctccttgatcttctccttgatgcccttcttc 333 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 548 ccggtgccggccatcccagtgtggccttgctgtccgtagg 509
>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710 Query: 260 gtg 262 ||| Sbjct: 709 gtg 707 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4 (Dhn4) gene, complete cds Length = 904 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 380 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 321 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 320 catgccatcgtcctcgga 303 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 766 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 707 Query: 260 gtg 262 ||| Sbjct: 706 gtg 704 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 751 gggagcttctccttgatcttgtccatgatgcccttcttc 713 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 367 agcttctccttgatcttctccttgatgcccttcttc 332
>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4 (Dhn4) gene, complete cds Length = 916 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 377 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 318 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 317 catgccatcgtcctcgga 300 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 778 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 719 Query: 260 gtg 262 ||| Sbjct: 718 gtg 716 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 763 gggagcttctccttgatcttgtccatgatgcccttcttc 725 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 364 agcttctccttgatcttctccttgatgcccttcttc 329 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 544 ccggtgccggccatcccagtgtggccttgctgtccgtagg 505
>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4 (Dhn4) gene, complete cds Length = 908 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710 Query: 260 gtg 262 ||| Sbjct: 709 gtg 707 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 769 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 710 Query: 260 gtg 262 ||| Sbjct: 709 gtg 707 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttc 716 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 324 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 323 catgccatcgtcctcgga 306 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 784 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 725 Query: 260 gtg 262 ||| Sbjct: 724 gtg 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttc 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 370 agcttctccttgatcttctccttgatgcccttcttc 335 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 550 ccggtgccggccatcccagtgtggccttgctgtccgtagg 511
>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds Length = 2790 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || || Sbjct: 1744 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgccacc 1685 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 1684 catgccatcgtcctcgga 1667 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 2205 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 2146 Query: 260 gtg 262 ||| Sbjct: 2145 gtg 2143 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 2190 gggagcttctccttgatcttgtccatgatgcccttcttc 2152 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1731 agcttctccttgatcttctccttgatgcccttcttc 1696 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 1911 ccggtgccggccatcccagtgtggccttgctgtccgtagg 1872
>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16 Length = 814 Score = 105 bits (53), Expect = 1e-19 Identities = 62/65 (95%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| || Sbjct: 518 ggctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcacc 459 Query: 259 ggtgc 263 ||||| Sbjct: 458 ggtgc 454 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || || |||||||| |||||||| ||||| |||||||||||| |||||||||| Sbjct: 341 gtggccacccggaagcttctctttgatcttatccttgatgcccttcttcttcctcccgcc 282 Query: 433 catgccgtcgtcctc 447 |||||| || ||||| Sbjct: 281 catgccatcatcctc 267 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttc 464
>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full insert sequence Length = 709 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 454 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 395 Query: 416 ttcttcctcctcccgcccat 435 |||||||||||||| ||||| Sbjct: 394 ttcttcctcctccctcccat 375 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 613 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttcttgccg 554 Query: 260 gtg 262 ||| Sbjct: 553 gtg 551 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 424 agcttctccttgatcttctccttgatccccttcttc 389 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 602 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 560
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 356 tgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccc 415 |||||||| | | |||||| ||||||||||||||||||||||||||||||||| || ||| Sbjct: 1986 tgctgctgctcgcccttgttgccgccggggagcttctccttgatcttctccttgatcccc 1927 Query: 416 ttcttcctcctcccgcccat 435 |||||||||||||| ||||| Sbjct: 1926 ttcttcctcctccctcccat 1907 Score = 101 bits (51), Expect = 2e-18 Identities = 60/63 (95%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 2175 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 2116 Query: 260 gtg 262 ||| Sbjct: 2115 gtg 2113 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||||||||||||| Sbjct: 1956 agcttctccttgatcttctccttgatccccttcttc 1921 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 2164 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 2122
>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9) Length = 683 Score = 103 bits (52), Expect = 5e-19 Identities = 64/68 (94%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| || ||||||||||||||||| | |||| Sbjct: 339 ccggggagcttctccttgatcttctccttcatccctttcttcctcctcccgccaacgccg 280 Query: 440 tcgtcctc 447 |||||||| Sbjct: 279 tcgtcctc 272 Score = 73.8 bits (37), Expect = 5e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 468 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 424 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatctt 402 |||||||| ||||||||||||||||| Sbjct: 477 ccgccgggaagcttctccttgatctt 452 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | ||||| |||||| Sbjct: 333 agcttctccttgatcttctccttcatccctttcttc 298
>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds Length = 1294 Score = 103 bits (52), Expect = 5e-19 Identities = 64/68 (94%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| || ||||||||||||||||| | |||| Sbjct: 1032 ccggggagcttctccttgatcttctccttcatccctttcttcctcctcccgccaacgccg 973 Query: 440 tcgtcctc 447 |||||||| Sbjct: 972 tcgtcctc 965 Score = 73.8 bits (37), Expect = 5e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1161 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 1117 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatctt 402 |||||||| ||||||||||||||||| Sbjct: 1170 ccgccgggaagcttctccttgatctt 1145 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | ||||| |||||| Sbjct: 1026 agcttctccttgatcttctccttcatccctttcttc 991
>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds Length = 1849 Score = 103 bits (52), Expect = 5e-19 Identities = 64/68 (94%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 |||||||||||||||||||||||||||||||| || ||||||||||||||||| | |||| Sbjct: 1040 ccggggagcttctccttgatcttctccttcatccctttcttcctcctcccgccaacgccg 981 Query: 440 tcgtcctc 447 |||||||| Sbjct: 980 tcgtcctc 973 Score = 73.8 bits (37), Expect = 5e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtg 262 ||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1169 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 1125 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 377 ccgccggggagcttctccttgatctt 402 |||||||| ||||||||||||||||| Sbjct: 1178 ccgccgggaagcttctccttgatctt 1153 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| | ||||| |||||| Sbjct: 1034 agcttctccttgatcttctccttcatccctttcttc 999
>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds Length = 483 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 273 gtggccaccagggagcttctccttgatcttatccttgatgcccttcttcctcctcccgcc 214 Query: 433 catgccgtcgtcctc 447 |||||| || ||||| Sbjct: 213 catgccatcatcctc 199 Score = 85.7 bits (43), Expect = 1e-13 Identities = 55/59 (93%) Strand = Plus / Minus Query: 202 tcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccgg 260 |||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||| Sbjct: 483 tcagtgctgtccgggcagcttttccttgatcttgtccatgatgcccttcttttcgccgg 425 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 260 agcttctccttgatcttatccttgatgcccttcttc 225 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| ||||| ||||||||||| ||| | ||||||||||| Sbjct: 473 ccgggcagcttttccttgatcttgtccatgatgcccttctt 433
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds Length = 864 Score = 101 bits (51), Expect = 2e-18 Identities = 60/63 (95%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 584 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 525 Query: 260 gtg 262 ||| Sbjct: 524 gtg 522 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||| ||| | |||||||||||| Sbjct: 573 gccgggcagcttctccttgatcttgtccatgatgcccttcttc 531
>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds Length = 654 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 590 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 531 Query: 259 ggtgccg 265 ||||||| Sbjct: 530 ggtgccg 524 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 332 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 273 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 272 catgccatcgtcctc 258 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 319 agcttctccttgatcttatccttgatacccttcttc 284 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 577 ccgggcagcttctccttgattttgtccatgatgcccttctt 537
>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7 (Dhn7) gene, complete cds Length = 1371 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 857 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 798 Query: 259 ggtgccg 265 ||||||| Sbjct: 797 ggtgccg 791 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 599 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 540 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 539 catgccatcgtcctc 525 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804
>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795 Query: 259 ggtgccg 265 ||||||| Sbjct: 794 ggtgccg 788 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 536 catgccatcgtcctc 522 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801
>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795 Query: 259 ggtgccg 265 ||||||| Sbjct: 794 ggtgccg 788 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 536 catgccatcgtcctc 522 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801
>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7 (Dhn7) gene, complete cds Length = 1332 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 816 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 757 Query: 259 ggtgccg 265 ||||||| Sbjct: 756 ggtgccg 750 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 558 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 499 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 498 catgccatcgtcctc 484 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 545 agcttctccttgatcttatccttgatacccttcttc 510 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 803 ccgggcagcttctccttgattttgtccatgatgcccttctt 763
>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795 Query: 259 ggtgccg 265 ||||||| Sbjct: 794 ggtgccg 788 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 536 catgccatcgtcctc 522 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801
>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 857 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 798 Query: 259 ggtgccg 265 ||||||| Sbjct: 797 ggtgccg 791 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 599 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 540 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 539 catgccatcgtcctc 525 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804
>gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 7 (Dhn7) gene, complete cds Length = 1375 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 859 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 800 Query: 259 ggtgccg 265 ||||||| Sbjct: 799 ggtgccg 793 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 601 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 542 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 541 catgccatcgtcctc 527 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 588 agcttctccttgatcttatccttgatacccttcttc 553 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 846 ccgggcagcttctccttgattttgtccatgatgcccttctt 806
>gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791 Query: 259 ggtgccg 265 ||||||| Sbjct: 790 ggtgccg 784 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 532 catgccatcgtcctc 518 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797
>gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791 Query: 259 ggtgccg 265 ||||||| Sbjct: 790 ggtgccg 784 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 532 catgccatcgtcctc 518 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797
>gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 857 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 798 Query: 259 ggtgccg 265 ||||||| Sbjct: 797 ggtgccg 791 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 599 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 540 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 539 catgccatcgtcctc 525 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 586 agcttctccttgatcttatccttgatacccttcttc 551 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804
>gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 847 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 788 Query: 259 ggtgccg 265 ||||||| Sbjct: 787 ggtgccg 781 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 589 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 530 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 529 catgccatcgtcctc 515 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 834 ccgggcagcttctccttgattttgtccatgatgcccttctt 794
>gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791 Query: 259 ggtgccg 265 ||||||| Sbjct: 790 ggtgccg 784 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 532 catgccatcgtcctc 518 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797
>gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768 Query: 259 ggtgccg 265 ||||||| Sbjct: 767 ggtgccg 761 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 509 catgccatcgtcctc 495 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774
>gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 854 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 795 Query: 259 ggtgccg 265 ||||||| Sbjct: 794 ggtgccg 788 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 596 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 537 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 536 catgccatcgtcctc 522 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 583 agcttctccttgatcttatccttgatacccttcttc 548 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801
>gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768 Query: 259 ggtgccg 265 ||||||| Sbjct: 767 ggtgccg 761 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 509 catgccatcgtcctc 495 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774
>gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791 Query: 259 ggtgccg 265 ||||||| Sbjct: 790 ggtgccg 784 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 532 catgccatcgtcctc 518 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797
>gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 850 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 791 Query: 259 ggtgccg 265 ||||||| Sbjct: 790 ggtgccg 784 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 592 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 533 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 532 catgccatcgtcctc 518 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 579 agcttctccttgatcttatccttgatacccttcttc 544 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 837 ccgggcagcttctccttgattttgtccatgatgcccttctt 797
>gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1344 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 828 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 769 Query: 259 ggtgccg 265 ||||||| Sbjct: 768 ggtgccg 762 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 570 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 511 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 510 catgccatcgtcctc 496 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 557 agcttctccttgatcttatccttgatacccttcttc 522 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 815 ccgggcagcttctccttgattttgtccatgatgcccttctt 775
>gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768 Query: 259 ggtgccg 265 ||||||| Sbjct: 767 ggtgccg 761 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 509 catgccatcgtcctc 495 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774
>gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768 Query: 259 ggtgccg 265 ||||||| Sbjct: 767 ggtgccg 761 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 509 catgccatcgtcctc 495 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774
>gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 847 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 788 Query: 259 ggtgccg 265 ||||||| Sbjct: 787 ggtgccg 781 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 589 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 530 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 529 catgccatcgtcctc 515 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 834 ccgggcagcttctccttgattttgtccatgatgcccttctt 794
>gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 7 (Dhn7) gene, complete cds Length = 1369 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 853 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 794 Query: 259 ggtgccg 265 ||||||| Sbjct: 793 ggtgccg 787 Score = 93.7 bits (47), Expect = 5e-16 Identities = 68/75 (90%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||| ||||| Sbjct: 595 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctaccgcc 536 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 535 catgccatcgtcctc 521 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 582 agcttctccttgatcttatccttgatacccttcttc 547 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 840 ccgggcagcttctccttgattttgtccatgatgcccttctt 800
>gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 7 (Dhn7) gene, complete cds Length = 1337 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 823 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 764 Query: 259 ggtgccg 265 ||||||| Sbjct: 763 ggtgccg 757 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 565 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 506 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 505 catgccatcgtcctc 491 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 552 agcttctccttgatcttatccttgatacccttcttc 517 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 810 ccgggcagcttctccttgattttgtccatgatgcccttctt 770
>gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768 Query: 259 ggtgccg 265 ||||||| Sbjct: 767 ggtgccg 761 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 509 catgccatcgtcctc 495 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774
>gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 7 (Dhn7) gene, complete cds Length = 1342 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 827 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 768 Query: 259 ggtgccg 265 ||||||| Sbjct: 767 ggtgccg 761 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 569 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 510 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 509 catgccatcgtcctc 495 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 556 agcttctccttgatcttatccttgatacccttcttc 521 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 814 ccgggcagcttctccttgattttgtccatgatgcccttctt 774
>gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 847 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 788 Query: 259 ggtgccg 265 ||||||| Sbjct: 787 ggtgccg 781 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 589 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 530 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 529 catgccatcgtcctc 515 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 576 agcttctccttgatcttatccttgatacccttcttc 541 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 834 ccgggcagcttctccttgattttgtccatgatgcccttctt 794
>gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, complete cds Length = 2127 Score = 101 bits (51), Expect = 2e-18 Identities = 63/67 (94%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||| Sbjct: 1183 ggctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgcc 1124 Query: 259 ggtgccg 265 ||||||| Sbjct: 1123 ggtgccg 1117 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||| ||||| || |||||||||||||||||||| Sbjct: 925 gtggccaccagggagcttctccttgatcttatccttgatacccttcttcctcctcccgcc 866 Query: 433 catgccgtcgtcctc 447 |||||| |||||||| Sbjct: 865 catgccatcgtcctc 851 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 912 agcttctccttgatcttatccttgatacccttcttc 877 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||| |||||||||||||| || ||| | ||||||||||| Sbjct: 1170 ccgggcagcttctccttgattttgtccatgatgcccttctt 1130
>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin Length = 1016 Score = 99.6 bits (50), Expect = 8e-18 Identities = 71/78 (91%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcc 432 |||||| || |||||||||||||||||||||||||| ||||||||||||||||| | || Sbjct: 366 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttcctcctgtcacc 307 Query: 433 catgccgtcgtcctcgga 450 |||||| ||||||||||| Sbjct: 306 catgccatcgtcctcgga 289 Score = 85.7 bits (43), Expect = 1e-13 Identities = 58/63 (92%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || | |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 707 gctcagtgctggccaaggagcttctccttgatcttgtccatgatgcccttcttctcgccg 648 Query: 260 gtg 262 ||| Sbjct: 647 gtg 645 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 384 ggagcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||||||||| ||| | |||||||||||| Sbjct: 691 ggagcttctccttgatcttgtccatgatgcccttcttc 654 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 353 agcttctccttgatcttctccttgatgcccttcttc 318 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 533 ccggtgccggccatcccagtgtggccttgctgtccgtagg 494
>gb|AF181460.1|AF181460 Hordeum vulgare dehydrin (Dhn10) gene, complete cds Length = 2501 Score = 93.7 bits (47), Expect = 5e-16 Identities = 65/71 (91%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 ||||| ||||||||||||||||||||||| |||||||||||||||| || |||||||| Sbjct: 1267 ccgggaagcttctccttgatcttctccttgatgcccttcttcctccgtccacccatgcca 1208 Query: 440 tcgtcctcgga 450 ||||||||||| Sbjct: 1207 tcgtcctcgga 1197 Score = 89.7 bits (45), Expect = 8e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||||| || |||||||| ||||||||||||||||| || ||||||||||||||||| | Sbjct: 1896 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgccggtac 1837 Query: 264 cggccattcctgcgtgcccttgctg 288 |||||| || ||||| |||||||| Sbjct: 1836 cggccagcccggcgtgaccttgctg 1812 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 389 ttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||| |||||||||||||||||| Sbjct: 1561 ttctccatgatcttgtccttcatgcccttcttc 1529 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1261 agcttctccttgatcttctccttgatgcccttcttc 1226 Score = 42.1 bits (21), Expect = 1.6 Identities = 39/45 (86%) Strand = Plus / Minus Query: 211 tcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||||| || |||||| ||||||||||| | || ||||||||||| Sbjct: 1571 tcccggaagtttctccatgatcttgtccttcatgcccttcttctc 1527
>gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 4-like (Dhn4) gene, partial sequence Length = 422 Score = 93.7 bits (47), Expect = 5e-16 Identities = 59/63 (93%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 259 ||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 359 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 300 Query: 260 gtg 262 ||| Sbjct: 299 gtg 297 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||| ||| | |||||||||||| Sbjct: 344 gggagcttctccttgatcttgtccatgatgcccttcttc 306 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 257 ccggtgccggccattcctgcgtgcccttgctgcccgtagg 296 |||||||||||||| || | ||| |||||||| ||||||| Sbjct: 125 ccggtgccggccatcccagtgtggccttgctgtccgtagg 86
>gb|AF043095.1|AF043095 Hordeum vulgare dehydrin 10 (dhn10) gene, complete cds Length = 2984 Score = 93.7 bits (47), Expect = 5e-16 Identities = 65/71 (91%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccg 439 ||||| ||||||||||||||||||||||| |||||||||||||||| || |||||||| Sbjct: 1665 ccgggaagcttctccttgatcttctccttgatgcccttcttcctccgtccacccatgcca 1606 Query: 440 tcgtcctcgga 450 ||||||||||| Sbjct: 1605 tcgtcctcgga 1595 Score = 89.7 bits (45), Expect = 8e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||||| || |||||||| ||||||||||||||||| || ||||||||||||||||| | Sbjct: 2294 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgccggtac 2235 Query: 264 cggccattcctgcgtgcccttgctg 288 |||||| || ||||| |||||||| Sbjct: 2234 cggccagcccggcgtgaccttgctg 2210 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 389 ttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||| |||||||||||||||||| Sbjct: 1959 ttctccatgatcttgtccttcatgcccttcttc 1927 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttc 253 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 1659 agcttctccttgatcttctccttgatgcccttcttc 1624 Score = 42.1 bits (21), Expect = 1.6 Identities = 39/45 (86%) Strand = Plus / Minus Query: 211 tcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||||| || |||||| ||||||||||| | || ||||||||||| Sbjct: 1969 tcccggaagtttctccatgatcttgtccttcatgcccttcttctc 1925
>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2) mRNA, complete cds Length = 1518 Score = 83.8 bits (42), Expect = 5e-13 Identities = 57/62 (91%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | ||||||||||||||||| Sbjct: 1293 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgccggtgc 1234 Query: 264 cg 265 || Sbjct: 1233 cg 1232 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| | |||||||||||| Sbjct: 131 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 83 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||||||||||||||| |||||||| |||||||||||||||| |||| Sbjct: 118 agcttctccttgatcttctccatgatgcccttcttctcgccggcgccg 71 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 1069 agcttctccttgatgttttccatgacgcccttcttctcgccggtgccg 1022 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 358 ctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccctt 417 |||||||| ||| ||||||| |||||||||||||||||||| || ||| | | |||||| Sbjct: 1097 ctgctggtggtcactgtggccaccggggagcttctccttgatgttttccatgacgccctt 1038 Query: 418 cttc 421 |||| Sbjct: 1037 cttc 1034 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| |||||||||||||| |||||| Sbjct: 685 agcttctccttgatgttctccatgacacccttcttctcgcctgtgccg 638 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccggc 267 ||||| |||||||| || ||||||| |||||||||||||||||| |||| Sbjct: 487 agcttgtccttgatgttctccatgacgcccttcttctcgccggtgtcggc 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctcc 406 ||||| |||||||||||||||||||| |||||| Sbjct: 697 tggccaccggggagcttctccttgatgttctcc 665 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||||| || |||||||||||||||||| Sbjct: 877 agcttgtccttgatgttctccatgacgcctttcttctcgccggtgccg 830 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctcc 406 |||||| ||||||||||| |||||||| |||||| Sbjct: 890 gtggccaccggggagcttgtccttgatgttctcc 857 Score = 44.1 bits (22), Expect = 0.41 Identities = 31/34 (91%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctcc 406 |||||| ||||||||||| |||||||| |||||| Sbjct: 302 gtggccaccggggagcttgtccttgatgttctcc 269
>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA, complete cds Length = 1504 Score = 81.8 bits (41), Expect = 2e-12 Identities = 56/61 (91%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| |||||||| ||||||||||||||||||| | |||||||||||| Sbjct: 1201 ggctcagtgctgtccaggcagcttatccttgatcttgtccatgaggctcttcttctcgcc 1142 Query: 259 g 259 | Sbjct: 1141 g 1141 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| | |||||||||||| Sbjct: 100 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 52 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 87 agcttctccttgatcttctccatgatgcccttcttctcgccgg 45 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 528 agcttctccttgatgttctccatgacgcccttcttctcgccggtgccg 481 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | | |||||||||| Sbjct: 541 gtggccaccagggagcttctccttgatgttctccatgacgcccttcttc 493 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||| |||||||| || ||||||| |||||||||||||||| Sbjct: 276 agcttgtccttgatgttctccatgacgcccttcttctcgccgg 234 Score = 44.1 bits (22), Expect = 0.41 Identities = 40/46 (86%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| |||||||||||||| |||| Sbjct: 912 agcttttccttgatgttctccatgacgcccttcttctcgccagtgc 867 Score = 42.1 bits (21), Expect = 1.6 Identities = 33/37 (89%) Strand = Plus / Minus Query: 270 ttcctgcgtgcccttgctgcccgtaggctccaccagt 306 |||| ||||| || |||||||||||||| |||||||| Sbjct: 203 ttccagcgtgaccctgctgcccgtaggcaccaccagt 167 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 tgctgcccgtaggctccacc 303 |||||||||||||||||||| Sbjct: 963 tgctgcccgtaggctccacc 944 Score = 40.1 bits (20), Expect = 6.4 Identities = 41/48 (85%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||||| || ||||||||||| |||||| Sbjct: 720 agcttgtccttgatgttctccatgacgcctttcttctcgccagtgccg 673
>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds Length = 3447 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| | |||||||||||| Sbjct: 676 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 628 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 2324 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2265 Query: 264 cg 265 || Sbjct: 2264 cg 2263 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 663 agcttctccttgatcttctccatgatgcccttcttctcgccgg 621 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 2100 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 2053 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 1515 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 1468 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 1908 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 1863 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 1528 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 1480 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 2127 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 2080 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||| ||||||||||| ||||||| |||||||||||||||| Sbjct: 861 agcttgtccttgatcttctccatgaggcccttcttctcgccgg 819 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 1921 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 1873 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| ||||||||||||||| | | |||||||||| Sbjct: 874 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttc 826 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 1323 agcttatccttgatgttctccattacacccttcttctcgccggtgccg 1276 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggt 261 ||||| |||||||| || ||||||| ||||||||||||||||| Sbjct: 1122 agcttgtccttgatgttctccatgacgcccttcttctcgccggt 1079 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 245 cccttcttctcgccggtgccg 265 ||||||||||||||||||||| Sbjct: 1689 cccttcttctcgccggtgccg 1669
>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds Length = 1243 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| | |||||||||||| Sbjct: 128 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 80 Score = 79.8 bits (40), Expect = 7e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| |||||||| ||||||||||||||||||| | |||||||||||| Sbjct: 1229 ggctcagtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 1170 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 115 agcttctccttgatcttctccatgatgcccttcttctcgccgg 73 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 940 agcttctccttgatgttctccatgacgcccttcttctcgccggtgccg 893 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 556 agcttctccttgatgttctccatgaggcccttcttctcgccggtgccg 509 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| |||||| | | |||||||||| Sbjct: 953 gtggccaccggggagcttctccttgatgttctccatgacgcccttcttc 905 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||||| ||||||||||||||||||||| Sbjct: 748 agcttgtccttgatgttctccatgacgcccttcttctcgccggtgccg 701 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| || ||||||||||||||||| |||||| | | |||||||||| Sbjct: 568 tggccaccagggagcttctccttgatgttctccatgaggcccttcttc 521 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 tgctgcccgtaggctccacc 303 |||||||||||||||||||| Sbjct: 991 tgctgcccgtaggctccacc 972
>gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein WCOR80 (Wcor80) mRNA, complete cds Length = 465 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 |||| |||||||||| |||||||||||||||| ||||||||||| | |||||||||||| Sbjct: 332 ggcttagtgctgtccaggcagcttctccttgaccttgtccatgaggctcttcttctcgcc 273 Query: 259 ggtgccggc 267 ||| ||||| Sbjct: 272 ggtcccggc 264 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| || |||||||||||||||||| Sbjct: 112 agcttctccttgatgttctccatgatgcctttcttctcgccggtgccg 65 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| |||||| | ||||| |||||| Sbjct: 125 gtggccaccggggagcttctccttgatgttctccatgatgcctttcttc 77
>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds Length = 2432 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| | |||||||||||| Sbjct: 669 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 621 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 2317 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2258 Query: 264 cg 265 || Sbjct: 2257 cg 2256 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 656 agcttctccttgatcttctccatgatgcccttcttctcgccgg 614 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 2093 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 2046 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 1508 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 1461 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 1901 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 1856 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 1521 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 1473 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 2120 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 2073 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||| ||||||||||| ||||||| |||||||||||||||| Sbjct: 854 agcttgtccttgatcttctccatgaggcccttcttctcgccgg 812 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 1914 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 1866 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| ||||||||||||||| | | |||||||||| Sbjct: 867 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttc 819 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 1709 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 1662 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 1316 agcttatccttgatgttctccattacacccttcttctcgccggtgccg 1269 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggt 261 ||||| |||||||| || ||||||| ||||||||||||||||| Sbjct: 1115 agcttgtccttgatgttctccatgacgcccttcttctcgccggt 1072
>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds Length = 1629 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||||||||| | |||||||||||| Sbjct: 154 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttc 106 Score = 73.8 bits (37), Expect = 5e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 ||||||||||||||| || ||||| ||||||||||||||||||| | |||||||||||| Sbjct: 1489 ggctcagtgctgtccaggtagcttgtccttgatcttgtccatgaggctcttcttctcgcc 1430 Query: 259 g 259 | Sbjct: 1429 g 1429 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||||||||||||||| |||||||| |||||||||||||||| |||| Sbjct: 141 agcttctccttgatcttctccatgatgcccttcttctcgccggcgccg 94 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 358 ctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgccctt 417 |||||||||||| ||||||| || |||||||| |||||||| |||||| | | |||||| Sbjct: 1036 ctgctggttgtcactgtggccaccagggagcttgtccttgatgttctccatgacgccctt 977 Query: 418 cttcc 422 ||||| Sbjct: 976 cttcc 972 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||||| ||||||||||||||||||||| Sbjct: 816 agcttgtccttgatgttctccatgaggcccttcttctcgccggtgccg 769 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||| |||||||| |||||| | | |||||||||| Sbjct: 342 tggccaccggggagcttgtccttgatgttctccatgacgcccttcttc 295 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||| |||||||| || ||||||| |||||||||||||||| Sbjct: 330 agcttgtccttgatgttctccatgacgcccttcttctcgccgg 288 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccg 259 |||||||||||||| || ||||||| | ||||||||||||| Sbjct: 624 agcttctccttgatgttctccatgaggctcttcttctcgccg 583 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctcc 406 ||||| || ||||||||||||||||| |||||| Sbjct: 636 tggccaccagggagcttctccttgatgttctcc 604 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 tgctgcccgtaggctccacc 303 |||||||||||||||||||| Sbjct: 1251 tgctgcccgtaggctccacc 1232 Score = 40.1 bits (20), Expect = 6.4 Identities = 41/48 (85%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||||| ||||||||||||| |||||| Sbjct: 1200 agcttgtccttgatgttctccatgacggccttcttctcgccagtgccg 1153
>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds Length = 697 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 360 gctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttct 419 |||||||||| |||||||||||||| ||||||||||||| ||| ||||| || ||||||| Sbjct: 373 gctggttgtctttgtggccgccgggtagcttctccttgaccttgtccttgatccccttct 314 Query: 420 tcctcctcccgcccatgccgtcgtcctcggaggacgagct 459 | ||||| || || ||||||||||| || |||||||| Sbjct: 313 ttctcctaccaccttgcccgtcgtcctcagaagacgagct 274 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||| ||||||||||| |||||||| |||||||||||||| Sbjct: 464 ggcagtttctccttgattttgtccatcatccccttcttctc 424 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttctt 252 ||||||||||||| ||||||| ||||||||||||| Sbjct: 347 agcttctccttgaccttgtccttgatccccttctt 313 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||||||| || || ||||||||||| || ||| |||| ||||||||| Sbjct: 474 gtggccgccaggcagtttctccttgattttgtccatcatccccttcttc 426
>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds Length = 748 Score = 79.8 bits (40), Expect = 7e-12 Identities = 49/52 (94%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||||||||| ||||||||||||||||||||||||||||| || |||||||| Sbjct: 498 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctc 447 Score = 77.8 bits (39), Expect = 3e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttc 418 |||||||||||||||||| | ||||| ||||||||||||||||| || || |||||| Sbjct: 364 tgctggttgtccttgtgggctccgggcagcttctccttgatcttttctccgattcccttc 305 Query: 419 ttcctcctcccgcccatgccgtc 441 |||||||| |||||||| ||||| Sbjct: 304 ttcctccttccgcccataccgtc 282 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||| ||| | ||||| |||||| Sbjct: 490 ccgggcagcttctccttgatcttgtccatgatgcctttcttc 449 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatctt 234 |||||||||||||||||||| Sbjct: 340 ggcagcttctccttgatctt 321
>gb|AF031249.1|AF031249 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-4) mRNA, complete cds Length = 680 Score = 77.8 bits (39), Expect = 3e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 |||| |||||||||| |||||||| |||||||||||||||||||| | ||| ||||| || Sbjct: 397 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcacc 338 Query: 259 ggtgccg 265 ||||||| Sbjct: 337 ggtgccg 331 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctc 405 |||||| |||||||||||||||||||| ||||| Sbjct: 229 gtggccaccggggagcttctccttgatgttctc 197 Score = 46.1 bits (23), Expect = 0.10 Identities = 41/47 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgcc 264 |||||||||||||| || || | || |||||||||||||||||||| Sbjct: 216 agcttctccttgatgttctcgacgacacccttcttctcgccggtgcc 170 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 cccttcttctcgccggtgcc 264 |||||||||||||||||||| Sbjct: 63 cccttcttctcgccggtgcc 44
>gb|AF031250.1|AF031250 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-5) mRNA, complete cds Length = 697 Score = 77.8 bits (39), Expect = 3e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 |||| |||||||||| |||||||| |||||||||||||||||||| | ||| ||||| || Sbjct: 421 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcacc 362 Query: 259 ggtgccg 265 ||||||| Sbjct: 361 ggtgccg 355 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctc 405 |||||| |||||||||||||||||||| ||||| Sbjct: 253 gtggccaccggggagcttctccttgatgttctc 221 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccgg 266 |||||||||||||| || || | || |||||||||||||||||||||| Sbjct: 240 agcttctccttgatgttctcgacgacgcccttcttctcgccggtgccgg 192
>gb|U73213.1|TAU73213 Triticum aestivum cold acclimation protein WCOR726 (Wcor726) mRNA, complete cds Length = 667 Score = 77.8 bits (39), Expect = 3e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 |||| |||||||||| |||||||| |||||||||||||||||||| | ||| ||||| || Sbjct: 441 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcacc 382 Query: 259 ggtgccg 265 ||||||| Sbjct: 381 ggtgccg 375 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctc 405 |||||| |||||||||||||||||||| ||||| Sbjct: 273 gtggccaccggggagcttctccttgatgttctc 241 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccgg 266 |||||||||||||| || || |||| ||||||||||||| |||||||| Sbjct: 260 agcttctccttgatgttctcgatgacgcccttcttctcgctggtgccgg 212
>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||| |||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551
>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||| ||||||||||| ||||||||| Sbjct: 778 agcttctccttgatgttctccatggcacccttcttctcaccggtgccg 731 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||| |||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551
>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| |||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||| |||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551
>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 264 cg 265 || Sbjct: 948 cg 947 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||| |||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 245 cccttcttctcgccggtgccg 265 ||||||||||||||||||||| Sbjct: 367 cccttcttctcgccggtgccg 347
>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 264 cg 265 || Sbjct: 339 cg 338 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149
>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 264 cg 265 || Sbjct: 339 cg 338 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149
>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 264 cg 265 || Sbjct: 948 cg 947 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| |||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| |||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5) gene, partial cds Length = 1061 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1014 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 955 Query: 264 cg 265 || Sbjct: 954 cg 953 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||| |||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551
>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 264 cg 265 || Sbjct: 948 cg 947 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| |||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| |||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 264 cg 265 || Sbjct: 339 cg 338 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149
>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 340 Query: 264 cg 265 || Sbjct: 339 cg 338 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 122 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 183 tgtggccaccgggaagcttctccttgatgttctcc 149
>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 264 cg 265 || Sbjct: 948 cg 947 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||| |||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551
>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| |||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 943 Query: 264 cg 265 || Sbjct: 942 cg 941 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 805 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 758 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || |||||||| |||||||||||||| |||||| Sbjct: 193 agcttgtccttgatgttctccatgatgcccttcttctcgccagtgccg 146 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 551 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| |||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttc 158 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347
>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 949 Query: 264 cg 265 || Sbjct: 948 cg 947 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| ||||||||||||||||||||| Sbjct: 193 agcttctccttgatgttctccatgatgcccttcttctcgccggtgccg 146 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 731 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 158 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 ||||| |||||||| || ||||||| ||||||||||||||||||| Sbjct: 586 agcttatccttgatgttttccatgacgcccttcttctcgccggtgc 541 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 394 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 347 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 372 tgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||||| |||||||||||||| |||||| Sbjct: 792 tgtggccaccgggaagcttctccttgatgttctcc 758 Score = 42.1 bits (21), Expect = 1.6 Identities = 42/49 (85%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||| |||||||| || ||| | | |||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttc 551 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctcc 406 ||||| ||||||||||| |||||||| |||||| Sbjct: 406 tggccaccggggagcttttccttgatgttctcc 374
>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds Length = 2814 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||| ||||||||||||||||||| | |||||||||||| |||| Sbjct: 2322 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcccgtgc 2263 Query: 264 cg 265 || Sbjct: 2262 cg 2261 Score = 73.8 bits (37), Expect = 5e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||||| |||||||||||||||||| | |||||||||||| Sbjct: 674 gtggccgccggggagtttctccttgatcttctccatgatgcccttcttc 626 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || ||||||| ||||||||||||||||||||| Sbjct: 2098 agcttctccttgatgttctccatgacacccttcttctcgccggtgccg 2051 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| |||||||||||||| |||||| Sbjct: 1513 agcttctccttgatgttctccatgatgcccttcttctcgccagtgccg 1466 Score = 63.9 bits (32), Expect = 4e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 221 ttctccttgatcttgtccatgatccccttcttctcgccgg 260 |||||||||||||| |||||||| |||||||||||||||| Sbjct: 658 ttctccttgatcttctccatgatgcccttcttctcgccgg 619 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||||||| || ||||||| ||||||||||||||||||| Sbjct: 1906 agcttctccttgatgttttccatgacgcccttcttctcgccggtgc 1861 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || ||||||||||||||||| |||||| | |||||||||||| Sbjct: 1526 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttc 1478 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 359 tgctggttgtccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||| ||| ||||||| |||||||||||||||||||| |||||| Sbjct: 2125 tgctggtggtcactgtggccaccggggagcttctccttgatgttctcc 2078 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||||| ||||||||||||||||||||| Sbjct: 1120 agcttgtccttgatgttctccatgacgcccttcttctcgccggtgccg 1073 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccgg 260 ||||| ||||||||||| ||||||| |||||||||||||||| Sbjct: 859 agcttgtccttgatcttctccatgaggcccttcttctcgccgg 817 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| |||||||||||||||||||| || ||| | | |||||||||| Sbjct: 1919 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttc 1871 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 373 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| || |||||||| ||||||||||||||| | | |||||||||| Sbjct: 872 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttc 824 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 1714 agcttttccttgatgttctccattacacccttcttctcgccggtgccg 1667 Score = 48.1 bits (24), Expect = 0.026 Identities = 42/48 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 ||||| |||||||| || ||||| | ||||||||||||||||||||| Sbjct: 1321 agcttatccttgatgttctccattacacccttcttctcgccggtgccg 1274
>gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, complete cds Length = 2009 Score = 73.8 bits (37), Expect = 5e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcg 256 |||||||| ||||| || ||||||||||||||||| |||||||| |||||||||||| Sbjct: 1641 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1585 Score = 60.0 bits (30), Expect = 7e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttcctcctc 427 ||||||||||| ||||||||||| |||||||||||| ||||| Sbjct: 1512 agcttctcctttatcttctccttgatgcccttcttcttcctc 1471 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||| | || ||||||||| Sbjct: 1626 gggagcttctccttgatcttctccatgatacccttcttc 1588 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 212 cccggcagcttctccttgatcttgtccatgatccccttcttct 254 ||||| ||||||||||| ||||| ||| |||| |||||||||| Sbjct: 1518 cccggaagcttctcctttatcttctccttgatgcccttcttct 1476
>gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene, complete cds Length = 2420 Score = 73.8 bits (37), Expect = 5e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 200 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcg 256 |||||||| ||||| || ||||||||||||||||| |||||||| |||||||||||| Sbjct: 1649 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1593 Score = 60.0 bits (30), Expect = 7e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttcctcctc 427 ||||||||||| ||||||||||| |||||||||||| ||||| Sbjct: 1520 agcttctcctttatcttctccttgatgcccttcttcttcctc 1479 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 383 gggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||| | || ||||||||| Sbjct: 1634 gggagcttctccttgatcttctccatgatacccttcttc 1596 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 212 cccggcagcttctccttgatcttgtccatgatccccttcttct 254 ||||| ||||||||||| ||||| ||| |||| |||||||||| Sbjct: 1526 cccggaagcttctcctttatcttctccttgatgcccttcttct 1484
>gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds Length = 829 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||| ||||| || || ||||||||||||||||||||||||||||||||||| Sbjct: 699 agtgttgtccgggaagtttctccttgatcttgtccatgatccccttcttctc 648 Score = 58.0 bits (29), Expect = 3e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttct 251 |||||||||||||||||||||||||| ||||||||| Sbjct: 544 ggcagcttctccttgatcttgtccatcgtccccttct 508 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttcctcctcc 428 ||||||||||| | ||||||||||| ||||||||| |||||| Sbjct: 442 agcttctcctttaccttctccttcaaccccttcttcttcctcc 400
>gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab21) mRNA, complete cds Length = 897 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||| ||||| || || ||||||||||||||||||||||||||||||||||| Sbjct: 693 agtgttgtccgggaagtttctccttgatcttgtccatgatccccttcttctc 642 Score = 58.0 bits (29), Expect = 3e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttct 251 |||||||||||||||||||||||||| ||||||||| Sbjct: 538 ggcagcttctccttgatcttgtccatcgtccccttct 502 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttcctcct 426 ||||||| ||| ||||||||||||| ||||||||| |||| Sbjct: 436 agcttcttctttatcttctccttcaaccccttcttcttcct 396
>emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd38 Length = 555 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| ||||||||||||||||||||| Sbjct: 128 agcttctccttgatgttctccatgatgcccttcttctcgccggtgccg 81 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||||||||| | ||||||||||| | ||||||||| ||||||| Sbjct: 343 agtgctgtccaggcagcttctccttcaccttgtccatgaggctcttcttctcaccggtgc 284 Query: 264 cg 265 || Sbjct: 283 cg 282 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| |||||||||||||||||||| |||||| | |||||||||||| Sbjct: 140 tggccaccggggagcttctccttgatgttctccatgatgcccttcttc 93
>emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd25a Length = 565 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccg 265 |||||||||||||| || |||||||| ||||||||||||||||||||| Sbjct: 134 agcttctccttgatgttctccatgatgcccttcttctcgccggtgccg 87 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 204 agtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccggtgc 263 |||||||||| |||||||||||||| | ||||||||||| | ||||||||| ||||||| Sbjct: 349 agtgctgtccaggcagcttctccttcaccttgtccatgaggctcttcttctcaccggtgc 290 Query: 264 cg 265 || Sbjct: 289 cg 288 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| |||||||||||||||||||| |||||| | |||||||||||| Sbjct: 146 tggccaccggggagcttctccttgatgttctccatgatgcccttcttc 99
>ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 687 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 428 |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||||| Sbjct: 543 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 485 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||| |||||||||||| Sbjct: 672 gccggggagcttctccttgatcttctccacgatgcccttcttc 630 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| |||| ||| |||||||||||| Sbjct: 665 agcttctccttgatcttctccacgatgcccttcttctcg 627
>gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, partial cds Length = 322 Score = 69.9 bits (35), Expect = 7e-09 Identities = 38/39 (97%) Strand = Plus / Minus Query: 368 tccttgtggccgccggggagcttctccttgatcttctcc 406 ||||||||||||||||| ||||||||||||||||||||| Sbjct: 224 tccttgtggccgccgggaagcttctccttgatcttctcc 186 Score = 44.1 bits (22), Expect = 0.41 Identities = 34/38 (89%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||| ||||| | |||||| ||||| Sbjct: 206 agcttctccttgatcttctccataaacccctttttctc 169
>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein mRNA, complete cds Length = 1021 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 428 |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||||| Sbjct: 632 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 574 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||| |||||||||||| Sbjct: 761 gccggggagcttctccttgatcttctccacgatgcccttcttc 719 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| |||| ||| |||||||||||| Sbjct: 754 agcttctccttgatcttctccacgatgcccttcttctcg 716
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 428 |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||||| Sbjct: 29117510 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 29117452 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||| |||||||||||| Sbjct: 29117639 gccggggagcttctccttgatcttctccacgatgcccttcttc 29117597 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| |||| ||| |||||||||||| Sbjct: 29117632 agcttctccttgatcttctccacgatgcccttcttctcg 29117594 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 41371466 cccttcttcctcctcccgcc 41371485 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 28500087 cccttcttcctcctcccgcc 28500106 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 6067964 cccttcttcctcctcccgcc 6067945 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 2233342 cccttcttcctcctcccgcc 2233361
>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0421H07 Length = 158126 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 428 |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||||| Sbjct: 77876 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 77818 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||| |||||||||||| Sbjct: 78005 gccggggagcttctccttgatcttctccacgatgcccttcttc 77963 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| |||| ||| |||||||||||| Sbjct: 77998 agcttctccttgatcttctccacgatgcccttcttctcg 77960
>emb|X57327.1|OSRAB25 Rice rab25 mRNA Length = 920 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 428 |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||||| Sbjct: 603 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 545 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||| |||||||||||| Sbjct: 732 gccggggagcttctccttgatcttctccacgatgcccttcttc 690 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| |||| ||| |||||||||||| Sbjct: 725 agcttctccttgatcttctccacgatgcccttcttctcg 687
>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full insert sequence Length = 761 Score = 69.9 bits (35), Expect = 7e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcc 428 |||||||| |||||| ||||||||||| ||||||||||| |||| ||||||| |||||| Sbjct: 424 cttgtggctgccgggaagcttctcctttatcttctccttgatgctcttcttcttcctcc 366 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||||||||||||||| |||||||||||| Sbjct: 553 gccggggagcttctccttgatcttctccacgatgcccttcttc 511 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||||||||| |||| ||| |||||||||||| Sbjct: 546 agcttctccttgatcttctccacgatgcccttcttctcg 508
>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete cds Length = 775 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 376 gccgccggggagcttctccttgatcttctccttcatgcccttcttcctcctcccgccc 433 |||||| || ||||||||||| ||||||||||||| ||||||||||||| ||||||| Sbjct: 379 gccgcccggaagcttctcctttatcttctccttcagtcccttcttcctccgcccgccc 322 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||| ||||| |||||||||||||| Sbjct: 462 agcttctccttgatcttttccatcatccccttcttctc 425 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||||||| ||| |||| ||||||||| Sbjct: 462 agcttctccttgatcttttccatcatccccttcttc 427
>dbj|AB076807.1| Triticum aestivum Wdhn13 mRNA for LEA D-11 dehydrin, complete cds Length = 657 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 199 ggctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgcc 258 |||| |||||||||| |||||||| ||||||||||||||||| || | ||| ||||| || Sbjct: 388 ggcttagtgctgtccaggcagcttgtccttgatcttgtccatcatgctcttgttctcacc 329 Query: 259 ggtgc 263 ||||| Sbjct: 328 ggtgc 324 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcgccggtgccgg 266 |||||||||||||| || || | || |||||||||||||||||||||| Sbjct: 207 agcttctccttgatgttctcgacgacgcccttcttctcgccggtgccgg 159
>emb|X64327.1|LGNPR1 L.gibba gene NPR1 (negatively phytochrome regulated 1) Length = 1573 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 212 cccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||| ||||| ||||| |||||||||||||| Sbjct: 1479 cccggcagcttctcctttatcttctccattatccccttcttctc 1436 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 212 cccggcagcttctccttgatcttgtccatgatccccttcttct 254 ||||||| ||| ||||||||||| |||||||| |||||||||| Sbjct: 1368 cccggcatcttatccttgatcttctccatgatgcccttcttct 1326 Score = 50.1 bits (25), Expect = 0.007 Identities = 51/59 (86%), Gaps = 3/59 (5%) Strand = Plus / Minus Query: 392 tccttgatcttctccttcatgcccttctt---cctcctcccgcccatgccgtcgtcctc 447 ||||||||||||||| | ||||||||||| ||||||||| ||||| ||||| ||||| Sbjct: 1356 tccttgatcttctccatgatgcccttcttcttcctcctccctcccatcccgtcatcctc 1298 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||| ||||||||| | || ||||||||| Sbjct: 1473 agcttctcctttatcttctccattatccccttcttc 1438
>ref|NM_126038.2| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18) transcript variant AT5G66400.1 mRNA, complete cds Length = 864 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcg 593 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttc 596
>ref|NM_001037085.1| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18) transcript variant AT5G66400.2 mRNA, complete cds Length = 881 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 628 agcttttccttgatcttgtccatcatccccttcttctcg 590 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 634 ccgggaagcttttccttgatcttgtccatcatccccttcttc 593
>gb|L04173.1|ATH18RAB Arabidopsis thaliana glycine rich protein (RAB18) gene, complete cds Length = 1676 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 1381 agcttttccttgatcttgtccatcatccccttcttctcg 1343 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 1387 ccgggaagcttttccttgatcttgtccatcatccccttcttc 1346
>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related protein Length = 1742 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||||||||| ||||||||||| ||||| |||||||| |||||||| Sbjct: 1415 tggccgccgggaagcttctccttcatcttgtccttcatccccttctt 1369 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 |||||||| ||||||||||||||||| ||||| ||||| Sbjct: 1517 agcttctctttgatcttgtccatgatgccctttttctc 1480 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgccctt 417 ||||||||||| |||||||| |||||||| ||| | |||||||| Sbjct: 1529 tggccgccgggaagcttctctttgatcttgtccatgatgccctt 1486 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttctt 252 ||||||||||| ||||||||| | ||||||||||| Sbjct: 1403 agcttctccttcatcttgtccttcatccccttctt 1369
>gb|AY093779.1| Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds Length = 798 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 624 agcttttccttgatcttgtccatcatccccttcttctcg 586 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 630 ccgggaagcttttccttgatcttgtccatcatccccttcttc 589
>gb|AF428458.1|AF428458 Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds Length = 861 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcg 593 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttc 596
>gb|AY050416.1| Arabidopsis thaliana At1g11360/T23J18_35 mRNA, complete cds Length = 1018 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 235 agcttttccttgatcttgtccatcatccccttcttctcg 273 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Plus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 229 ccgggaagcttttccttgatcttgtccatcatccccttcttc 270
>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 741 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgcccttctt 420 ||||||||||| ||||||||||| ||||| |||||||| |||||||| Sbjct: 414 tggccgccgggaagcttctccttcatcttgtccttcatccccttctt 368 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 |||||||| ||||||||||||||||| ||||| ||||| Sbjct: 516 agcttctctttgatcttgtccatgatgccctttttctc 479 Score = 48.1 bits (24), Expect = 0.026 Identities = 39/44 (88%) Strand = Plus / Minus Query: 374 tggccgccggggagcttctccttgatcttctccttcatgccctt 417 ||||||||||| |||||||| |||||||| ||| | |||||||| Sbjct: 528 tggccgccgggaagcttctctttgatcttgtccatgatgccctt 485 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttctt 252 ||||||||||| ||||||||| | ||||||||||| Sbjct: 402 agcttctccttcatcttgtccttcatccccttctt 368
>emb|AJ606474.1| Fagus sylvatica mRNA for dehydrin/response ABA (rab1 gene) Length = 952 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 209 tgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||| || ||||||||||| ||||| |||||||||||||||||||| Sbjct: 764 tgtccaggaagcttctcctttatcttttccatgatccccttcttctc 718
>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13 Length = 83511 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Plus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 7446 agcttttccttgatcttgtccatcatccccttcttctcg 7484 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Plus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 7440 ccgggaagcttttccttgatcttgtccatcatccccttcttc 7481
>emb|X68042.1|ATRAB18A A.thaliana rab18 gene Length = 1528 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 1237 agcttttccttgatcttgtccatcatccccttcttctcg 1199 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 1243 ccgggaagcttttccttgatcttgtccatcatccccttcttc 1202
>gb|BT002226.1| Arabidopsis thaliana At5g66400/K1F13_5 mRNA, complete cds Length = 561 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 542 agcttttccttgatcttgtccatcatccccttcttctcg 504 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||| ||||||||||| ||| |||| ||||||||| Sbjct: 548 ccgggaagcttttccttgatcttgtccatcatccccttcttc 507
>gb|AY425975.1| Streptocarpus primulifolius microsatellite B22 sequence Length = 646 Score = 60.0 bits (30), Expect = 7e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 368 tccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttcctcc 425 ||||| |||||||| || || |||||||||||||| |||||||| |||||||| |||| Sbjct: 252 tccttatggccgcctggtagtttctccttgatcttatccttcatccccttctttctcc 195 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 389 ttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||| ||| |||||||||||||| Sbjct: 399 ttctccttgatcttatccatcatgcccttcttc 367 Score = 48.1 bits (24), Expect = 0.026 Identities = 33/36 (91%) Strand = Plus / Minus Query: 221 ttctccttgatcttgtccatgatccccttcttctcg 256 |||||||||||||| ||||| || |||||||||||| Sbjct: 399 ttctccttgatcttatccatcatgcccttcttctcg 364 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 221 ttctccttgatcttgtccatgatccccttctt 252 |||||||||||||| ||| | ||||||||||| Sbjct: 231 ttctccttgatcttatccttcatccccttctt 200
>dbj|AB126059.1| Codonopsis lanceolata mRNA for dehydrin 1, complete cds Length = 813 Score = 60.0 bits (30), Expect = 7e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttcctcctcccgcccatgccgtcgtcc 445 |||||||||||||| || ||||| || |||||||||||||| || ||||| || |||||| Sbjct: 419 agcttctccttgattttttcctttatccccttcttcctccttccacccatcccatcgtcc 360 Query: 446 tc 447 || Sbjct: 359 tc 358 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 212 cccggcagcttctccttgatcttgtccatgatccccttcttc 253 |||||||||||||||||||| || ||| | |||||||||||| Sbjct: 425 cccggcagcttctccttgattttttcctttatccccttcttc 384
>dbj|AB049336.1| Nicotiana tabacum NtERD10B mRNA for dehydrin, complete cds Length = 796 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||| |||||||||||||| ||||||||||| Sbjct: 530 agcttctccttaatcttgtccatgattcccttcttctc 493 Score = 44.1 bits (22), Expect = 0.41 Identities = 34/38 (89%) Strand = Plus / Minus Query: 389 ttctccttgatcttctccttcatgcccttcttcctcct 426 |||||||| |||||||||||||| || |||||| |||| Sbjct: 404 ttctccttaatcttctccttcatccctttcttcttcct 367
>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible protein 1 mRNA, complete cds Length = 1315 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 744 cttgtggccgccgggcagcttctccttgatctt 712 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||||||| ||| ||| ||||||||||| Sbjct: 470 ggcagcttctccttgatcttctccttgagccccttcttct 431 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||||||||| | ||||||||| Sbjct: 474 gccgggcagcttctccttgatcttctccttgagccccttcttc 432 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||||||||| | || ||||||||||| Sbjct: 731 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 691
>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1) mRNA, complete cds Length = 1117 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 734 cttgtggccgccgggcagcttctccttgatctt 702 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||||||| ||| ||| ||||||||||| Sbjct: 460 ggcagcttctccttgatcttctccttgagccccttcttct 421 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||||||||| | ||||||||| Sbjct: 464 gccgggcagcttctccttgatcttctccttgagccccttcttc 422 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||||||||| | || ||||||||||| Sbjct: 721 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 681
>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence Length = 391 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 252 cttgtggccgccgggcagcttctccttgatctt 220 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtcca 239 |||||||||||||||||||| |||| Sbjct: 239 ggcagcttctccttgatcttttcca 215
>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene) Length = 1127 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 659 cttgtggccgccgggcagcttctccttgatctt 627 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtcca 239 |||||||||||||||||||| |||| Sbjct: 646 ggcagcttctccttgatcttttcca 622
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 27184543 cttgtggccgccgggcagcttctccttgatctt 27184575 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||||||| ||| ||| ||||||||||| Sbjct: 27184817 ggcagcttctccttgatcttctccttgagccccttcttct 27184856 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||||||||| | ||||||||| Sbjct: 27184813 gccgggcagcttctccttgatcttctccttgagccccttcttc 27184855 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||||||||| | || ||||||||||| Sbjct: 27184556 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 27184596 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 cccttcttcctcctcccgcc 432 |||||||||||||||||||| Sbjct: 34736311 cccttcttcctcctcccgcc 34736330 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 389 ttctccttgatcttctcctt 408 |||||||||||||||||||| Sbjct: 34288041 ttctccttgatcttctcctt 34288060
>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence Length = 1130 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 640 cttgtggccgccgggcagcttctccttgatctt 608 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||||||||||||||||||| ||||||| || |||||||| Sbjct: 627 ggcagcttctccttgatcttttccatgaagcctttcttctc 587
>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1725_H08 Length = 155431 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 80992 cttgtggccgccgggcagcttctccttgatctt 81024 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||||||| ||| ||| ||||||||||| Sbjct: 81266 ggcagcttctccttgatcttctccttgagccccttcttct 81305 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||||||||| | ||||||||| Sbjct: 81262 gccgggcagcttctccttgatcttctccttgagccccttcttc 81304 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||||||||| | || ||||||||||| Sbjct: 81005 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 81045
>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0684A08 Length = 137841 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 35214 cttgtggccgccgggcagcttctccttgatctt 35246 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||||||| ||| ||| ||||||||||| Sbjct: 35488 ggcagcttctccttgatcttctccttgagccccttcttct 35527 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||||||||| | ||||||||| Sbjct: 35484 gccgggcagcttctccttgatcttctccttgagccccttcttc 35526 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||||||||| | || ||||||||||| Sbjct: 35227 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 35267
>emb|X84056.1|HVPAF93 H.vulgare paf93 gene Length = 1154 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 650 cttgtggccgccgggcagcttctccttgatctt 618 Score = 48.1 bits (24), Expect = 0.026 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||| || ||||||||||||| ||||||||| | ||||||||| Sbjct: 461 gttgtccttgtggccg---ggcagcttctccttgagcttctccttgagacccttcttc 407 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtcca 239 |||||||||||||||||||| |||| Sbjct: 637 ggcagcttctccttgatcttttcca 613 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||| ||| ||| ||| |||||||||| Sbjct: 445 ggcagcttctccttgagcttctccttgagacccttcttct 406
>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full insert sequence Length = 1292 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 756 cttgtggccgccgggcagcttctccttgatctt 724 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||||||| ||| ||| ||||||||||| Sbjct: 482 ggcagcttctccttgatcttctccttgagccccttcttct 443 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||||||||||||| | ||||||||| Sbjct: 486 gccgggcagcttctccttgatcttctccttgagccccttcttc 444 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||||||||| | || ||||||||||| Sbjct: 743 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 703
>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds Length = 2254 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 1930 cttgtggccgccgggcagcttctccttgatctt 1898 Score = 48.1 bits (24), Expect = 0.026 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||| || ||||||||||||| ||||||||| | ||||||||| Sbjct: 1741 gttgtccttgtggccg---ggcagcttctccttgagcttctccttgagacccttcttc 1687 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtcca 239 |||||||||||||||||||| |||| Sbjct: 1917 ggcagcttctccttgatcttttcca 1893 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||| ||| ||| ||| |||||||||| Sbjct: 1725 ggcagcttctccttgagcttctccttgagacccttcttct 1686
>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c) mRNA, complete cds Length = 1242 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 662 cttgtggccgccgggcagcttctccttgatctt 630 Score = 46.1 bits (23), Expect = 0.10 Identities = 38/43 (88%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||| ||||||||||||| ||||||||| | ||||||||| Sbjct: 461 gccgggcagcttctccttgagcttctccttgagacccttcttc 419 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtcca 239 |||||||||||||||||||| |||| Sbjct: 649 ggcagcttctccttgatcttttcca 625 Score = 40.1 bits (20), Expect = 6.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttct 254 |||||||||||||||| ||| ||| ||| |||||||||| Sbjct: 457 ggcagcttctccttgagcttctccttgagacccttcttct 418
>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b) mRNA, complete cds Length = 1181 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 647 cttgtggccgccgggcagcttctccttgatctt 615 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtcca 239 |||||||||||||||||||| |||| Sbjct: 634 ggcagcttctccttgatcttttcca 610
>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete cds Length = 1136 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 662 cttgtggccgccgggcagcttctccttgatctt 630 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtcca 239 |||||||||||||||||||| |||| Sbjct: 649 ggcagcttctccttgatcttttcca 625
>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds Length = 680 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgatctt 402 ||||||||||||||| ||||||||||||||||| Sbjct: 177 cttgtggccgccgggcagcttctccttgatctt 145 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||||||||||||||| | || ||||||||||| Sbjct: 164 ggcagcttctccttgatcttgtcgaggaagcccttcttctc 124
>emb|AJ704825.1| Glycine max partial lea8 gene for putative dehydrin Length = 591 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 221 ttctccttgatcttgtccatgatccccttcttctcg 256 |||||||||||||||||||| ||||| ||||||||| Sbjct: 581 ttctccttgatcttgtccataatccctttcttctcg 546
>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 634 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 379 gccggggagcttctccttgatcttctcc 406 |||||||||||||||||||||||||||| Sbjct: 406 gccggggagcttctccttgatcttctcc 379 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 202 tcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||| || || ||||||||||||||||| ||||| | ||| |||||||| Sbjct: 415 tcagtgctggccggggagcttctccttgatcttctccatcacccctttcttctc 362
>gb|AY105067.1| Zea mays PCO081051 mRNA sequence Length = 1398 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 371 ttgtggccgccggggagcttctccttgatctt 402 |||||||| ||||||||||||||||||||||| Sbjct: 773 ttgtggccaccggggagcttctccttgatctt 742 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtcca 239 |||||||||||||||||||||| Sbjct: 758 agcttctccttgatcttgtcca 737 Score = 40.1 bits (20), Expect = 6.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctccttcatgcccttcttc 421 ||||||||||||| ||||||||| | |||| ||||| Sbjct: 509 agcttctccttgagcttctccttgaggcccatcttc 474
>gb|M94012.1|SOYMATSGB Glycine max maturation-associated protein (MAT9) mRNA, complete cds Length = 947 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||| ||||||||||| ||||| ||||||||| Sbjct: 695 agcttctccttaatcttgtccataatccctttcttctcg 657
>gb|U10111.1|GMU10111 Glycine max Essex dehydrin-like protein mRNA, complete cds Length = 958 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctcg 256 ||||||||||| ||||||||||| ||||| ||||||||| Sbjct: 685 agcttctccttaatcttgtccataatccctttcttctcg 647
>gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds Length = 853 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ccggggagcttctccttgatcttctccttcatgcccttcttc 421 ||||| ||||||||||||||||||||| |||| || |||||| Sbjct: 536 ccgggcagcttctccttgatcttctccatcattcctttcttc 495 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 215 ggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||||||||||||||||||| ||||| || || |||||||| Sbjct: 533 ggcagcttctccttgatcttctccatcattcctttcttctc 493
>gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod60) mRNA, complete cds Length = 1921 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 206 tgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctc 255 |||||||| || ||||||||||||||||| ||||||| || |||||||| Sbjct: 1751 tgctgtccaggaagcttctccttgatcttctccatgactcctttcttctc 1702 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 386 agcttctccttgatcttctcc 406 ||||||||||||||||||||| Sbjct: 1739 agcttctccttgatcttctcc 1719
>gb|U91970.1|PSU91970 Pisum sativum dehydrin 3 (Dhn3) mRNA, complete cds Length = 809 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||| ||||||||||| ||||| |||||||| Sbjct: 614 agcttctccttaatcttgtccataatccctttcttctc 577
>gb|U91969.1|PSU91969 Pisum sativum dehydrin 2 (Dhn2) mRNA, complete cds Length = 1125 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||| ||||||||||| ||||| |||||||| Sbjct: 834 agcttctccttaatcttgtccataatccctttcttctc 797
>dbj|AB049335.1| Nicotiana tabacum NtERD10A mRNA for dehydrin, partial cds Length = 342 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||| ||||||||||| || ||||||||||| Sbjct: 65 agcttctccttaatcttgtccataattcccttcttctc 28
>emb|X94979.1|BOPC34 B.oleracea mRNA for pollen coat protein (clone bopc34) Length = 882 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 218 agcttctccttgatcttgtccatgatccccttcttctc 255 ||||||||||| ||||| |||| ||||||||||||||| Sbjct: 609 agcttctccttaatcttctccaagatccccttcttctc 572
>gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, complete cds Length = 808 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 370 cttgtggccgccggggagcttctccttgat 399 ||||||||||||||| |||||||||||||| Sbjct: 557 cttgtggccgccgggcagcttctccttgat 528 Score = 40.1 bits (20), Expect = 6.4 Identities = 49/58 (84%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 364 gttgtccttgtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 421 |||||||||||||||| || ||||||||||||| |||| |||| | ||||||||| Sbjct: 368 gttgtccttgtggccg---ggcagcttctccttgagcttccccttgagacccttcttc 314 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,868,604 Number of Sequences: 3902068 Number of extensions: 4868604 Number of successful extensions: 146130 Number of sequences better than 10.0: 589 Number of HSP's better than 10.0 without gapping: 624 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 139563 Number of HSP's gapped (non-prelim): 6488 length of query: 474 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 452 effective length of database: 17,147,199,772 effective search space: 7750534296944 effective search space used: 7750534296944 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
