ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags28d04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_468565.1| Oryza sativa (japonica cultivar-group), predic... 311 1e-81
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 311 1e-81
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 311 1e-81
4gb|AC105733.2| Oryza sativa (japonica cultivar-group) chromosome... 311 1e-81
5ref|NM_196466.1| Oryza sativa (japonica cultivar-group) contains... 303 3e-79
6dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 303 3e-79
7gb|AC027659.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 303 3e-79
8gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 303 3e-79
9dbj|AK059434.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 8e-77
10gb|BT017440.1| Zea mays clone EL01N0404H05.c mRNA sequence 289 5e-75
11gb|AY109334.1| Zea mays CL3259_2 mRNA sequence 280 5e-72
12gb|BT018883.1| Zea mays clone EL01T0205A07.d mRNA sequence 272 1e-69
13ref|XM_956742.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S... 113 6e-22
14ref|XM_327299.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S... 113 6e-22
15ref|XM_809649.1| Trypanosoma cruzi strain CL Brener 40S ribosoma... 96 1e-16
16gb|M63879.1|NEUCRP3 Neurospora crassa ribosomal protein gene, co... 88 4e-14
17ref|XM_809656.1| Trypanosoma cruzi strain CL Brener 40S ribosoma... 88 4e-14
18emb|BX930857.2| Gallus gallus finished cDNA, clone ChEST970j5 68 3e-08
19ref|NM_204217.1| Gallus gallus ribosomal protein S17 (RPS17), mRNA 68 3e-08
20emb|BX933819.1| Gallus gallus finished cDNA, clone ChEST38m20 68 3e-08
21gb|AY215074.1| Gallus gallus ribosomal protein S17 mRNA, complet... 68 3e-08
22emb|X07257.1|GGRPS17 Chicken mRNA for ribosomal protein S17 68 3e-08
23ref|XM_361640.1| Magnaporthe grisea 70-15 hypothetical protein (... 66 1e-07
24ref|XM_658491.1| Aspergillus nidulans FGSC A4 40S ribosomal prot... 66 1e-07
25ref|XM_750270.1| Aspergillus fumigatus Af293 ribosomal protein S... 66 1e-07
26dbj|AB226307.1| Aspergillus oryzae cDNA, contig sequence: AoEST3169 66 1e-07
27ref|NM_001036758.1| Arabidopsis thaliana structural constituent ... 64 5e-07
28ref|NM_120562.2| Arabidopsis thaliana structural constituent of ... 64 5e-07
29ref|NM_001036757.1| Arabidopsis thaliana structural constituent ... 64 5e-07
30ref|NM_180434.1| Arabidopsis thaliana structural constituent of ... 64 5e-07
31gb|BT000851.1| Arabidopsis thaliana At5g04800/MUK11_12 mRNA, com... 64 5e-07
32emb|AL162972.1|ATT1E3 Arabidopsis thaliana DNA chromosome 5, BAC... 64 5e-07
33gb|AF361843.1| Arabidopsis thaliana AT5g04800/MUK11_12 mRNA, com... 64 5e-07
34ref|NM_001013455.1| Danio rerio zgc:114188 (zgc:114188), mRNA 64 5e-07
35gb|AY087862.1| Arabidopsis thaliana clone 39018 mRNA, complete s... 64 5e-07
36gb|BC091562.1| Danio rerio zgc:114188, mRNA (cDNA clone MGC:1141... 64 5e-07
37dbj|AB008271.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 64 5e-07
38emb|CR734206.2|CNS0GTAL Tetraodon nigroviridis full-length cDNA 60 8e-06
39emb|CR733885.2|CNS0GT1O Tetraodon nigroviridis full-length cDNA 60 8e-06
40emb|CR721645.2|CNS0GJRN Tetraodon nigroviridis full-length cDNA 60 8e-06
41emb|CR716561.2|CNS0GFUI Tetraodon nigroviridis full-length cDNA 60 8e-06
42emb|CR715007.2|CNS0GENF Tetraodon nigroviridis full-length cDNA 60 8e-06
43emb|CR713801.2|CNS0GDPX Tetraodon nigroviridis full-length cDNA 60 8e-06
44emb|CR709441.2|CNS0GACT Tetraodon nigroviridis full-length cDNA 60 8e-06
45emb|CR699586.2|CNS0G2R2 Tetraodon nigroviridis full-length cDNA 60 8e-06
46emb|CR697355.2|CNS0G113 Tetraodon nigroviridis full-length cDNA 60 8e-06
47emb|CR696871.2|CNS0G0NN Tetraodon nigroviridis full-length cDNA 60 8e-06
48emb|CR694883.2|CNS0FZ4F Tetraodon nigroviridis full-length cDNA 60 8e-06
49emb|CR688673.2|CNS0FUBX Tetraodon nigroviridis full-length cDNA 60 8e-06
50emb|CR687232.2|CNS0FT7W Tetraodon nigroviridis full-length cDNA 60 8e-06
51emb|CR684996.2|CNS0FRHS Tetraodon nigroviridis full-length cDNA 60 8e-06
52emb|CR678165.2|CNS0FM89 Tetraodon nigroviridis full-length cDNA 60 8e-06
53emb|CR674580.1|CNS0FJH6 Tetraodon nigroviridis full-length cDNA 60 8e-06
54emb|CR663962.2|CNS0FBA8 Tetraodon nigroviridis full-length cDNA 60 8e-06
55emb|CR655202.2|CNS0F4IW Tetraodon nigroviridis full-length cDNA 60 8e-06
56emb|CR656244.2|CNS0F5BU Tetraodon nigroviridis full-length cDNA 60 8e-06
57emb|CR651538.2|CNS0F1P4 Tetraodon nigroviridis full-length cDNA 60 8e-06
58emb|CR632947.2|CNS0ENCP Tetraodon nigroviridis full-length cDNA 60 8e-06
59ref|XM_751922.1| Ustilago maydis 521 hypothetical protein (UM008... 58 3e-05
60ref|XM_385816.1| Gibberella zeae PH-1 chromosome 3 RS17_NEUCR 40... 58 3e-05
61dbj|AB224095.1| Aspergillus oryzae cDNA, contig sequence: AoEST0937 58 3e-05
62dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 58 3e-05
63emb|BX829605.1|CNS0A03W Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
64gb|DQ213966.1| Taeniopygia guttata clone 0064P0014G08 ribosomal ... 54 5e-04
65gb|DQ213965.1| Taeniopygia guttata clone 0061P0023H07 ribosomal ... 54 5e-04
66gb|DQ213964.1| Taeniopygia guttata clone 0058P0046B02 ribosomal ... 54 5e-04
67gb|DQ213963.1| Taeniopygia guttata clone 0058P0023E05 ribosomal ... 54 5e-04
68gb|DQ213962.1| Taeniopygia guttata clone 0063P0001H04 ribosomal ... 54 5e-04
69gb|AF548334.1| Branchiostoma belcheri ribosomal protein S17 mRNA... 54 5e-04
70emb|CR681446.2|CNS0FOR6 Tetraodon nigroviridis full-length cDNA 52 0.002
71gb|DQ066305.1| Ixodes scapularis isolate IS-6-12L-68 ribosomal p... 52 0.002
72gb|AY232491.1| Coturnix coturnix ribosomal protein S17 mRNA, com... 52 0.002
73gb|AY826141.1| Aedes albopictus clone AL_160 ribosomal protein S... 50 0.008
74ref|XM_505414.1| Yarrowia lipolytica CLIB122, YALI0F14465g predi... 50 0.008
75emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 50 0.008
76ref|XM_824152.1| Trypanosoma brucei TREU927 40S ribosomal protei... 48 0.031
77ref|XM_824151.1| Trypanosoma brucei TREU927 40S ribosomal protei... 48 0.031
78ref|XM_762597.1| Giardia lamblia ATCC 50803 ribosomal protein S1... 48 0.031
79gb|AF402826.1| Ictalurus punctatus 40S ribosomal protein S17 mRN... 48 0.031
80gb|AY909424.1| Siniperca chuatsi clone C133 40S ribosomal protei... 48 0.031
81gb|AY927787.2| Aedes aegypti 40S ribosomal protein S17 mRNA, com... 46 0.12
82ref|XM_525570.1| PREDICTED: Pan troglodytes similar to 40S ribos... 46 0.12
83ref|XM_510548.1| PREDICTED: Pan troglodytes similar to 40S ribos... 46 0.12
84gb|AY431522.1| Aedes aegypti ASAP ID: 34649 cytosolic small ribo... 46 0.12
85ref|XM_874149.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.12
86ref|XM_874055.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.12
87gb|BC070222.1| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
88gb|BC049824.1| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
89ref|NM_001021.3| Homo sapiens ribosomal protein S17 (RPS17), mRNA 46 0.12
90gb|BC019899.1| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
91gb|BC000118.1| Homo sapiens cDNA clone IMAGE:3352435, **** WARNI... 46 0.12
92gb|BC021027.1| Homo sapiens cDNA clone IMAGE:3621797, **** WARNI... 46 0.12
93emb|Z74021.1|HSB1E7 Human DNA sequence from clone SC22CB-1E7 on ... 46 0.12
94gb|AC135995.7| Homo sapiens chromosome 15, clone RP13-608F4, com... 46 0.12
95gb|AC126605.4| Homo sapiens chromosome 15, clone RP11-606M5, com... 46 0.12
96emb|CR620738.1| full-length cDNA clone CS0DK004YH09 of HeLa cell... 46 0.12
97emb|CR618357.1| full-length cDNA clone CS0DB001YL21 of Neuroblas... 46 0.12
98emb|CR618328.1| full-length cDNA clone CS0DD004YF16 of Neuroblas... 46 0.12
99emb|CR615408.1| full-length cDNA clone CS0DD004YL21 of Neuroblas... 46 0.12
100emb|CR616208.1| full-length cDNA clone CS0DI079YE09 of Placenta ... 46 0.12
101gb|AC145334.12| Pan troglodytes clone rp43-24d7, complete sequence 46 0.12
102emb|CR612555.1| full-length cDNA clone CS0DA002YJ22 of Neuroblas... 46 0.12
103emb|CR609691.1| full-length cDNA clone CS0DC001YD01 of Neuroblas... 46 0.12
104gb|AC110291.6| Homo sapiens chromosome 15, clone RP11-379H8, com... 46 0.12
105emb|CR602312.1| full-length cDNA clone CS0DL008YM17 of B cells (... 46 0.12
106emb|CR595559.1| full-length cDNA clone CS0DB009YI01 of Neuroblas... 46 0.12
107gb|AC107421.6| Homo sapiens 3 BAC RP11-8J23 (Roswell Park Cancer... 46 0.12
108gb|AC117379.3| Homo sapiens 3 BAC RP11-392C7 (Roswell Park Cance... 46 0.12
109ref|XM_939482.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.12
110ref|XM_377716.3| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.12
111ref|XM_940826.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.12
112ref|XM_172230.2| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.12
113gb|BC022370.1| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
114gb|AC010724.6|AC010724 Homo sapiens BAC clone RP11-152F13 from 1... 46 0.12
115gb|AY892179.1| Synthetic construct Homo sapiens clone FLH029468.... 46 0.12
116gb|AY889719.1| Synthetic construct Homo sapiens clone FLH029472.... 46 0.12
117dbj|AK026570.1| Homo sapiens cDNA: FLJ22917 fis, clone KAT06430 46 0.12
118gb|BC071928.1| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
119gb|BC062715.1| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
120gb|BC009407.2| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
121gb|BC020453.1| Homo sapiens ribosomal protein S17, mRNA (cDNA cl... 46 0.12
122gb|M18000.1|HUMRPS17A Human ribosomal protein S17 gene, complete... 46 0.12
123gb|M13932.1|HUMRPS17 Human ribosomal protein S17 mRNA, complete cds 46 0.12
124ref|XM_527902.1| PREDICTED: Pan troglodytes similar to 40S ribos... 44 0.48
125gb|AF539801.1| Plasmodiophora brassicae S17 ribosomal protein mR... 44 0.48
126gb|AC121814.3| Mus musculus BAC clone RP23-457H19 from chromosom... 44 0.48
127ref|XM_533364.2| PREDICTED: Canis familiaris similar to PQ loop ... 44 0.48
128gb|AC008155.10| Homo sapiens chromosome 7 clone RP11-289F17, com... 44 0.48
129ref|NM_200845.1| Danio rerio zgc:77702 (zgc:77702), mRNA 44 0.48
130ref|XM_695547.1| PREDICTED: Danio rerio similar to casein kinase... 44 0.48
131ref|XM_499473.1| PREDICTED: Homo sapiens similar to ribosomal pr... 44 0.48
132ref|XM_939008.1| PREDICTED: Homo sapiens similar to ribosomal pr... 44 0.48
133ref|XM_374655.1| PREDICTED: Homo sapiens similar to ribosomal pr... 44 0.48
134emb|AL935050.11| Zebrafish DNA sequence from clone CH211-59B1, c... 44 0.48
135gb|BC062279.1| Danio rerio zgc:77702, mRNA (cDNA clone MGC:77702... 44 0.48
136emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 44 0.48
137gb|U22230.1|FCU22230 Felis domesticus ribosomal protein S17 mRNA... 44 0.48
138gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 42 1.9
139ref|XM_812742.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 42 1.9
140ref|XM_814621.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 42 1.9
141gb|AY231772.1| Drosophila yakuba clone yak-em_RpS17 mRNA sequence 42 1.9
142emb|AL049693.16|HSDJ753D5 Human DNA sequence from clone RP4-753D... 42 1.9
143emb|AJ271817.1|DME271817 Drosophila melanogaster aay gene (parti... 42 1.9
144gb|AC010028.8| Drosophila melanogaster 3L BAC RP98-1E20 (Roswell... 42 1.9
145ref|NM_079278.2| Drosophila melanogaster Ribosomal protein S17 C... 42 1.9
146gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 42 1.9
147ref|NG_005089.1| Homo sapiens ribosomal protein S17 pseudogene (... 42 1.9
148gb|AE005112.1| Halobacterium sp. NRC-1 section 143 of 170 of the... 42 1.9
149gb|AE003552.4| Drosophila melanogaster chromosome 3L, section 33... 42 1.9
150gb|BT001651.1| Drosophila melanogaster RE44119 full insert cDNA 42 1.9
151gb|M22142.1|DRORPS17 D.melanogaster ribosomal protein S17 gene, ... 42 1.9
152gb|AY850937.1| Pectinaria gouldii ribosomal protein S17 mRNA, co... 40 7.4
153ref|NM_111897.2| Arabidopsis thaliana structural constituent of ... 40 7.4
154ref|XM_526885.1| PREDICTED: Pan troglodytes similar to zinc fing... 40 7.4
155gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl... 40 7.4
156gb|AF159690.1| Myxococcus xanthus serine/threonine kinase PKN7 (... 40 7.4
157ref|XM_867513.1| PREDICTED: Bos taurus similar to zinc finger, B... 40 7.4
158ref|XM_954834.1| Neurospora crassa OR74A hypothetical protein ( ... 40 7.4
159ref|XM_331058.1| Neurospora crassa OR74A hypothetical protein ( ... 40 7.4
160gb|AY395570.1| Chlamys farreri ribosomal protein S17 mRNA, parti... 40 7.4
161emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 7.4
162gb|AC013428.6|ATAC013428 Arabidopsis thaliana chromosome III BAC... 40 7.4
163ref|XM_505678.1| Yarrowia lipolytica CLIB122, YALI0F20768g predi... 40 7.4
164gb|DQ352890.1| Aenictus sp. 2 CSM-2006 abdominal-A (AbdA) gene, ... 40 7.4
165gb|AY091313.1| Arabidopsis thaliana putative 40S ribosomal prote... 40 7.4
166gb|CP000088.1| Thermobifida fusca YX, complete genome 40 7.4
167gb|AY063881.1| Arabidopsis thaliana putative 40S ribosomal prote... 40 7.4
168emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 7.4
169emb|AL731621.3|OSJN00268 Oryza sativa genomic DNA, chromosome 4,... 40 7.4
170gb|AC016924.19| Homo sapiens 3 BAC RP11-205A6 (Roswell Park Canc... 40 7.4
171gb|AF214654.1| Arthrobotrys dactyloides calmodulin-binding prote... 40 7.4
172gb|AY072718.1| Oryctolagus cuniculus phospholipid transfer prote... 40 7.4
173gb|AF382033.1|AF382033 Oryctolagus cuniculus phospholipid transf... 40 7.4
174emb|AL115656.1|CNS01CKW Botrytis cinerea strain T4 cDNA library 40 7.4
175emb|AL115003.1|CNS01C2R Botrytis cinerea strain T4 cDNA library 40 7.4
176emb|AL114900.1|CNS01BZW Botrytis cinerea strain T4 cDNA library 40 7.4
177emb|AL113499.1|CNS01AWZ Botrytis cinerea strain T4 cDNA library 40 7.4
178dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.4
179gb|AC011560.6|AC011560 Arabidopsis thaliana chromosome 3 BAC F13... 40 7.4
180gb|AY088250.1| Arabidopsis thaliana clone 4775 mRNA, complete se... 40 7.4
181gb|AY881984.1| Verticillium dahliae ribosomal protein S17 (crp3)... 40 7.4
182dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 7.4
183dbj|AK110039.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.4
184emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chro... 40 7.4

>ref|XM_468565.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 435

 Score =  311 bits (157), Expect = 1e-81
 Identities = 239/267 (89%)
 Strand = Plus / Minus

                                                                       
Query: 279 gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
           |||| ||||||| ||||| ||||||||||||||| | |  |||||||| |  ||||||||
Sbjct: 357 gcgcacgacgccggggaggtcggccatgccgagggaggtgagcatgtcgagggtctcctt 298

                                                                       
Query: 339 gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
           |||||||||||| ||||||||||| || |||||| | || ||||||||||||||||||||
Sbjct: 297 gtcgacgcggatgtcgtcgacctcgagcgccgacctgtccgggacgaagtccatgcggcg 238

                                                                       
Query: 399 ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
            ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 237 ctcgcgctcctcctcctggagcttgagggagatgccgcggacggggccgcgctggatgcg 178

                                                                       
Query: 459 gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
           ||||||||  |||||| ||||||||||||||||||||||||||||||| ||| ||| |||
Sbjct: 177 gcgcatcaggtgggtgctgaagccggccaccttgttgcggaggcgcttcgacggcaggat 118

                                      
Query: 519 ggacaccttcttgagcaccttcttgtt 545
            ||||||| ||  ||||||||||||||
Sbjct: 117 cgacacctcctccagcaccttcttgtt 91



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  311 bits (157), Expect = 1e-81
 Identities = 239/267 (89%)
 Strand = Plus / Plus

                                                                          
Query: 279    gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
              |||| ||||||| ||||| ||||||||||||||| | |  |||||||| |  ||||||||
Sbjct: 537809 gcgcacgacgccggggaggtcggccatgccgagggaggtgagcatgtcgagggtctcctt 537868

                                                                          
Query: 339    gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
              |||||||||||| ||||||||||| || |||||| | || ||||||||||||||||||||
Sbjct: 537869 gtcgacgcggatgtcgtcgacctcgagcgccgacctgtccgggacgaagtccatgcggcg 537928

                                                                          
Query: 399    ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
               ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 537929 ctcgcgctcctcctcctggagcttgagggagatgccgcggacggggccgcgctggatgcg 537988

                                                                          
Query: 459    gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
              ||||||||  |||||| ||||||||||||||||||||||||||||||| ||| ||| |||
Sbjct: 537989 gcgcatcaggtgggtgctgaagccggccaccttgttgcggaggcgcttcgacggcaggat 538048

                                         
Query: 519    ggacaccttcttgagcaccttcttgtt 545
               ||||||| ||  ||||||||||||||
Sbjct: 538049 cgacacctcctccagcaccttcttgtt 538075



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score =  311 bits (157), Expect = 1e-81
 Identities = 239/267 (89%)
 Strand = Plus / Plus

                                                                          
Query: 279    gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
              |||| ||||||| ||||| ||||||||||||||| | |  |||||||| |  ||||||||
Sbjct: 537807 gcgcacgacgccggggaggtcggccatgccgagggaggtgagcatgtcgagggtctcctt 537866

                                                                          
Query: 339    gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
              |||||||||||| ||||||||||| || |||||| | || ||||||||||||||||||||
Sbjct: 537867 gtcgacgcggatgtcgtcgacctcgagcgccgacctgtccgggacgaagtccatgcggcg 537926

                                                                          
Query: 399    ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
               ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 537927 ctcgcgctcctcctcctggagcttgagggagatgccgcggacggggccgcgctggatgcg 537986

                                                                          
Query: 459    gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
              ||||||||  |||||| ||||||||||||||||||||||||||||||| ||| ||| |||
Sbjct: 537987 gcgcatcaggtgggtgctgaagccggccaccttgttgcggaggcgcttcgacggcaggat 538046

                                         
Query: 519    ggacaccttcttgagcaccttcttgtt 545
               ||||||| ||  ||||||||||||||
Sbjct: 538047 cgacacctcctccagcaccttcttgtt 538073



to top

>gb|AC105733.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0043C10, complete sequence
          Length = 108688

 Score =  311 bits (157), Expect = 1e-81
 Identities = 239/267 (89%)
 Strand = Plus / Minus

                                                                         
Query: 279   gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
             |||| ||||||| ||||| ||||||||||||||| | |  |||||||| |  ||||||||
Sbjct: 78109 gcgcacgacgccggggaggtcggccatgccgagggaggtgagcatgtcgagggtctcctt 78050

                                                                         
Query: 339   gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
             |||||||||||| ||||||||||| || |||||| | || ||||||||||||||||||||
Sbjct: 78049 gtcgacgcggatgtcgtcgacctcgagcgccgacctgtccgggacgaagtccatgcggcg 77990

                                                                         
Query: 399   ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
              ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 77989 ctcgcgctcctcctcctggagcttgagggagatgccgcggacggggccgcgctggatgcg 77930

                                                                         
Query: 459   gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
             ||||||||  |||||| ||||||||||||||||||||||||||||||| ||| ||| |||
Sbjct: 77929 gcgcatcaggtgggtgctgaagccggccaccttgttgcggaggcgcttcgacggcaggat 77870

                                        
Query: 519   ggacaccttcttgagcaccttcttgtt 545
              ||||||| ||  ||||||||||||||
Sbjct: 77869 cgacacctcctccagcaccttcttgtt 77843



to top

>ref|NM_196466.1| Oryza sativa (japonica cultivar-group) contains similarity to 40S
           ribosomal protein S17 (OSJNBa0015J03.22), mRNA
          Length = 426

 Score =  303 bits (153), Expect = 3e-79
 Identities = 241/271 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
           |||||||||||| ||||| ||||||||||||||    || ||||| ||||| ||||||||
Sbjct: 357 gcgctcgacgccggggaggtcggccatgccgagcgcggcgagcatctccatggtctcctt 298

                                                                       
Query: 339 gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
           ||||||||||||||| || ||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 297 gtcgacgcggatctcctccacctcgagcgccgacttctccgggacgaagtccatgcggcg 238

                                                                       
Query: 399 ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
            ||||||||||||||||||||||| || |||||||| || ||||| ||||||||||||||
Sbjct: 237 ctcgcgctcctcctcctgcagcttcagcgagatgccccgcacgggcccgcgctggatgcg 178

                                                                       
Query: 459 gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
           ||||||||  ||||||||||| ||||||||||||||||| || ||||| ||| ||| |||
Sbjct: 177 gcgcatcaggtgggtggtgaacccggccaccttgttgcgcagccgcttcgacggcaggat 118

                                          
Query: 519 ggacaccttcttgagcaccttcttgttggtg 549
           |||||||| || |||||||||||||||||||
Sbjct: 117 ggacacctcctcgagcaccttcttgttggtg 87



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  303 bits (153), Expect = 3e-79
 Identities = 241/271 (88%)
 Strand = Plus / Minus

                                                                            
Query: 279      gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
                |||||||||||| ||||| ||||||||||||||    || ||||| ||||| ||||||||
Sbjct: 13815834 gcgctcgacgccggggaggtcggccatgccgagcgcggcgagcatctccatggtctcctt 13815775

                                                                            
Query: 339      gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
                ||||||||||||||| || ||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 13815774 gtcgacgcggatctcctccacctcgagcgccgacttctccgggacgaagtccatgcggcg 13815715

                                                                            
Query: 399      ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
                 ||||||||||||||||||||||| || |||||||| || ||||| ||||||||||||||
Sbjct: 13815714 ctcgcgctcctcctcctgcagcttcagcgagatgccccgcacgggcccgcgctggatgcg 13815655

                                                                            
Query: 459      gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
                ||||||||  ||||||||||| ||||||||||||||||| || ||||| ||| ||| |||
Sbjct: 13815654 gcgcatcaggtgggtggtgaacccggccaccttgttgcgcagccgcttcgacggcaggat 13815595

                                               
Query: 519      ggacaccttcttgagcaccttcttgttggtg 549
                |||||||| || |||||||||||||||||||
Sbjct: 13815594 ggacacctcctcgagcaccttcttgttggtg 13815564



to top

>gb|AC027659.1| Oryza sativa (japonica cultivar-group) BAC nbxb0015J03 chromosome 10,
              complete sequence
          Length = 172742

 Score =  303 bits (153), Expect = 3e-79
 Identities = 241/271 (88%)
 Strand = Plus / Minus

                                                                          
Query: 279    gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
              |||||||||||| ||||| ||||||||||||||    || ||||| ||||| ||||||||
Sbjct: 142363 gcgctcgacgccggggaggtcggccatgccgagcgcggcgagcatctccatggtctcctt 142304

                                                                          
Query: 339    gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
              ||||||||||||||| || ||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 142303 gtcgacgcggatctcctccacctcgagcgccgacttctccgggacgaagtccatgcggcg 142244

                                                                          
Query: 399    ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
               ||||||||||||||||||||||| || |||||||| || ||||| ||||||||||||||
Sbjct: 142243 ctcgcgctcctcctcctgcagcttcagcgagatgccccgcacgggcccgcgctggatgcg 142184

                                                                          
Query: 459    gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
              ||||||||  ||||||||||| ||||||||||||||||| || ||||| ||| ||| |||
Sbjct: 142183 gcgcatcaggtgggtggtgaacccggccaccttgttgcgcagccgcttcgacggcaggat 142124

                                             
Query: 519    ggacaccttcttgagcaccttcttgttggtg 549
              |||||||| || |||||||||||||||||||
Sbjct: 142123 ggacacctcctcgagcaccttcttgttggtg 142093



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  303 bits (153), Expect = 3e-79
 Identities = 241/271 (88%)
 Strand = Plus / Minus

                                                                            
Query: 279      gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
                |||||||||||| ||||| ||||||||||||||    || ||||| ||||| ||||||||
Sbjct: 13823176 gcgctcgacgccggggaggtcggccatgccgagcgcggcgagcatctccatggtctcctt 13823117

                                                                            
Query: 339      gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
                ||||||||||||||| || ||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 13823116 gtcgacgcggatctcctccacctcgagcgccgacttctccgggacgaagtccatgcggcg 13823057

                                                                            
Query: 399      ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
                 ||||||||||||||||||||||| || |||||||| || ||||| ||||||||||||||
Sbjct: 13823056 ctcgcgctcctcctcctgcagcttcagcgagatgccccgcacgggcccgcgctggatgcg 13822997

                                                                            
Query: 459      gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
                ||||||||  ||||||||||| ||||||||||||||||| || ||||| ||| ||| |||
Sbjct: 13822996 gcgcatcaggtgggtggtgaacccggccaccttgttgcgcagccgcttcgacggcaggat 13822937

                                               
Query: 519      ggacaccttcttgagcaccttcttgttggtg 549
                |||||||| || |||||||||||||||||||
Sbjct: 13822936 ggacacctcctcgagcaccttcttgttggtg 13822906



to top

>dbj|AK059434.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-F09, full
           insert sequence
          Length = 736

 Score =  295 bits (149), Expect = 8e-77
 Identities = 240/271 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
           |||||||||||| ||||| ||||||||||||||    || ||||| ||||| ||||||||
Sbjct: 454 gcgctcgacgccggggaggtcggccatgccgagcgcggcgagcatctccatggtctcctt 395

                                                                       
Query: 339 gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
           ||||||||||||||| || ||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 394 gtcgacgcggatctcctccacctcgagcgccgacttctccgggacgaagtccatgcggcg 335

                                                                       
Query: 399 ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
            ||||||||||||||||||||||| || |||||||| || ||||| ||||||||||||||
Sbjct: 334 ctcgcgctcctcctcctgcagcttcagcgagatgccccgcacgggcccgcgctggatgcg 275

                                                                       
Query: 459 gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
           ||||||||  ||||||||||| ||||||||||||||||| || ||||| ||| ||| |||
Sbjct: 274 gcgcatcaggtgggtggtgaacccggccaccttgttgcgcagccgcttcgacggcaggat 215

                                          
Query: 519 ggacaccttcttgagcaccttcttgttggtg 549
           |||||||| || || ||||||||||||||||
Sbjct: 214 ggacacctcctcgaacaccttcttgttggtg 184



to top

>gb|BT017440.1| Zea mays clone EL01N0404H05.c mRNA sequence
          Length = 511

 Score =  289 bits (146), Expect = 5e-75
 Identities = 206/225 (91%), Gaps = 1/225 (0%)
 Strand = Plus / Plus

                                                                       
Query: 279 gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
           |||||| ||||| ||||||||||||||||||||   ||||||||| ||||| ||||||||
Sbjct: 287 gcgctctacgcccgggagatcggccatgccgagtgccgccagcatctccatggtctcctt 346

                                                                       
Query: 339 gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
           ||||||||||||||| |||||||| || || |||||||| ||||||||||||||||||||
Sbjct: 347 gtcgacgcggatctcttcgacctcgagcgctgacttctccgggacgaagtccatgcggcg 406

                                                                       
Query: 399 ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
            || ||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 407 ctcccgctcctcctcctgcagcttgagcgagatgccacggacggggccccgctggatgcg 466

                                                        
Query: 459 gcgcatcanatgggtggtgaagccggc-caccttgttgcggaggc 502
           |||||||| |||||||||||||||||| |||||||||||||||||
Sbjct: 467 gcgcatcagatgggtggtgaagccggcacaccttgttgcggaggc 511



to top

>gb|AY109334.1| Zea mays CL3259_2 mRNA sequence
          Length = 1585

 Score =  280 bits (141), Expect = 5e-72
 Identities = 238/271 (87%)
 Strand = Plus / Plus

                                                                       
Query: 279 gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
           |||||| ||||| || || |||||||||||||||   || ||||| ||||| ||||||||
Sbjct: 305 gcgctcaacgccgggcaggtcggccatgccgagggcagcgagcatctccatggtctcctt 364

                                                                       
Query: 339 gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
           ||||||||||||||| |||||||| || || |||||||| || |||||||||||||||||
Sbjct: 365 gtcgacgcggatctcttcgacctcgagcgcggacttctccggcacgaagtccatgcggcg 424

                                                                       
Query: 399 ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
            |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 425 ctcgcgctcctcctcctgcagcttgagcgagatgccgcggactgggccgcgctggatgcg 484

                                                                       
Query: 459 gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
           ||||||||  |||||  ||||||| ||||||||||||||||||||||| ||  |||  ||
Sbjct: 485 gcgcatcaggtgggtactgaagccagccaccttgttgcggaggcgcttcgagggcagaat 544

                                          
Query: 519 ggacaccttcttgagcaccttcttgttggtg 549
            || |||| || |||||||||||||||||||
Sbjct: 545 cgagacctcctcgagcaccttcttgttggtg 575



to top

>gb|BT018883.1| Zea mays clone EL01T0205A07.d mRNA sequence
          Length = 1280

 Score =  272 bits (137), Expect = 1e-69
 Identities = 237/271 (87%)
 Strand = Plus / Minus

                                                                        
Query: 279  gcgctcgacgccagggagatcggccatgccgaggaacgccagcatgtccatcgtctcctt 338
            |||||| ||||| || || |||||||||||||||   || ||||| ||||| ||||||||
Sbjct: 1014 gcgctcaacgccgggcaggtcggccatgccgagggcagcgagcatctccatggtctcctt 955

                                                                        
Query: 339  gtcgacgcggatctcgtcgacctcaagagccgacttctcagggacgaagtccatgcggcg 398
            ||||||||||||||| |||||||| || || |||||||| || ||||||||| |||||||
Sbjct: 954  gtcgacgcggatctcttcgacctcgagcgcggacttctccggcacgaagtccctgcggcg 895

                                                                        
Query: 399  ttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
             |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 894  ctcgcgctcctcctcctgcagcttgagcgagatgccgcggactgggccgcgctggatgcg 835

                                                                        
Query: 459  gcgcatcanatgggtggtgaagccggccaccttgttgcggaggcgcttngactgcaagat 518
            ||||||||  |||||  ||||||| ||||||||||||||||||||||| ||  |||  ||
Sbjct: 834  gcgcatcaggtgggtactgaagccagccaccttgttgcggaggcgcttcgagggcagaat 775

                                           
Query: 519  ggacaccttcttgagcaccttcttgttggtg 549
             || |||| || |||||||||||||||||||
Sbjct: 774  cgagacctcctcgagcaccttcttgttggtg 744



to top

>ref|XM_956742.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S17 (CRP3)
           (NCU07014.1) partial mRNA
          Length = 441

 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcggcgc 462
           |||||||||||||||||||||| |||||| |||||||||||||| |||||||| ||   |
Sbjct: 233 cgctcctcctcctgcagcttgaaggagataccgcggacggggccacgctggatacgcttc 174

                                                       
Query: 463 atcanatgggtggtgaagccggccaccttgttgcggaggcgctt 506
           ||||  ||||||||| ||||||| | ||||||||||||||||||
Sbjct: 173 atcaagtgggtggtgtagccggcaatcttgttgcggaggcgctt 130



to top

>ref|XM_327299.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S17 (CRP3)
           (NCU07014.1) partial mRNA
          Length = 441

 Score =  113 bits (57), Expect = 6e-22
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcggcgc 462
           |||||||||||||||||||||| |||||| |||||||||||||| |||||||| ||   |
Sbjct: 233 cgctcctcctcctgcagcttgaaggagataccgcggacggggccacgctggatacgcttc 174

                                                       
Query: 463 atcanatgggtggtgaagccggccaccttgttgcggaggcgctt 506
           ||||  ||||||||| ||||||| | ||||||||||||||||||
Sbjct: 173 atcaagtgggtggtgtagccggcaatcttgttgcggaggcgctt 130



to top

>ref|XM_809649.1| Trypanosoma cruzi strain CL Brener 40S ribosomal protein S17
           (Tc00.1047053508827.70) partial mRNA
          Length = 591

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 60/64 (93%)
 Strand = Plus / Minus

                                                                       
Query: 386 agtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggc 445
           ||||||||||||| ||||||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 415 agtccatgcggcgctcgcgctcctcctcctgcagcttcagcgagatgccacggacggggc 356

               
Query: 446 cgcg 449
           ||||
Sbjct: 355 cgcg 352



to top

>gb|M63879.1|NEUCRP3 Neurospora crassa ribosomal protein gene, complete cds
          Length = 1714

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                        
Query: 403  cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcggcgc 462
            |||||||||||||||||||||| |||||| |||||||||||||| |||||||| ||   |
Sbjct: 1194 cgctcctcctcctgcagcttgaaggagataccgcggacggggccacgctggatacgcttc 1135

                                   
Query: 463  atcanatgggtggtgaagccggc 485
            ||||  ||||||||| |||||||
Sbjct: 1134 atcaagtgggtggtgtagccggc 1112



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 486  caccttgttgcggaggcgctt 506
            |||||||||||||||||||||
Sbjct: 1018 caccttgttgcggaggcgctt 998



to top

>ref|XM_809656.1| Trypanosoma cruzi strain CL Brener 40S ribosomal protein S17
           (Tc00.1047053508827.79) partial mRNA
          Length = 426

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                       
Query: 386 agtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggc 445
           ||||||||||||| ||||||||||||||||||||||| || |||||||| ||||| ||||
Sbjct: 250 agtccatgcggcgctcgcgctcctcctcctgcagcttcagcgagatgccacggacagggc 191

               
Query: 446 cgcg 449
           ||||
Sbjct: 190 cgcg 187



to top

>emb|BX930857.2| Gallus gallus finished cDNA, clone ChEST970j5
          Length = 472

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||| | |||||| || ||||||||||| |||||||||||
Sbjct: 255 ctcctcctcctgcagcttaatggagataccccggacggggccccgctggatgcg 202



to top

>ref|NM_204217.1| Gallus gallus ribosomal protein S17 (RPS17), mRNA
          Length = 485

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||| | |||||| || ||||||||||| |||||||||||
Sbjct: 268 ctcctcctcctgcagcttaatggagataccccggacggggccccgctggatgcg 215



to top

>emb|BX933819.1| Gallus gallus finished cDNA, clone ChEST38m20
          Length = 707

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||| | |||||| || ||||||||||| |||||||||||
Sbjct: 490 ctcctcctcctgcagcttaatggagataccccggacggggccccgctggatgcg 437



to top

>gb|AY215074.1| Gallus gallus ribosomal protein S17 mRNA, complete cds
          Length = 485

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||| | |||||| || ||||||||||| |||||||||||
Sbjct: 268 ctcctcctcctgcagcttaatggagataccccggacggggccccgctggatgcg 215



to top

>emb|X07257.1|GGRPS17 Chicken mRNA for ribosomal protein S17
          Length = 430

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||| | |||||| || ||||||||||| |||||||||||
Sbjct: 213 ctcctcctcctgcagcttaatggagataccccggacggggccccgctggatgcg 160



to top

>ref|XM_361640.1| Magnaporthe grisea 70-15 hypothetical protein (MG04114.4) partial
           mRNA
          Length = 447

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcggcgc 462
           |||||||||||||| ||||||| |||||| || |||||||| || ||||| || ||   |
Sbjct: 233 cgctcctcctcctgaagcttgaaggagataccacggacgggaccacgctgaatacgcttc 174

                                                       
Query: 463 atcanatgggtggtgaagccggccaccttgttgcggaggcgctt 506
           ||||  ||||||||| | ||||| | ||||||||| ||||||||
Sbjct: 173 atcaagtgggtggtgtaaccggcaatcttgttgcgcaggcgctt 130



to top

>ref|XM_658491.1| Aspergillus nidulans FGSC A4 40S ribosomal protein S17 (AN5979.2),
           mRNA
          Length = 420

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||||| ||||||| |||||| |||||||| ||||| ||||||||
Sbjct: 233 cgctcctcctcctgtagcttgaaggagataccgcggacagggccacgctggat 181



to top

>ref|XM_750270.1| Aspergillus fumigatus Af293 ribosomal protein S17 crp3 (Afu2g10300)
           partial mRNA
          Length = 639

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           ||||||||||||||||||||||  ||||| |||||||| ||||| ||||||||
Sbjct: 410 cgctcctcctcctgcagcttgaaagagataccgcggacagggccacgctggat 358



to top

>dbj|AB226307.1| Aspergillus oryzae cDNA, contig sequence: AoEST3169
          Length = 860

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcggcgc 462
           |||||||||||||| ||||||| |||||| || || || |||||||||||||| ||   |
Sbjct: 285 cgctcctcctcctggagcttgaaggagataccacgaacagggccgcgctggatacgcttc 226

                                                       
Query: 463 atcanatgggtggtgaagccggccaccttgttgcggaggcgctt 506
           ||||  || |||||| | ||||| | ||||||||| ||||||||
Sbjct: 225 atcaagtgagtggtgtatccggcaatcttgttgcgcaggcgctt 182



to top

>ref|NM_001036758.1| Arabidopsis thaliana structural constituent of ribosome AT5G04800
           transcript variant AT5G04800.4 mRNA, complete cds
          Length = 822

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 424 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 369



to top

>ref|NM_120562.2| Arabidopsis thaliana structural constituent of ribosome AT5G04800
           transcript variant AT5G04800.1 mRNA, complete cds
          Length = 745

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 364 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 309



to top

>ref|NM_001036757.1| Arabidopsis thaliana structural constituent of ribosome AT5G04800
           transcript variant AT5G04800.3 mRNA, complete cds
          Length = 768

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 370 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 315



to top

>ref|NM_180434.1| Arabidopsis thaliana structural constituent of ribosome AT5G04800
           transcript variant AT5G04800.2 mRNA, complete cds
          Length = 751

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 370 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 315



to top

>gb|BT000851.1| Arabidopsis thaliana At5g04800/MUK11_12 mRNA, complete cds
          Length = 426

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 251 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 196



to top

>emb|AL162972.1|ATT1E3 Arabidopsis thaliana DNA chromosome 5, BAC clone T1E3 (ESSA project)
          Length = 83485

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 385   aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
             ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 79380 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 79325



to top

>gb|AF361843.1| Arabidopsis thaliana AT5g04800/MUK11_12 mRNA, complete cds
          Length = 723

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 369 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 314



to top

>ref|NM_001013455.1| Danio rerio zgc:114188 (zgc:114188), mRNA
          Length = 490

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 400 tcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           ||||||||||||||||||||||||| |||||| || | ||| || |||||||||||
Sbjct: 257 tcgcgctcctcctcctgcagcttgatggagattcctctgaccggcccgcgctggat 202



to top

>gb|AY087862.1| Arabidopsis thaliana clone 39018 mRNA, complete sequence
          Length = 718

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 364 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 309



to top

>gb|BC091562.1| Danio rerio zgc:114188, mRNA (cDNA clone MGC:114188 IMAGE:7431996),
           complete cds
          Length = 490

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 400 tcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           ||||||||||||||||||||||||| |||||| || | ||| || |||||||||||
Sbjct: 257 tcgcgctcctcctcctgcagcttgatggagattcctctgaccggcccgcgctggat 202



to top

>dbj|AB008271.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUK11
          Length = 79073

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 385   aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
             ||||||||||||||||| |||||||| ||||| |||||||| ||||| || |||||
Sbjct: 36993 aagtccatgcggcgttcacgctcctcttcctgaagcttgagtgagattccacggac 36938



to top

>emb|CR734206.2|CNS0GTAL Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 252 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 199



to top

>emb|CR733885.2|CNS0GT1O Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 252 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 199



to top

>emb|CR721645.2|CNS0GJRN Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR716561.2|CNS0GFUI Tetraodon nigroviridis full-length cDNA
          Length = 440

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 229 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 176



to top

>emb|CR715007.2|CNS0GENF Tetraodon nigroviridis full-length cDNA
          Length = 510

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 292 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 239



to top

>emb|CR713801.2|CNS0GDPX Tetraodon nigroviridis full-length cDNA
          Length = 470

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 254 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 201



to top

>emb|CR709441.2|CNS0GACT Tetraodon nigroviridis full-length cDNA
          Length = 471

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR699586.2|CNS0G2R2 Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR697355.2|CNS0G113 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR696871.2|CNS0G0NN Tetraodon nigroviridis full-length cDNA
          Length = 996

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 229 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 176



to top

>emb|CR694883.2|CNS0FZ4F Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR688673.2|CNS0FUBX Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR687232.2|CNS0FT7W Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR684996.2|CNS0FRHS Tetraodon nigroviridis full-length cDNA
          Length = 993

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 229 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 176



to top

>emb|CR678165.2|CNS0FM89 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR674580.1|CNS0FJH6 Tetraodon nigroviridis full-length cDNA
          Length = 1404

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 970 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 917



to top

>emb|CR663962.2|CNS0FBA8 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR655202.2|CNS0F4IW Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 229 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 176



to top

>emb|CR656244.2|CNS0F5BU Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR651538.2|CNS0F1P4 Tetraodon nigroviridis full-length cDNA
          Length = 466

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 202



to top

>emb|CR632947.2|CNS0ENCP Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| ||||||||| | ||| || || |||||||||||
Sbjct: 229 ctcctcctcctgcagcttgatggagatgcccctgactggaccacgctggatgcg 176



to top

>ref|XM_751922.1| Ustilago maydis 521 hypothetical protein (UM00868.1) partial mRNA
          Length = 1200

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||||| |||||||  ||||| ||||||||||| || ||||||||
Sbjct: 998 cgctcctcctcctgaagcttgaacgagataccgcggacgggaccacgctggat 946



to top

>ref|XM_385816.1| Gibberella zeae PH-1 chromosome 3 RS17_NEUCR 40S ribosomal protein
           S17 (CRP3) (FG05640.1) partial mRNA
          Length = 468

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcggcgc 462
           |||||||||||||| ||||||| |||||| || ||||| ||||| ||||| || ||   |
Sbjct: 233 cgctcctcctcctgaagcttgaaggagataccacggacagggccacgctgaattcgcttc 174

                                                       
Query: 463 atcanatgggtggtgaagccggccaccttgttgcggaggcgctt 506
           ||||  ||||||||| | || || | |||||||||||| |||||
Sbjct: 173 atcaagtgggtggtgtaaccagcaatcttgttgcggagacgctt 130



to top

>dbj|AB224095.1| Aspergillus oryzae cDNA, contig sequence: AoEST0937
          Length = 823

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||||| ||||||| |||||| || || || ||||||||||||||
Sbjct: 345 cgctcctcctcctggagcttgaaggagataccacgaacagggccgcgctggat 293



to top

>dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038
          Length = 1725576

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 403    cgctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
              |||||||||||||| ||||||| |||||| || || || ||||||||||||||
Sbjct: 272183 cgctcctcctcctggagcttgaaggagataccacgaacagggccgcgctggat 272235



to top

>emb|BX829605.1|CNS0A03W Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB24ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1247

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgag 425
           ||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 944 aagtccatgcggcgttcacgctcctcttcctgaagcttgag 904



to top

>gb|DQ213966.1| Taeniopygia guttata clone 0064P0014G08 ribosomal protein S17
           variant 1-like mRNA, complete sequence
          Length = 489

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||| || |||| ||||||||||||||| ||||| | ||||||
Sbjct: 253 ctcctcctcctgtagtttgatggagatgccgcggacagggcccctctggat 203



to top

>gb|DQ213965.1| Taeniopygia guttata clone 0061P0023H07 ribosomal protein S17
           variant 1-like mRNA, complete sequence
          Length = 504

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||| || |||| ||||||||||||||| ||||| | ||||||
Sbjct: 268 ctcctcctcctgtagtttgatggagatgccgcggacagggcccctctggat 218



to top

>gb|DQ213964.1| Taeniopygia guttata clone 0058P0046B02 ribosomal protein S17
           variant 1-like mRNA, complete sequence
          Length = 503

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||| || |||| ||||||||||||||| ||||| | ||||||
Sbjct: 268 ctcctcctcctgtagtttgatggagatgccgcggacagggcccctctggat 218



to top

>gb|DQ213963.1| Taeniopygia guttata clone 0058P0023E05 ribosomal protein S17
           variant 1-like mRNA, complete sequence
          Length = 503

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||| || |||| ||||||||||||||| ||||| | ||||||
Sbjct: 268 ctcctcctcctgtagtttgatggagatgccgcggacagggcccctctggat 218



to top

>gb|DQ213962.1| Taeniopygia guttata clone 0063P0001H04 ribosomal protein S17
           variant 2-like mRNA, complete sequence
          Length = 551

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||| || |||| ||||||||||||||| ||||| | ||||||
Sbjct: 315 ctcctcctcctgtagtttgatggagatgccgcggacagggcccctctggat 265



to top

>gb|AF548334.1| Branchiostoma belcheri ribosomal protein S17 mRNA, complete cds
          Length = 614

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggat 455
           |||||||||||||||||||| |||||| || ||||| || || ||||||||
Sbjct: 239 ctcctcctcctgcagcttgatggagataccacggactggtcctcgctggat 189



to top

>emb|CR681446.2|CNS0FOR6 Tetraodon nigroviridis full-length cDNA
          Length = 472

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||||||||||||||| || |||||| | ||| || || |||||||||||
Sbjct: 261 ctcctcctcctgcagcttgatggggatgcccctgactggaccacgctggatgcg 208



to top

>gb|DQ066305.1| Ixodes scapularis isolate IS-6-12L-68 ribosomal protein S17 mRNA,
           partial cds
          Length = 393

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||| ||||| ||||||| ||||||||| || ||||| || |||||||||||
Sbjct: 231 ctcctcttcctggagcttgatggagatgccacgcacgggaccacgctggatgcg 178



to top

>gb|AY232491.1| Coturnix coturnix ribosomal protein S17 mRNA, complete cds
          Length = 484

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 409 tcctcctgcagcttgagggagatgccgcggacggggccgcgctggatgcg 458
           |||||||| || || | |||||| |||||||| |||||||||||||||||
Sbjct: 261 tcctcctgtagtttaatggagataccgcggactgggccgcgctggatgcg 212



to top

>gb|AY826141.1| Aedes albopictus clone AL_160 ribosomal protein S17 mRNA, complete
           cds
          Length = 318

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 400 tcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           ||||| ||||||||||||||||||| |||||| || |||||
Sbjct: 161 tcgcgttcctcctcctgcagcttgatggagataccacggac 121



to top

>ref|XM_505414.1| Yarrowia lipolytica CLIB122, YALI0F14465g predicted mRNA
          Length = 417

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 403 cgctcctcctcctgcagcttgagggagatgccgcggacggg 443
           |||||||||||||| ||||||| |||||| || ||||||||
Sbjct: 233 cgctcctcctcctgaagcttgaaggagatacctcggacggg 193



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                        
Query: 403     cgctcctcctcctgcagcttgagggagatgccgcggacggg 443
               |||||||||||||| ||||||| |||||| || ||||||||
Sbjct: 1930671 cgctcctcctcctgaagcttgaaggagatacctcggacggg 1930631



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 527     tcttgagcaccttcttgttg 546
               ||||||||||||||||||||
Sbjct: 2772826 tcttgagcaccttcttgttg 2772807



to top

>ref|XM_824152.1| Trypanosoma brucei TREU927 40S ribosomal protein S17 (Tb11.01.3676)
           partial mRNA
          Length = 429

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 agtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggc 445
           ||||||||||||| || |||||||| || ||||| || || ||||| || ||||| ||||
Sbjct: 250 agtccatgcggcgctcacgctcctcttcttgcagtttcagcgagataccacggacagggc 191

               
Query: 446 cgcg 449
           ||||
Sbjct: 190 cgcg 187



to top

>ref|XM_824151.1| Trypanosoma brucei TREU927 40S ribosomal protein S17 (Tb11.01.3675)
           partial mRNA
          Length = 429

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 386 agtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggc 445
           ||||||||||||| || |||||||| || ||||| || || ||||| || ||||| ||||
Sbjct: 250 agtccatgcggcgctcacgctcctcttcttgcagtttcagcgagataccacggacagggc 191

               
Query: 446 cgcg 449
           ||||
Sbjct: 190 cgcg 187



to top

>ref|XM_762597.1| Giardia lamblia ATCC 50803 ribosomal protein S17 (GLP_2_8281_8694)
           partial mRNA
          Length = 414

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 400 tcgcgctcctcctcctgcagcttgagggagatgccgcggacggg 443
           ||||||||||||||||| ||| | || ||||||||| |||||||
Sbjct: 245 tcgcgctcctcctcctggagcctcagagagatgccgtggacggg 202



to top

>gb|AF402826.1| Ictalurus punctatus 40S ribosomal protein S17 mRNA, complete cds
          Length = 459

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 403 cgctcctcctcctgcagcttgagggagatgcc 434
           ||||||||||||||||| |||| |||||||||
Sbjct: 245 cgctcctcctcctgcagtttgatggagatgcc 214



to top

>gb|AY909424.1| Siniperca chuatsi clone C133 40S ribosomal protein S17 mRNA,
           complete cds
          Length = 498

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 403 cgctcctcctcctgcagcttgagggagatgcc 434
           ||||||||||||||||| |||| |||||||||
Sbjct: 264 cgctcctcctcctgcagtttgatggagatgcc 233



to top

>gb|AY927787.2| Aedes aegypti 40S ribosomal protein S17 mRNA, complete cds
          Length = 600

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 406 tcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||||| |||||| || |||||
Sbjct: 261 tcctcctcctgcagcttgatggagataccacggac 227



to top

>ref|XM_525570.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S17
           (LOC470186), mRNA
          Length = 432

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 255 ctcctcctcctgcagcttgatggagat 229



to top

>ref|XM_510548.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S17
           (LOC453592), mRNA
          Length = 520

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 309 ctcctcctcctgcagcttgatggagat 283



to top

>gb|AY431522.1| Aedes aegypti ASAP ID: 34649 cytosolic small ribosomal subunit S17
           mRNA sequence
          Length = 634

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 406 tcctcctcctgcagcttgagggagatgccgcggac 440
           ||||||||||||||||||| |||||| || |||||
Sbjct: 281 tcctcctcctgcagcttgatggagataccacggac 247



to top

>ref|XM_874149.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S17,
           transcript variant 4 (LOC514174), mRNA
          Length = 951

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 734 ctcctcctcctgcagcttgatggagat 708



to top

>ref|XM_874055.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S17,
            transcript variant 3 (LOC514174), mRNA
          Length = 2032

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 405  ctcctcctcctgcagcttgagggagat 431
            |||||||||||||||||||| ||||||
Sbjct: 1812 ctcctcctcctgcagcttgatggagat 1786



to top

>gb|BC070222.1| Homo sapiens ribosomal protein S17, mRNA (cDNA clone MGC:88203
           IMAGE:6738383), complete cds
          Length = 512

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 256 ctcctcctcctgcagcttgatggagat 230



to top

>gb|BC049824.1| Homo sapiens ribosomal protein S17, mRNA (cDNA clone MGC:59704
           IMAGE:6212543), complete cds
          Length = 475

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 235 ctcctcctcctgcagcttgatggagat 209



to top

>ref|NM_001021.3| Homo sapiens ribosomal protein S17 (RPS17), mRNA
          Length = 511

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 260 ctcctcctcctgcagcttgatggagat 234



to top

>gb|BC019899.1| Homo sapiens ribosomal protein S17, mRNA (cDNA clone MGC:29933
           IMAGE:3882924), complete cds
          Length = 480

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 243 ctcctcctcctgcagcttgatggagat 217



to top

>gb|BC000118.1| Homo sapiens cDNA clone IMAGE:3352435, **** WARNING: chimeric clone
            ****
          Length = 2838

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 405  ctcctcctcctgcagcttgagggagat 431
            |||||||||||||||||||| ||||||
Sbjct: 2596 ctcctcctcctgcagcttgatggagat 2570



to top

>gb|BC021027.1| Homo sapiens cDNA clone IMAGE:3621797, **** WARNING: chimeric clone
            ****
          Length = 1468

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 405  ctcctcctcctgcagcttgagggagat 431
            |||||||||||||||||||| ||||||
Sbjct: 1221 ctcctcctcctgcagcttgatggagat 1195



to top

>emb|Z74021.1|HSB1E7 Human DNA sequence from clone SC22CB-1E7 on chromosome 22 Contains a
             ribosomal protein S17 (RPS17) pseudogene and the 5' end of
             the SLC5A1 gene for solute carrier family 5 (sodiumglucose
             transporter)  member 1, complete sequence
          Length = 42493

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 405   ctcctcctcctgcagcttgagggagat 431
             |||||||||||||||||||| ||||||
Sbjct: 22487 ctcctcctcctgcagcttgatggagat 22461



to top

>gb|AC135995.7| Homo sapiens chromosome 15, clone RP13-608F4, complete sequence
          Length = 157246

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 405  ctcctcctcctgcagcttgagggagat 431
            |||||||||||||||||||| ||||||
Sbjct: 6328 ctcctcctcctgcagcttgatggagat 6302



to top

>gb|AC126605.4| Homo sapiens chromosome 15, clone RP11-606M5, complete sequence
          Length = 169125

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 405   ctcctcctcctgcagcttgagggagat 431
             |||||||||||||||||||| ||||||
Sbjct: 77898 ctcctcctcctgcagcttgatggagat 77872



to top

>emb|CR620738.1| full-length cDNA clone CS0DK004YH09 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 452

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 229 ctcctcctcctgcagcttgatggagat 203



to top

>emb|CR618357.1| full-length cDNA clone CS0DB001YL21 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 759

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 536 ctcctcctcctgcagcttgatggagat 510



to top

>emb|CR618328.1| full-length cDNA clone CS0DD004YF16 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 464

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 238 ctcctcctcctgcagcttgatggagat 212



to top

>emb|CR615408.1| full-length cDNA clone CS0DD004YL21 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 460

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 235 ctcctcctcctgcagcttgatggagat 209



to top

>emb|CR616208.1| full-length cDNA clone CS0DI079YE09 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1922

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 405  ctcctcctcctgcagcttgagggagat 431
            |||||||||||||||||||| ||||||
Sbjct: 1224 ctcctcctcctgcagcttgatggagat 1198



to top

>gb|AC145334.12| Pan troglodytes clone rp43-24d7, complete sequence
          Length = 139632

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 405   ctcctcctcctgcagcttgagggagat 431
             |||||||||||||||||||| ||||||
Sbjct: 37108 ctcctcctcctgcagcttgatggagat 37134



to top

>emb|CR612555.1| full-length cDNA clone CS0DA002YJ22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1877

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 238 ctcctcctcctgcagcttgatggagat 212



to top

>emb|CR609691.1| full-length cDNA clone CS0DC001YD01 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 461

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 238 ctcctcctcctgcagcttgatggagat 212



to top

>gb|AC110291.6| Homo sapiens chromosome 15, clone RP11-379H8, complete sequence
          Length = 186812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 405   ctcctcctcctgcagcttgagggagat 431
             |||||||||||||||||||| ||||||
Sbjct: 83947 ctcctcctcctgcagcttgatggagat 83973



to top

>emb|CR602312.1| full-length cDNA clone CS0DL008YM17 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 460

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 235 ctcctcctcctgcagcttgatggagat 209



to top

>emb|CR595559.1| full-length cDNA clone CS0DB009YI01 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 463

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 238 ctcctcctcctgcagcttgatggagat 212



to top

>gb|AC107421.6| Homo sapiens 3 BAC RP11-8J23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 160396

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 405    ctcctcctcctgcagcttgagggagat 431
              |||||||||||||||||||| ||||||
Sbjct: 146331 ctcctcctcctgcagcttgatggagat 146357



to top

>gb|AC117379.3| Homo sapiens 3 BAC RP11-392C7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181191

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 405    ctcctcctcctgcagcttgagggagat 431
              |||||||||||||||||||| ||||||
Sbjct: 167994 ctcctcctcctgcagcttgatggagat 167968



to top

>ref|XM_939482.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S17
           (LOC650398), mRNA
          Length = 529

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 266 ctcctcctcctgcagcttgatggagat 240



to top

>ref|XM_377716.3| PREDICTED: Homo sapiens similar to 40S ribosomal protein S17
           (LOC402057), mRNA
          Length = 528

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 266 ctcctcctcctgcagcttgatggagat 240



to top

>ref|XM_940826.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S17
           (LOC257039), mRNA
          Length = 624

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 447 ctcctcctcctgcagcttgatggagat 421



to top

>ref|XM_172230.2| PREDICTED: Homo sapiens similar to 40S ribosomal protein S17
           (LOC257039), mRNA
          Length = 624

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 447 ctcctcctcctgcagcttgatggagat 421



to top

>gb|BC022370.1| Homo sapiens ribosomal protein S17, mRNA (cDNA clone MGC:23905
           IMAGE:4738331), complete cds
          Length = 504

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 260 ctcctcctcctgcagcttgatggagat 234



to top

>gb|AC010724.6|AC010724 Homo sapiens BAC clone RP11-152F13 from 15, complete sequence
          Length = 157200

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 405   ctcctcctcctgcagcttgagggagat 431
             |||||||||||||||||||| ||||||
Sbjct: 19491 ctcctcctcctgcagcttgatggagat 19465



to top

>gb|AY892179.1| Synthetic construct Homo sapiens clone FLH029468.01L ribosomal
           protein S17 (RPS17) mRNA, partial cds
          Length = 408

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 231 ctcctcctcctgcagcttgatggagat 205



to top

>gb|AY889719.1| Synthetic construct Homo sapiens clone FLH029472.01X ribosomal
           protein S17 (RPS17) mRNA, complete cds
          Length = 408

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 231 ctcctcctcctgcagcttgatggagat 205



to top

>dbj|AK026570.1| Homo sapiens cDNA: FLJ22917 fis, clone KAT06430
          Length = 647

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 406 ctcctcctcctgcagcttgatggagat 380



to top

>gb|BC071928.1| Homo sapiens ribosomal protein S17, mRNA (cDNA clone MGC:88613
           IMAGE:5090053), complete cds
          Length = 488

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 246 ctcctcctcctgcagcttgatggagat 220



to top

>gb|BC062715.1| Homo sapiens ribosomal protein S17, mRNA (cDNA clone MGC:72007
           IMAGE:4068842), complete cds
          Length = 596

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 345 ctcctcctcctgcagcttgatggagat 319



to top

>gb|BC009407.2| Homo sapiens ribosomal protein S17, mRNA (cDNA clone MGC:19553
           IMAGE:4334552), complete cds
          Length = 489

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 238 ctcctcctcctgcagcttgatggagat 212



to top

>gb|BC020453.1| Homo sapiens ribosomal protein S17, mRNA (cDNA clone IMAGE:3450232)
          Length = 479

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 242 ctcctcctcctgcagcttgatggagat 216



to top

>gb|M18000.1|HUMRPS17A Human ribosomal protein S17 gene, complete cds
          Length = 4029

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 405  ctcctcctcctgcagcttgagggagat 431
            |||||||||||||||||||| ||||||
Sbjct: 1716 ctcctcctcctgcagcttgatggagat 1690



to top

>gb|M13932.1|HUMRPS17 Human ribosomal protein S17 mRNA, complete cds
          Length = 477

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 405 ctcctcctcctgcagcttgagggagat 431
           |||||||||||||||||||| ||||||
Sbjct: 256 ctcctcctcctgcagcttgatggagat 230



to top

>ref|XM_527902.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S17
           (LOC472527), mRNA
          Length = 366

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 405 ctcctcctcctgcagcttgagggaga 430
           |||||||||||||||||||| |||||
Sbjct: 230 ctcctcctcctgcagcttgatggaga 205



to top

>gb|AF539801.1| Plasmodiophora brassicae S17 ribosomal protein mRNA, partial cds
          Length = 298

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 396 gcgttcgcgctcctcctcctgcagcttgagggagatgccgcggacggggccgcg 449
           |||||||||||| |||||||| ||||| || || ||||| ||||| || |||||
Sbjct: 156 gcgttcgcgctcttcctcctgaagcttcagcgaaatgccacggaccggcccgcg 103



to top

>gb|AC121814.3| Mus musculus BAC clone RP23-457H19 from chromosome 15, complete
             sequence
          Length = 188928

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 153   taataaaaacttataaagcatgatag 178
             ||||||||||||| ||||||||||||
Sbjct: 89485 taataaaaacttaaaaagcatgatag 89460



to top

>ref|XM_533364.2| PREDICTED: Canis familiaris similar to PQ loop repeat containing 1
           (predicted) (LOC476157), mRNA
          Length = 1077

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 405 ctcctcctcctgcagcttgagggagatgcc 434
           |||||||||||||| ||||| |||||||||
Sbjct: 865 ctcctcctcctgcaacttgatggagatgcc 836



to top

>gb|AC008155.10| Homo sapiens chromosome 7 clone RP11-289F17, complete sequence
          Length = 176181

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 405    ctcctcctcctgcagcttgagggaga 430
              |||||||||||||||||||| |||||
Sbjct: 106452 ctcctcctcctgcagcttgatggaga 106427



to top

>ref|NM_200845.1| Danio rerio zgc:77702 (zgc:77702), mRNA
          Length = 491

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 405 ctcctcctcctgcagcttgagggagatgcc 434
           ||||||||||||||| |||| |||||||||
Sbjct: 237 ctcctcctcctgcagtttgatggagatgcc 208



to top

>ref|XM_695547.1| PREDICTED: Danio rerio similar to casein kinase 1, gamma 1
           (LOC573918), mRNA
          Length = 1278

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 405 ctcctcctcctgcagcttgagggagatgcc 434
           ||||||||||||||| |||| |||||||||
Sbjct: 838 ctcctcctcctgcagtttgatggagatgcc 809



to top

>ref|XM_499473.1| PREDICTED: Homo sapiens similar to ribosomal protein S17
           (LOC442726), mRNA
          Length = 366

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 405 ctcctcctcctgcagcttgagggaga 430
           |||||||||||||||||||| |||||
Sbjct: 230 ctcctcctcctgcagcttgatggaga 205



to top

>ref|XM_939008.1| PREDICTED: Homo sapiens similar to ribosomal protein S17
           (LOC442726), mRNA
          Length = 366

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 405 ctcctcctcctgcagcttgagggaga 430
           |||||||||||||||||||| |||||
Sbjct: 230 ctcctcctcctgcagcttgatggaga 205



to top

>ref|XM_374655.1| PREDICTED: Homo sapiens similar to ribosomal protein S17
           (LOC442726), mRNA
          Length = 366

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 405 ctcctcctcctgcagcttgagggaga 430
           |||||||||||||||||||| |||||
Sbjct: 230 ctcctcctcctgcagcttgatggaga 205



to top

>emb|AL935050.11| Zebrafish DNA sequence from clone CH211-59B1, complete sequence
          Length = 177773

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 405    ctcctcctcctgcagcttgagggagatgcc 434
              ||||||||||||||| |||| |||||||||
Sbjct: 172075 ctcctcctcctgcagtttgatggagatgcc 172046



to top

>gb|BC062279.1| Danio rerio zgc:77702, mRNA (cDNA clone MGC:77702 IMAGE:6997693),
           complete cds
          Length = 491

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 405 ctcctcctcctgcagcttgagggagatgcc 434
           ||||||||||||||| |||| |||||||||
Sbjct: 237 ctcctcctcctgcagtttgatggagatgcc 208



to top

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                          
Query: 379    gggacgaagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcgg 438
              |||||||| ||||||||||| || ||||| || |||||||  ||||| || ||||| |||
Sbjct: 366739 gggacgaaatccatgcggcgctcacgctcttcttcctgcaatttgagagaaatgcctcgg 366798

                
Query: 439    ac 440
              ||
Sbjct: 366799 ac 366800



to top

>gb|U22230.1|FCU22230 Felis domesticus ribosomal protein S17 mRNA, partial cds
          Length = 447

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 405 ctcctcctcctgcagcttgagggagatgcc 434
           |||||| ||||||||||||| |||||||||
Sbjct: 228 ctcctcttcctgcagcttgatggagatgcc 199



to top

>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 299    cggccatgccgaggaacgccagcat 323
              ||||||||||||||| |||||||||
Sbjct: 920327 cggccatgccgaggaccgccagcat 920351



to top

>ref|XM_812742.1| Trypanosoma cruzi strain CL Brener ribosomal protein S25
           (Tc00.1047053509233.190) partial mRNA
          Length = 333

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 tgtccatcgtctccttgtcga 343
           |||||||||||||||||||||
Sbjct: 163 tgtccatcgtctccttgtcga 143



to top

>ref|XM_814621.1| Trypanosoma cruzi strain CL Brener ribosomal protein S25
           (Tc00.1047053504105.94) partial mRNA
          Length = 333

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 tgtccatcgtctccttgtcga 343
           |||||||||||||||||||||
Sbjct: 163 tgtccatcgtctccttgtcga 143



to top

>gb|AY231772.1| Drosophila yakuba clone yak-em_RpS17 mRNA sequence
          Length = 393

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 403 cgctcctcctcctgcagcttgagggagat 431
           |||||||||||||||| ||||| ||||||
Sbjct: 233 cgctcctcctcctgcaacttgatggagat 205



to top

>emb|AL049693.16|HSDJ753D5 Human DNA sequence from clone RP4-753D5 on chromosome 6p12.1-12.3
             Contains the 3' end of the TFAP2B gene for transcription
             factor AP-2 beta (activating enhancer-binding protein 2
             beta), the gene for a novel protein similar to RPS17 (40S
             ribosomal protein S17), a pseudogene similar to part of
             nuclear transport receptor MTR10A, an FTH1 (ferritin heavy
             polypeptide 1) (FTHL6) pseudogene, complete sequence
          Length = 118280

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 407   cctcctcctgcagcttgagggagat 431
             |||||||||||||||||| ||||||
Sbjct: 25834 cctcctcctgcagcttgatggagat 25858



to top

>emb|AJ271817.1|DME271817 Drosophila melanogaster aay gene (partial), Shc gene, RPS17 gene and
            MTF-1 gene
          Length = 17111

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 403  cgctcctcctcctgcagcttgagggagat 431
            |||||||||||||||| ||||| ||||||
Sbjct: 4853 cgctcctcctcctgcaacttgatggagat 4881



to top

>gb|AC010028.8| Drosophila melanogaster 3L BAC RP98-1E20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 187489

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 403    cgctcctcctcctgcagcttgagggagat 431
              |||||||||||||||| ||||| ||||||
Sbjct: 128161 cgctcctcctcctgcaacttgatggagat 128189



to top

>ref|NM_079278.2| Drosophila melanogaster Ribosomal protein S17 CG3922-RB (RpS17),
           mRNA
          Length = 637

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 403 cgctcctcctcctgcagcttgagggagat 431
           |||||||||||||||| ||||| ||||||
Sbjct: 289 cgctcctcctcctgcaacttgatggagat 261



to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete
              genome
          Length = 3570858

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 526    ttcttgagcaccttcttgttg 546
              |||||||||||||||||||||
Sbjct: 486552 ttcttgagcaccttcttgttg 486572



to top

>ref|NG_005089.1| Homo sapiens ribosomal protein S17 pseudogene (LOC442216) on
           chromosome 6
          Length = 702

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 407 cctcctcctgcagcttgagggagat 431
           |||||||||||||||||| ||||||
Sbjct: 349 cctcctcctgcagcttgatggagat 373



to top

>gb|AE005112.1| Halobacterium sp. NRC-1 section 143 of 170 of the complete genome
          Length = 12204

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 339   gtcgacgcggatctcgtcgac 359
             |||||||||||||||||||||
Sbjct: 10965 gtcgacgcggatctcgtcgac 10985



to top

>gb|AE003552.4| Drosophila melanogaster chromosome 3L, section 33 of 83 of the complete
              sequence
          Length = 286770

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 403    cgctcctcctcctgcagcttgagggagat 431
              |||||||||||||||| ||||| ||||||
Sbjct: 238758 cgctcctcctcctgcaacttgatggagat 238786



to top

>gb|BT001651.1| Drosophila melanogaster RE44119 full insert cDNA
          Length = 543

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 403 cgctcctcctcctgcagcttgagggagat 431
           |||||||||||||||| ||||| ||||||
Sbjct: 286 cgctcctcctcctgcaacttgatggagat 258



to top

>gb|M22142.1|DRORPS17 D.melanogaster ribosomal protein S17 gene, complete cds
          Length = 1700

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 403  cgctcctcctcctgcagcttgagggagat 431
            |||||||||||||||| ||||| ||||||
Sbjct: 1295 cgctcctcctcctgcaacttgatggagat 1267



to top

>gb|AY850937.1| Pectinaria gouldii ribosomal protein S17 mRNA, complete cds
          Length = 578

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 405 ctcctcctcctgcagcttga 424
           ||||||||||||||||||||
Sbjct: 258 ctcctcctcctgcagcttga 239



to top

>ref|NM_111897.2| Arabidopsis thaliana structural constituent of ribosome AT3G10610
           mRNA, complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           |||||||| || | ||| ||||| ||||| || |||||||||||||| || |||||
Sbjct: 331 aagtccattcgcctttcacgctcttcctcttgtagcttgagggagattccacggac 276



to top

>ref|XM_526885.1| PREDICTED: Pan troglodytes similar to zinc finger, BED domain
           containing 3; hypothetical protein MGC15435;
           2610005H11Rik (LOC471507), mRNA
          Length = 474

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 cgcgctcctcctcctgcagc 420
           ||||||||||||||||||||
Sbjct: 298 cgcgctcctcctcctgcagc 279



to top

>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 309    gaggaacgccagcatgtccatcgtctcc 336
              |||||| |||||| ||||||||||||||
Sbjct: 743103 gaggaaggccagcgtgtccatcgtctcc 743076



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    gggccgcgctggatgcggcg 461
              ||||||||||||||||||||
Sbjct: 665602 gggccgcgctggatgcggcg 665583



to top

>gb|AF159690.1| Myxococcus xanthus serine/threonine kinase PKN7 (pkn7) and
            serine/threonine kinase PKN11 (pkn11) genes, complete
            cds; and unknown gene
          Length = 6145

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 443  ggccgcgctggatgcggcgc 462
            ||||||||||||||||||||
Sbjct: 4324 ggccgcgctggatgcggcgc 4343



to top

>ref|XM_867513.1| PREDICTED: Bos taurus similar to zinc finger, BED domain containing
           3 (LOC615651), mRNA
          Length = 645

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 cgcgctcctcctcctgcagc 420
           ||||||||||||||||||||
Sbjct: 460 cgcgctcctcctcctgcagc 441



to top

>ref|XM_954834.1| Neurospora crassa OR74A hypothetical protein ( (AF034963)
           calmodulin-dependent protein kinase; CgCMK [Glomerella
           cingulata]  ) (NCU02283.1) partial mRNA
          Length = 1359

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 517 atggacaccttcttgagcac 536
           ||||||||||||||||||||
Sbjct: 212 atggacaccttcttgagcac 193



to top

>ref|XM_331058.1| Neurospora crassa OR74A hypothetical protein ( (AF034963)
           calmodulin-dependent protein kinase; CgCMK [Glomerella
           cingulata]  ) (NCU02283.1) partial mRNA
          Length = 1359

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 517 atggacaccttcttgagcac 536
           ||||||||||||||||||||
Sbjct: 212 atggacaccttcttgagcac 193



to top

>gb|AY395570.1| Chlamys farreri ribosomal protein S17 mRNA, partial cds
          Length = 474

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 405 ctcctcctcctgcagcttgagggagatgccgcggac 440
           |||||||||||| || |||| ||||||||| |||||
Sbjct: 204 ctcctcctcctggagtttgatggagatgcctcggac 169



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 444     gccgcgctggatgcggcgca 463
               ||||||||||||||||||||
Sbjct: 4999722 gccgcgctggatgcggcgca 4999703



to top

>gb|AC013428.6|ATAC013428 Arabidopsis thaliana chromosome III BAC F18K10 genomic sequence,
             complete sequence
          Length = 93985

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 385   aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
             |||||||| || | ||| ||||| ||||| || |||||||||||||| || |||||
Sbjct: 76869 aagtccattcgcctttcacgctcttcctcttgtagcttgagggagattccacggac 76814



to top

>ref|XM_505678.1| Yarrowia lipolytica CLIB122, YALI0F20768g predicted mRNA
          Length = 468

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 527 tcttgagcaccttcttgttg 546
           ||||||||||||||||||||
Sbjct: 130 tcttgagcaccttcttgttg 111



to top

>gb|DQ352890.1| Aenictus sp. 2 CSM-2006 abdominal-A (AbdA) gene, partial cds
          Length = 642

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 442 gggccgcgctggatgcggcg 461
           ||||||||||||||||||||
Sbjct: 382 gggccgcgctggatgcggcg 363



to top

>gb|AY091313.1| Arabidopsis thaliana putative 40S ribosomal protein S17 (At3g10610)
           mRNA, complete cds
          Length = 454

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           |||||||| || | ||| ||||| ||||| || |||||||||||||| || |||||
Sbjct: 251 aagtccattcgcctttcacgctcttcctcttgtagcttgagggagattccacggac 196



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 256     gcggacgcggtgacctcgggagcg 279
               |||||||||||||||| |||||||
Sbjct: 2766580 gcggacgcggtgacctggggagcg 2766603



to top

>gb|AY063881.1| Arabidopsis thaliana putative 40S ribosomal protein S17 (At3g10610)
           mRNA, complete cds
          Length = 655

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           |||||||| || | ||| ||||| ||||| || |||||||||||||| || |||||
Sbjct: 331 aagtccattcgcctttcacgctcttcctcttgtagcttgagggagattccacggac 276



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 444     gccgcgctggatgcggcgca 463
               ||||||||||||||||||||
Sbjct: 1090591 gccgcgctggatgcggcgca 1090610



to top

>emb|AL731621.3|OSJN00268 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0013O03,
             complete sequence
          Length = 118791

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 403   cgctcctcctcctgcagctt 422
             ||||||||||||||||||||
Sbjct: 88382 cgctcctcctcctgcagctt 88401



to top

>gb|AC016924.19| Homo sapiens 3 BAC RP11-205A6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 51001

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 238   ggctggcggaagggggcggc 257
             ||||||||||||||||||||
Sbjct: 16547 ggctggcggaagggggcggc 16528



to top

>gb|AF214654.1| Arthrobotrys dactyloides calmodulin-binding protein kinase mRNA,
           complete cds
          Length = 1820

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 517 atggacaccttcttgagcac 536
           ||||||||||||||||||||
Sbjct: 565 atggacaccttcttgagcac 546



to top

>gb|AY072718.1| Oryctolagus cuniculus phospholipid transfer protein (PLTP) mRNA,
           complete cds
          Length = 1782

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 gcgctcctcctcctgcagct 421
           ||||||||||||||||||||
Sbjct: 830 gcgctcctcctcctgcagct 811



to top

>gb|AF382033.1|AF382033 Oryctolagus cuniculus phospholipid transfer protein (PLTP) mRNA,
           complete cds
          Length = 1743

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 gcgctcctcctcctgcagct 421
           ||||||||||||||||||||
Sbjct: 786 gcgctcctcctcctgcagct 767



to top

>emb|AL115656.1|CNS01CKW Botrytis cinerea strain T4 cDNA library
          Length = 576

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 462 catcanatgggtggtgaagccggccaccttgttgcggag 500
           ||||| |||||||||| | ||||| | ||||||||||||
Sbjct: 216 catcaaatgggtggtgtaaccggcaatcttgttgcggag 178



to top

>emb|AL115003.1|CNS01C2R Botrytis cinerea strain T4 cDNA library
          Length = 605

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 462 catcanatgggtggtgaagccggccaccttgttgcggag 500
           ||||| |||||||||| | ||||| | ||||||||||||
Sbjct: 216 catcaaatgggtggtgtaaccggcaatcttgttgcggag 178



to top

>emb|AL114900.1|CNS01BZW Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 462 catcanatgggtggtgaagccggccaccttgttgcggag 500
           ||||| |||||||||| | ||||| | ||||||||||||
Sbjct: 210 catcaaatgggtggtgtaaccggcaatcttgttgcggag 172



to top

>emb|AL113499.1|CNS01AWZ Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 462 catcanatgggtggtgaagccggccaccttgttgcggag 500
           ||||| |||||||||| | ||||| | ||||||||||||
Sbjct: 216 catcaaatgggtggtgtaaccggcaatcttgttgcggag 178



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 403      cgctcctcctcctgcagctt 422
                ||||||||||||||||||||
Sbjct: 13452026 cgctcctcctcctgcagctt 13452045



to top

>gb|AC011560.6|AC011560 Arabidopsis thaliana chromosome 3 BAC F13M14 genomic sequence, complete
             sequence
          Length = 118107

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 385   aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
             |||||||| || | ||| ||||| ||||| || |||||||||||||| || |||||
Sbjct: 27648 aagtccattcgcctttcacgctcttcctcttgtagcttgagggagattccacggac 27703



to top

>gb|AY088250.1| Arabidopsis thaliana clone 4775 mRNA, complete sequence
          Length = 740

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 385 aagtccatgcggcgttcgcgctcctcctcctgcagcttgagggagatgccgcggac 440
           |||||||| || | ||| ||||| ||||| || |||||||||||||| || |||||
Sbjct: 345 aagtccattcgcctttcacgctcttcctcttgtagcttgagggagattccacggac 290



to top

>gb|AY881984.1| Verticillium dahliae ribosomal protein S17 (crp3) gene, partial cds
          Length = 365

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 accttgttgcggaggcgctt 506
           ||||||||||||||||||||
Sbjct: 110 accttgttgcggaggcgctt 91



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 440     cggggccgcgctggatgcgg 459
               ||||||||||||||||||||
Sbjct: 5664080 cggggccgcgctggatgcgg 5664099



to top

>dbj|AK110039.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-160-B07, full
            insert sequence
          Length = 3388

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 396  gcgttcgcgctcctcctcct 415
            ||||||||||||||||||||
Sbjct: 1835 gcgttcgcgctcctcctcct 1816



to top

>emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chromosome 2, complete
             sequence
          Length = 129438

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 530   tgagcaccttcttgttggtg 549
             ||||||||||||||||||||
Sbjct: 42411 tgagcaccttcttgttggtg 42430


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,016,215
Number of Sequences: 3902068
Number of extensions: 4016215
Number of successful extensions: 88360
Number of sequences better than 10.0: 184
Number of HSP's better than 10.0 without gapping: 184
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87530
Number of HSP's gapped (non-prelim): 824
length of query: 549
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 526
effective length of database: 17,143,297,704
effective search space: 9017374592304
effective search space used: 9017374592304
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top