ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags28d22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL645761.8| Human DNA sequence from clone RP11-514N2 on chro... 46 0.13
2ref|NM_214574.1| Strongylocentrotus purpuratus Kruppel/Krox-rela... 42 2.0
3gb|AF102558.2|AF102558 Strongylocentrotus purpuratus Krox1 prote... 42 2.0
4gb|DQ177152.1| Strongylocentrotus purpuratus Blimp1/Krox1b (blim... 42 2.0
5gb|DQ225099.1| Strongylocentrotus purpuratus Blimp1/Krox1a late ... 42 2.0
6gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, com... 40 8.0
7ref|XM_508719.1| PREDICTED: Pan troglodytes baculoviral IAP repe... 40 8.0
8gb|AY764389.1| Homo sapiens baculoviral IAP repeat-containing 3 ... 40 8.0
9gb|AC123854.3| Mus musculus BAC clone RP23-328J8 from chromosome... 40 8.0
10gb|AC122872.3| Mus musculus BAC clone RP23-110E8 from 1, complet... 40 8.0
11emb|AL606458.5| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 8.0
12gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, com... 40 8.0
13ref|NM_001165.3| Homo sapiens baculoviral IAP repeat-containing ... 40 8.0
14ref|NM_182962.1| Homo sapiens baculoviral IAP repeat-containing ... 40 8.0
15emb|AL080273.10|HSBA259P1 Human DNA sequence from clone RP11-259... 40 8.0
16gb|BC037420.1| Homo sapiens baculoviral IAP repeat-containing 3,... 40 8.0
17gb|AC009435.5| Homo sapiens chromosome , clone RP11-124B13, comp... 40 8.0
18gb|AC046144.15| Homo sapiens 3 BAC RP11-628J14 (Roswell Park Can... 40 8.0
19dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.0
20gb|AC011727.16| Homo sapiens chromosome 8, clone RP11-10H7, comp... 40 8.0
21emb|BX248083.4| Zebrafish DNA sequence from clone CH211-255B5 in... 40 8.0
22emb|AL110490.1|CEY48B6A Caenorhabditis elegans YAC Y48B6A, compl... 40 8.0
23dbj|AK063893.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.0
24emb|BX511298.10| Zebrafish DNA sequence from clone DKEY-210E13 i... 40 8.0
25gb|AF123094.1|AF123094 Homo sapiens API2-MLT fusion protein (API... 40 8.0
26gb|AF070674.1|AF070674 Homo sapiens inhibitor of apoptosis prote... 40 8.0
27dbj|AP000942.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 8.0
28dbj|AP001167.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 8.0
29gb|U37546.1|HSU37546 Human IAP homolog C (MIHC) mRNA, complete cds 40 8.0
30gb|U45878.1|HSU45878 Human inhibitor of apoptosis protein 1 mRNA... 40 8.0
31gb|L49432.1|HUMSCPB Homo sapiens TNFR2-TRAF signalling complex p... 40 8.0
32dbj|AP004248.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 8.0

>emb|AL645761.8| Human DNA sequence from clone RP11-514N2 on chromosome 1 Contains the
             3' end of the gene for short-chain dehydrogenase/reductase
             1 (SDR1) and a CpG island, complete sequence
          Length = 56690

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 202   ttagcgtgagatgaacactgaca 224
             |||||||||||||||||||||||
Sbjct: 21742 ttagcgtgagatgaacactgaca 21764



to top

>ref|NM_214574.1| Strongylocentrotus purpuratus Kruppel/Krox-related gene 1 (Krox1),
            mRNA
          Length = 4023

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 411  caatcctgccctcaaactcga 431
            |||||||||||||||||||||
Sbjct: 2209 caatcctgccctcaaactcga 2229



to top

>gb|AF102558.2|AF102558 Strongylocentrotus purpuratus Krox1 protein mRNA, complete cds
          Length = 4023

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 411  caatcctgccctcaaactcga 431
            |||||||||||||||||||||
Sbjct: 2209 caatcctgccctcaaactcga 2229



to top

>gb|DQ177152.1| Strongylocentrotus purpuratus Blimp1/Krox1b (blimp1/krox) mRNA,
            complete cds, alternatively spliced
          Length = 4083

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 411  caatcctgccctcaaactcga 431
            |||||||||||||||||||||
Sbjct: 2316 caatcctgccctcaaactcga 2336



to top

>gb|DQ225099.1| Strongylocentrotus purpuratus Blimp1/Krox1a late isoform mRNA,
            complete cds, alternatively spliced
          Length = 3974

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 411  caatcctgccctcaaactcga 431
            |||||||||||||||||||||
Sbjct: 2207 caatcctgccctcaaactcga 2227



to top

>gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, complete sequence
          Length = 174540

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 220   tgacaattttttaggggaaataaa 243
             ||||||| ||||||||||||||||
Sbjct: 78914 tgacaatattttaggggaaataaa 78937



to top

>ref|XM_508719.1| PREDICTED: Pan troglodytes baculoviral IAP repeat-containing
           protein 3 (LOC451507), mRNA
          Length = 1827

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 290 tagttaatcctgagcagctt 309
           ||||||||||||||||||||
Sbjct: 809 tagttaatcctgagcagctt 828



to top

>gb|AY764389.1| Homo sapiens baculoviral IAP repeat-containing 3 (BIRC3) gene,
            complete cds
          Length = 24250

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 290  tagttaatcctgagcagctt 309
            ||||||||||||||||||||
Sbjct: 9858 tagttaatcctgagcagctt 9877



to top

>gb|AC123854.3| Mus musculus BAC clone RP23-328J8 from chromosome 1, complete sequence
          Length = 187979

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 462   gtgcaggaattttagtacta 481
             ||||||||||||||||||||
Sbjct: 55454 gtgcaggaattttagtacta 55473



to top

>gb|AC122872.3| Mus musculus BAC clone RP23-110E8 from 1, complete sequence
          Length = 190644

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 462    gtgcaggaattttagtacta 481
              ||||||||||||||||||||
Sbjct: 135863 gtgcaggaattttagtacta 135882



to top

>emb|AL606458.5| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084A10,
             complete sequence
          Length = 144811

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   aaacactggccttgtgatat 260
             ||||||||||||||||||||
Sbjct: 43752 aaacactggccttgtgatat 43771



to top

>gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, complete sequence
          Length = 192661

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 220    tgacaattttttaggggaaataaa 243
              ||||||| ||||||||||||||||
Sbjct: 147670 tgacaatattttaggggaaataaa 147693



to top

>ref|NM_001165.3| Homo sapiens baculoviral IAP repeat-containing 3 (BIRC3), transcript
            variant 1, mRNA
          Length = 5243

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 290  tagttaatcctgagcagctt 309
            ||||||||||||||||||||
Sbjct: 3591 tagttaatcctgagcagctt 3610



to top

>ref|NM_182962.1| Homo sapiens baculoviral IAP repeat-containing 3 (BIRC3), transcript
            variant 2, mRNA
          Length = 2683

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 290  tagttaatcctgagcagctt 309
            ||||||||||||||||||||
Sbjct: 1031 tagttaatcctgagcagctt 1050



to top

>emb|AL080273.10|HSBA259P1 Human DNA sequence from clone RP11-259P1 on chromosome 22 Contains
            STSs, GSSs, genomic markers D22S1154, D22S310 and D22S690
            and a gt repeat polymorphism, complete sequence
          Length = 48084

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 365  tgtgcagatgaggagaccga 384
            ||||||||||||||||||||
Sbjct: 4447 tgtgcagatgaggagaccga 4466



to top

>gb|BC037420.1| Homo sapiens baculoviral IAP repeat-containing 3, transcript
           variant 1, mRNA (cDNA clone MGC:46142 IMAGE:5497880),
           complete cds
          Length = 2591

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 290 tagttaatcctgagcagctt 309
           ||||||||||||||||||||
Sbjct: 945 tagttaatcctgagcagctt 964



to top

>gb|AC009435.5| Homo sapiens chromosome , clone RP11-124B13, complete sequence
          Length = 133148

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 272    cttctttttagctccattta 291
              ||||||||||||||||||||
Sbjct: 117825 cttctttttagctccattta 117844



to top

>gb|AC046144.15| Homo sapiens 3 BAC RP11-628J14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188840

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 94     acctgatctacagcatgttaactgcagt 121
              ||||||| ||||||||||| ||||||||
Sbjct: 174816 acctgatgtacagcatgttcactgcagt 174789



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 241      aaacactggccttgtgatat 260
                ||||||||||||||||||||
Sbjct: 21394002 aaacactggccttgtgatat 21394021



to top

>gb|AC011727.16| Homo sapiens chromosome 8, clone RP11-10H7, complete sequence
          Length = 152530

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 272   cttctttttagctccattta 291
             ||||||||||||||||||||
Sbjct: 44198 cttctttttagctccattta 44217



to top

>emb|BX248083.4| Zebrafish DNA sequence from clone CH211-255B5 in linkage group 5,
             complete sequence
          Length = 148679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 150   taaaaataatactgtatgtg 169
             ||||||||||||||||||||
Sbjct: 22460 taaaaataatactgtatgtg 22441



to top

>emb|AL110490.1|CEY48B6A Caenorhabditis elegans YAC Y48B6A, complete sequence
          Length = 101295

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 220   tgacaattttttaggggaaa 239
             ||||||||||||||||||||
Sbjct: 76525 tgacaattttttaggggaaa 76544



to top

>dbj|AK063893.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-G08, full
           insert sequence
          Length = 673

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 241 aaacactggccttgtgatat 260
           ||||||||||||||||||||
Sbjct: 591 aaacactggccttgtgatat 572



to top

>emb|BX511298.10| Zebrafish DNA sequence from clone DKEY-210E13 in linkage group 4,
             complete sequence
          Length = 217817

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 133   aaatgggtagacaaacgtaaaaat 156
             ||||||||||||||| ||||||||
Sbjct: 38325 aaatgggtagacaaaggtaaaaat 38302



to top

>gb|AF123094.1|AF123094 Homo sapiens API2-MLT fusion protein (API2-MLT) mRNA, complete cds
          Length = 3734

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 290 tagttaatcctgagcagctt 309
           ||||||||||||||||||||
Sbjct: 931 tagttaatcctgagcagctt 950



to top

>gb|AF070674.1|AF070674 Homo sapiens inhibitor of apoptosis protein-1 (MIHC) mRNA, complete
            cds
          Length = 5212

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 290  tagttaatcctgagcagctt 309
            ||||||||||||||||||||
Sbjct: 3560 tagttaatcctgagcagctt 3579



to top

>dbj|AP000942.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-864G5, complete
              sequence
          Length = 185984

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 290    tagttaatcctgagcagctt 309
              ||||||||||||||||||||
Sbjct: 100662 tagttaatcctgagcagctt 100681



to top

>dbj|AP001167.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-890D8, complete
             sequences
          Length = 39970

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 290   tagttaatcctgagcagctt 309
             ||||||||||||||||||||
Sbjct: 13926 tagttaatcctgagcagctt 13945



to top

>gb|U37546.1|HSU37546 Human IAP homolog C (MIHC) mRNA, complete cds
          Length = 3076

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 290  tagttaatcctgagcagctt 309
            ||||||||||||||||||||
Sbjct: 1533 tagttaatcctgagcagctt 1552



to top

>gb|U45878.1|HSU45878 Human inhibitor of apoptosis protein 1 mRNA, complete cds
          Length = 2916

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 290  tagttaatcctgagcagctt 309
            ||||||||||||||||||||
Sbjct: 1257 tagttaatcctgagcagctt 1276



to top

>gb|L49432.1|HUMSCPB Homo sapiens TNFR2-TRAF signalling complex protein mRNA, complete
           cds
          Length = 2563

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 290 tagttaatcctgagcagctt 309
           ||||||||||||||||||||
Sbjct: 931 tagttaatcctgagcagctt 950



to top

>dbj|AP004248.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-709M17, complete
              sequence
          Length = 191071

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 91     tgcacctgatctacagcatgttaa 114
              ||||||||||||||||||| ||||
Sbjct: 156059 tgcacctgatctacagcattttaa 156036


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,231,135
Number of Sequences: 3902068
Number of extensions: 5231135
Number of successful extensions: 86507
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86441
Number of HSP's gapped (non-prelim): 66
length of query: 586
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 563
effective length of database: 17,143,297,704
effective search space: 9651676607352
effective search space used: 9651676607352
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top