ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags27o22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR936738.1| Homo sapiens mRNA; cDNA DKFZp686E1042 (from clon... 44 0.23
2gb|AC113372.2| Homo sapiens chromosome 5 clone RP11-160H11, comp... 44 0.23
3gb|AC011384.4| Homo sapiens chromosome 5 clone CTB-143D11, compl... 44 0.23
4gb|AC115891.7| Mus musculus chromosome 10, clone RP24-421G4, com... 40 3.6
5gb|AC110043.6| Mus musculus chromosome 10, clone RP23-296O20, co... 40 3.6
6emb|AJ277557.1|HSA277557 Homo sapiens dNT-2 gene for mitochondri... 40 3.6
7gb|AC006071.1|AC006071 Homo sapiens chromosome 17, clone hCIT.12... 40 3.6
8dbj|AP003472.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 3.6

>emb|CR936738.1| Homo sapiens mRNA; cDNA DKFZp686E1042 (from clone DKFZp686E1042)
          Length = 5988

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 191  tctgatttgacagatgaagctc 212
            ||||||||||||||||||||||
Sbjct: 5635 tctgatttgacagatgaagctc 5656



to top

>gb|AC113372.2| Homo sapiens chromosome 5 clone RP11-160H11, complete sequence
          Length = 98328

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 191   tctgatttgacagatgaagctc 212
             ||||||||||||||||||||||
Sbjct: 64123 tctgatttgacagatgaagctc 64144



to top

>gb|AC011384.4| Homo sapiens chromosome 5 clone CTB-143D11, complete sequence
          Length = 104475

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 191   tctgatttgacagatgaagctc 212
             ||||||||||||||||||||||
Sbjct: 16385 tctgatttgacagatgaagctc 16406



to top

>gb|AC115891.7| Mus musculus chromosome 10, clone RP24-421G4, complete sequence
          Length = 166946

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 151    agcactagatgcaaaaggta 170
              ||||||||||||||||||||
Sbjct: 149776 agcactagatgcaaaaggta 149795



to top

>gb|AC110043.6| Mus musculus chromosome 10, clone RP23-296O20, complete sequence
          Length = 158081

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   agcactagatgcaaaaggta 170
             ||||||||||||||||||||
Sbjct: 13884 agcactagatgcaaaaggta 13903



to top

>emb|AJ277557.1|HSA277557 Homo sapiens dNT-2 gene for mitochondrial 5'(3')-deoxyribonucleotidase
             (dNT-2 gene), exons 1-5
          Length = 44327

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   ttctgatttgacagatgaag 209
             ||||||||||||||||||||
Sbjct: 22887 ttctgatttgacagatgaag 22906



to top

>gb|AC006071.1|AC006071 Homo sapiens chromosome 17, clone hCIT.124_H_2, complete sequence
          Length = 93713

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   ttctgatttgacagatgaag 209
             ||||||||||||||||||||
Sbjct: 58535 ttctgatttgacagatgaag 58554



to top

>dbj|AP003472.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB173C10, complete
             sequence
          Length = 103804

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    gagactttgaacattggtag 43
             ||||||||||||||||||||
Sbjct: 46864 gagactttgaacattggtag 46883


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,400,010
Number of Sequences: 3902068
Number of extensions: 2400010
Number of successful extensions: 33049
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33038
Number of HSP's gapped (non-prelim): 11
length of query: 274
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 252
effective length of database: 17,147,199,772
effective search space: 4321094342544
effective search space used: 4321094342544
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top