>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                            
Query: 111      ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 170
                |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 22167421 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 22167480

                                                                            
Query: 171      tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 230
                 |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 22167481 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 22167540

                                    
Query: 231      agctttgtatgagctgatca 250
                |  | |||||||||||||||
Sbjct: 22167541 aattctgtatgagctgatca 22167560

>dbj|AK067865.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013124K14, full
            insert sequence
          Length = 2169

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                        
Query: 111  ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 170
            |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 1833 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 1774

                                                                        
Query: 171  tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 230
             |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 1773 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 1714

                                
Query: 231  agctttgtatgagctgatca 250
            |  | |||||||||||||||
Sbjct: 1713 aattctgtatgagctgatca 1694

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                            
Query: 111      ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 170
                |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 22095766 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 22095825

                                                                            
Query: 171      tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 230
                 |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 22095826 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 22095885

                                    
Query: 231      agctttgtatgagctgatca 250
                |  | |||||||||||||||
Sbjct: 22095886 aattctgtatgagctgatca 22095905

>emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123_B09 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 155585

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                         
Query: 111   ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 170
             |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 85589 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 85530

                                                                         
Query: 171   tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 230
              |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 85529 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 85470

                                 
Query: 231   agctttgtatgagctgatca 250
             |  | |||||||||||||||
Sbjct: 85469 aattctgtatgagctgatca 85450

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 181     tggcgacaaaggtgtcgctgcc 202
               ||||||||||||||||||||||
Sbjct: 1642451 tggcgacaaaggtgtcgctgcc 1642472

>gb|AC026774.7| Homo sapiens chromosome 5 clone CTC-235G5, complete sequence
          Length = 108451

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 221   tgagaaatgaagctttgtatg 241
             |||||||||||||||||||||
Sbjct: 89575 tgagaaatgaagctttgtatg 89595

>gb|AC120113.2| Homo sapiens chromosome 5 clone CTD-2324F19, complete sequence
          Length = 129346

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 221    tgagaaatgaagctttgtatg 241
              |||||||||||||||||||||
Sbjct: 127250 tgagaaatgaagctttgtatg 127230

>gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence
          Length = 339089

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 217   aagctgagaaatgaagctttg 237
             |||||||||||||||||||||
Sbjct: 39822 aagctgagaaatgaagctttg 39802

>gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, complete sequence
          Length = 173710

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 207    cactgctaaaaagctgagaaatgaa 231
              |||| ||||||||||||||||||||
Sbjct: 136065 cacttctaaaaagctgagaaatgaa 136041

>gb|AC134463.3| Mus musculus BAC clone RP23-425N12 from 5, complete sequence
          Length = 200629

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 207   cactgctaaaaagctgagaaatgaa 231
             |||| ||||||||||||||||||||
Sbjct: 89236 cacttctaaaaagctgagaaatgaa 89212

>ref|XM_656095.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3583.2), mRNA
          Length = 2460

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  ggcgacaaaggtgtcgctgc 201
            ||||||||||||||||||||
Sbjct: 1522 ggcgacaaaggtgtcgctgc 1541

>gb|AC125057.5| Mus musculus BAC clone RP23-399K1 from chromosome 12, complete sequence
          Length = 182276

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    cacactattcagcagggtcatgtt 67
             |||| |||||||||||||||||||
Sbjct: 18743 cacaatattcagcagggtcatgtt 18766

>gb|AC123869.4| Mus musculus BAC clone RP23-245M16 from 12, complete sequence
          Length = 167795

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    cacactattcagcagggtcatgtt 67
             |||| |||||||||||||||||||
Sbjct: 20937 cacaatattcagcagggtcatgtt 20914

>emb|AL591502.10| Human DNA sequence from clone RP11-199C17 on chromosome 9 Contains the
             5' end of the TBC1D2 gene for TBC1 domain family, member 2
             (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823), the 3' end
             of the GPR51 gene for G protein-coupled receptor 51 (HG20,
             GABBR2, GPRC3B, GABABR2) and a CpG island, complete
             sequence
          Length = 156753

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    gtaccagccttgcccttccc 91
             ||||||||||||||||||||
Sbjct: 13872 gtaccagccttgcccttccc 13891

>gb|AF291662.1| Aspergillus nidulans Kex2-like dibasic endoprotease ANPC gene,
            complete cds
          Length = 4688

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  ggcgacaaaggtgtcgctgc 201
            ||||||||||||||||||||
Sbjct: 2268 ggcgacaaaggtgtcgctgc 2287

>gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome
          Length = 1471282

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 230    aagctttgtatgagctgatc 249
              ||||||||||||||||||||
Sbjct: 306895 aagctttgtatgagctgatc 306876

>gb|AC102443.11| Mus musculus chromosome 3, clone RP24-191D1, complete sequence
          Length = 147088

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 215   aaaagctgagaaatgaagct 234
             ||||||||||||||||||||
Sbjct: 62951 aaaagctgagaaatgaagct 62970

>dbj|AB056726.1| Emericella nidulans kexB mRNA for kexin like processing protease,
            complete cds
          Length = 2785

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  ggcgacaaaggtgtcgctgc 201
            ||||||||||||||||||||
Sbjct: 1622 ggcgacaaaggtgtcgctgc 1641

>emb|BX323557.8| Zebrafish DNA sequence from clone DKEYP-86B9 in linkage group 5,
             complete sequence
          Length = 223754

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    tgtcacaattgttatccaca 47
             ||||||||||||||||||||
Sbjct: 35337 tgtcacaattgttatccaca 35318

>emb|BX072549.4| Zebrafish DNA sequence from clone CH211-114A17 in linkage group 5,
             complete sequence
          Length = 167182

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    tgtcacaattgttatccaca 47
             ||||||||||||||||||||
Sbjct: 71794 tgtcacaattgttatccaca 71775

>gb|AC147597.2| Gallus gallus BAC clone CH261-100D18 from chromosome unknown, complete
              sequence
          Length = 168372

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 223    agaaatgaagctttgtatgagctgatca 250
              |||||||||||||| ||||| |||||||
Sbjct: 161343 agaaatgaagctttatatgaactgatca 161316


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,048,642
Number of Sequences: 3902068
Number of extensions: 2048642
Number of successful extensions: 37132
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37075
Number of HSP's gapped (non-prelim): 57
length of query: 264
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 242
effective length of database: 17,147,199,772
effective search space: 4149622344824
effective search space used: 4149622344824
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)