ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags27n23 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) mRNA, complete cds Length = 869 Score = 676 bits (341), Expect = 0.0 Identities = 365/373 (97%) Strand = Plus / Minus Query: 186 ggcggacggacctagagctggccgcagtcggcgatgacgacctgcttggagcagatgccg 245 ||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 597 ggcgggcggatctagagctggccgcagtcggcgatgacgacctgcttggagcaggtgccg 538 Query: 246 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 537 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 478 Query: 306 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 477 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 418 Query: 366 ccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtgg 425 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 417 ccgttggtgttgggcccggcgttggccatggagaggatcccgggcttggtgtgcttgtgg 358 Query: 426 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 485 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 357 acgaacttctcgtcggcgaacttctcgccgtagatggactcgcctccggtgccgttgccc 298 Query: 486 ctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgccc 545 |||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||| Sbjct: 297 ctggtgaagtcgccgccctggcacatgaagtcggggatcacgcggtggaaggcgctgccc 238 Query: 546 ttgtagtgcagcg 558 ||||||||||||| Sbjct: 237 ttgtagtgcagcg 225 Score = 167 bits (84), Expect = 5e-38 Identities = 105/112 (93%) Strand = Plus / Minus Query: 1 gaagataaccatggcggccggacgcagatccagcagcctaaagagtccacctaaaaccct 60 ||||||||||| ||| |||||||||||||||||| ||| ||||||||||||||||||||| Sbjct: 779 gaagataaccaaggccgccggacgcagatccagcggcccaaagagtccacctaaaaccct 720 Query: 61 cctaaaccaaccacggagatctcatcggacggacaggggcaagacacgacac 112 |||||||||||||||||||||||||||||||||| ||| |||||||||||| Sbjct: 719 cctaaaccaaccacggagatctcatcggacggaccaggggaagacacgacac 668
>gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) mRNA, complete cds Length = 845 Score = 672 bits (339), Expect = 0.0 Identities = 363/371 (97%) Strand = Plus / Minus Query: 186 ggcggacggacctagagctggccgcagtcggcgatgacgacctgcttggagcagatgccg 245 |||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||| Sbjct: 597 ggcggacggatctagagctggccgcagtcggcgatgacgacttgcttggagcaggtgccg 538 Query: 246 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 537 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 478 Query: 306 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 477 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 418 Query: 366 ccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtgg 425 |||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||| Sbjct: 417 ccgttggtgttggggcccgcgttggccatggagaggatcccgggcttggtgtgcttgtgg 358 Query: 426 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 485 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 357 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 298 Query: 486 ctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgccc 545 ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 297 ttggtgaagtcgccgccctggcacatgaagtcggggatcacgcggtggaacgagctgccc 238 Query: 546 ttgtagtgcag 556 ||||||||||| Sbjct: 237 ttgtagtgcag 227 Score = 180 bits (91), Expect = 3e-42 Identities = 109/115 (94%) Strand = Plus / Minus Query: 1 gaagataaccatggcggccggacgcagatccagcagcctaaagagtccacctaaaaccct 60 ||||||||||||||| ||||||| |||||||||| ||| ||||||||||||||||||||| Sbjct: 775 gaagataaccatggccgccggacacagatccagcggccaaaagagtccacctaaaaccct 716 Query: 61 cctaaaccaaccacggagatctcatcggacggacaggggcaagacacgacacgac 115 ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 715 cctaaaccaaccacggagatctcatcggacggacaaggggaagacacgacacgac 661
>gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, complete cds Length = 781 Score = 672 bits (339), Expect = 0.0 Identities = 363/371 (97%) Strand = Plus / Minus Query: 186 ggcggacggacctagagctggccgcagtcggcgatgacgacctgcttggagcagatgccg 245 |||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||| Sbjct: 561 ggcggacggatctagagctggccgcagtcggcgatgacgacttgcttggagcaggtgccg 502 Query: 246 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 501 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 442 Query: 306 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 441 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 382 Query: 366 ccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtgg 425 |||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||| Sbjct: 381 ccgttggtgttggggcccgcgttggccatggagaggatcccgggcttggtgtgcttgtgg 322 Query: 426 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 485 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 321 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 262 Query: 486 ctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgccc 545 ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 261 ttggtgaagtcgccgccctggcacatgaagtcggggatcacgcggtggaacgagctgccc 202 Query: 546 ttgtagtgcag 556 ||||||||||| Sbjct: 201 ttgtagtgcag 191 Score = 180 bits (91), Expect = 3e-42 Identities = 109/115 (94%) Strand = Plus / Minus Query: 1 gaagataaccatggcggccggacgcagatccagcagcctaaagagtccacctaaaaccct 60 ||||||||||||||| ||||||| |||||||||| ||| ||||||||||||||||||||| Sbjct: 739 gaagataaccatggccgccggacacagatccagcggccaaaagagtccacctaaaaccct 680 Query: 61 cctaaaccaaccacggagatctcatcggacggacaggggcaagacacgacacgac 115 ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 679 cctaaaccaaccacggagatctcatcggacggacaaggggaagacacgacacgac 625
>gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) mRNA, complete cds Length = 859 Score = 658 bits (332), Expect = 0.0 Identities = 362/372 (97%) Strand = Plus / Minus Query: 187 gcggacggacctagagctggccgcagtcggcgatgacgacctgcttggagcagatgccgc 246 |||| |||| ||||||||||||||||||||||||||| ||||||||||||||| |||||| Sbjct: 588 gcgggcggatctagagctggccgcagtcggcgatgaccacctgcttggagcaggtgccgc 529 Query: 247 tgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccga 306 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 528 tgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccga 469 Query: 307 agaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagc 366 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 468 agaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagc 409 Query: 367 cgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtgga 426 |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 408 cgttggtgttgggccccgcgttggccatggagaggatcccgggcttggtgtgcttgtgga 349 Query: 427 cgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccc 486 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 348 cgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccc 289 Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgccct 546 |||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||| Sbjct: 288 gggtgaagtcgccgccctggcacatgaagtcggggatcacgcggtggaaggcgctgccct 229 Query: 547 tgtagtgcagcg 558 |||||||||||| Sbjct: 228 tgtagtgcagcg 217 Score = 172 bits (87), Expect = 8e-40 Identities = 108/115 (93%) Strand = Plus / Minus Query: 1 gaagataaccatggcggccggacgcagatccagcagcctaaagagtccacctaaaaccct 60 ||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| Sbjct: 783 gaagataaccaaggcggccggacagagatccagcagcccaaagagtccacctaaaaccct 724 Query: 61 cctaaaccaaccacggagatctcatcggacggacaggggcaagacacgacacgac 115 |||||||||||||||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 723 cctaaaccaaccacggagatctcatcggacggaccaggggaagacacgacacgac 669
>gb|AF384147.1|AF384147 Triticum aestivum cyclophilin mRNA, partial cds Length = 430 Score = 636 bits (321), Expect = e-179 Identities = 360/373 (96%) Strand = Plus / Minus Query: 186 ggcggacggacctagagctggccgcagtcggcgatgacgacctgcttggagcagatgccg 245 |||| ||||| |||||||||||||||||||||||||||||||||||||| | | ||||| Sbjct: 407 ggcgaacggatctagagctggccgcagtcggcgatgacgacctgcttggcggtggtgccg 348 Query: 246 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 347 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 288 Query: 306 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 365 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 287 aagacgacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 228 Query: 366 ccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtgg 425 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 227 ccgttggtgttgggcccggcgttggccatggagaggatcccgggcttggtgtgcttgtgg 168 Query: 426 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 485 ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| Sbjct: 167 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcccgtcccgttgccc 108 Query: 486 ctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgccc 545 |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||| Sbjct: 107 ctggtgaagtcgccgccctggcacatgaagtcggggatcacgcggtggaacgcgctcccc 48 Query: 546 ttgtagtgcagcg 558 ||||||||||||| Sbjct: 47 ttgtagtgcagcg 35
>gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, partial cds Length = 494 Score = 591 bits (298), Expect = e-165 Identities = 313/318 (98%) Strand = Plus / Minus Query: 186 ggcggacggacctagagctggccgcagtcggcgatgacgacctgcttggagcagatgccg 245 ||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 318 ggcgggcggatctagagctggccgcagtcggcgatgacgacctgcttggagcaggtgccg 259 Query: 246 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 258 ctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccg 199 Query: 306 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 198 aagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggag 139 Query: 366 ccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtgg 425 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 138 ccgttggtgttgggcccggcgttggccatggagaggatcccgggcttggtgtgcttgtgg 79 Query: 426 acgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 485 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 78 acgaacttctcgtcggcgaacttctcgccgtagatggactcgcctccggtgccgttgccc 19 Query: 486 ctggtgaagtcgccgccc 503 |||||||||||||||||| Sbjct: 18 ctggtgaagtcgccgccc 1 Score = 155 bits (78), Expect = 2e-34 Identities = 99/106 (93%) Strand = Plus / Minus Query: 7 aaccatggcggccggacgcagatccagcagcctaaagagtccacctaaaaccctcctaaa 66 ||||| ||| |||||||||||||||||| ||| ||||||||||||||||||||||||||| Sbjct: 494 aaccaaggccgccggacgcagatccagcggcccaaagagtccacctaaaaccctcctaaa 435 Query: 67 ccaaccacggagatctcatcggacggacaggggcaagacacgacac 112 |||||||||||||||||||||||||||| ||| |||||||||||| Sbjct: 434 ccaaccacggagatctcatcggacggaccaggggaagacacgacac 389
>gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, partial cds Length = 519 Score = 575 bits (290), Expect = e-161 Identities = 311/318 (97%) Strand = Plus / Minus Query: 187 gcggacggacctagagctggccgcagtcggcgatgacgacctgcttggagcagatgccgc 246 |||| |||| ||||||||||||||||||||||||||| ||||||||||||||| |||||| Sbjct: 318 gcgggcggatctagagctggccgcagtcggcgatgaccacctgcttggagcaggtgccgc 259 Query: 247 tgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccga 306 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 258 tgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccga 199 Query: 307 agaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagc 366 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 198 agaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagc 139 Query: 367 cgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtgga 426 |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 138 cgttggtgttgggccccgcgttggccatggagaggatcccgggcttggtgtgcttgtgga 79 Query: 427 cgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccc 486 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 78 cgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccc 19 Query: 487 tggtgaagtcgccgccct 504 ||||||||||||||||| Sbjct: 18 gggtgaagtcgccgccct 1 Score = 172 bits (87), Expect = 8e-40 Identities = 108/115 (93%) Strand = Plus / Minus Query: 1 gaagataaccatggcggccggacgcagatccagcagcctaaagagtccacctaaaaccct 60 ||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| Sbjct: 513 gaagataaccaaggcggccggacagagatccagcagcccaaagagtccacctaaaaccct 454 Query: 61 cctaaaccaaccacggagatctcatcggacggacaggggcaagacacgacacgac 115 |||||||||||||||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 453 cctaaaccaaccacggagatctcatcggacggaccaggggaagacacgacacgac 399
>gb|BT016412.1| Zea mays clone Contig245 mRNA sequence Length = 858 Score = 391 bits (197), Expect = e-105 Identities = 287/317 (90%) Strand = Plus / Minus Query: 242 gccgctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctc 301 |||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 534 gccgttgcgggtgcccaccttctcgatggccttgacgacgtccatgccctcgacgacctg 475 Query: 302 gccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactg 361 ||||||||| ||||||||||||||||||||| | | ||||||||||||||||||||| Sbjct: 474 gccgaagacgacgtgcttgccgtcgagccaaggggtcgcgacggtgcagatgaagaactg 415 Query: 362 ggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgctt 421 ||||||||||||||||||||||||||||||||||||||| | || || ||||||||| Sbjct: 414 ggagccgttggtgttgggcccggcgttggccatggagagcacaccgggggcggtgtgctt 355 Query: 422 gtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgtt 481 | | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 354 gcgcacgaacttctcgtcggggaacttctcgccgtagatggactcgccgccggtgccgtt 295 Query: 482 gcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagct 541 ||| | ||||||||||||||||||||||||||| |||||||||||||||||||| | | Sbjct: 294 gccgcgggtgaagtcgccgccctggcacatgaactcggggatgacgcggtggaaggtgga 235 Query: 542 gcccttgtagtgcagcg 558 |||||||||||| |||| Sbjct: 234 gcccttgtagtggagcg 218
>emb|X68678.1|ZMCYCL Z.mays gene for cyclophilin Length = 2598 Score = 375 bits (189), Expect = e-100 Identities = 285/317 (89%) Strand = Plus / Minus Query: 242 gccgctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctc 301 |||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1532 gccgttgcgggtgcccaccttctcgatggccttgacgacgtccatgccctcgacgacctg 1473 Query: 302 gccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactg 361 ||||||||| ||||||||||||||||||||| | | ||||||||||||||||||||| Sbjct: 1472 gccgaagacgacgtgcttgccgtcgagccaaggggtcgcgacggtgcagatgaagaactg 1413 Query: 362 ggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgctt 421 ||||||||||||||||||||||||||||||||||||||| | || || || ||||| Sbjct: 1412 ggagccgttggtgttgggcccggcgttggccatggagagcacaccgggggcgggttgctt 1353 Query: 422 gtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgtt 481 | | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 1352 gcgcacgaacttctcgtcggggaacttctcgccgtagatggactcgccgccggtgccgtt 1293 Query: 482 gcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagct 541 ||| | ||||||||||||||||||||||||||| |||||||||||||||||||| | | Sbjct: 1292 gccgcgggtgaagtcgccgccctggcacatgaactcggggatgacgcggtggaaggtgga 1233 Query: 542 gcccttgtagtgcagcg 558 |||||||||||| |||| Sbjct: 1232 gcccttgtagtggagcg 1216
>gb|M55021.1|MZECYP Zea mays cyclophilin (CyP) mRNA, complete cds Length = 792 Score = 375 bits (189), Expect = e-100 Identities = 285/317 (89%) Strand = Plus / Minus Query: 242 gccgctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctc 301 |||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 495 gccgttgcgggtgcccaccttctcgatggccttgacgacgtccatgccctcgacgacctg 436 Query: 302 gccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactg 361 ||||||||| ||||||||||||||||||||| | | ||||||||||||||||||||| Sbjct: 435 gccgaagacgacgtgcttgccgtcgagccaaggggtcgcgacggtgcagatgaagaactg 376 Query: 362 ggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtgtgctt 421 ||||||||||||||||||||||||||||||||||||||| | || || || ||||| Sbjct: 375 ggagccgttggtgttgggcccggcgttggccatggagagcacaccgggggcgggttgctt 316 Query: 422 gtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgtt 481 | | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 315 gcgcacgaacttctcgtcggggaacttctcgccgtagatggactcgccgccggtgccgtt 256 Query: 482 gcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagct 541 ||| | ||||||||||||||||||||||||||| |||||||||||||||||||| | | Sbjct: 255 gccgcgggtgaagtcgccgccctggcacatgaactcggggatgacgcggtggaaggtgga 196 Query: 542 gcccttgtagtgcagcg 558 |||||||||||| |||| Sbjct: 195 gcccttgtagtggagcg 179
>ref|XM_463914.1| Oryza sativa (japonica cultivar-group), mRNA Length = 885 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 607 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 548 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 547 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 488 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 487 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 428 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 427 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 368 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 367 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 308 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 307 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 248
>ref|XM_506694.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBb0088N06.23 mRNA Length = 887 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 608 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 549 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 548 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 489 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 488 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 429 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 428 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 369 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 368 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 309 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 308 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 249
>gb|DQ480736.1| Oryza sativa (indica cultivar-group) cyclophilinA mRNA, complete cds Length = 588 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 524 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 465 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 464 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 405 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 404 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 345 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 344 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 285 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 284 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 225 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 224 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 165
>dbj|AK061894.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-G07, full insert sequence Length = 887 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 608 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 549 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 548 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 489 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 488 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 429 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 428 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 369 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 368 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 309 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 308 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 249
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 1116673 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 1116614 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 1116613 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 1116554 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 1116553 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 1116494 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 1116493 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 1116434 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 1116433 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 1116374 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 1116373 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 1116314
>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1020_C02 Length = 124578 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 69197 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 69138 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 69137 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 69078 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 69077 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 69018 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 69017 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 68958 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 68957 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 68898 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 68897 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 68838
>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0088N06 Length = 123454 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 105381 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 105322 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 105321 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 105262 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 105261 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 105202 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 105201 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 105142 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 105141 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 105082 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 105081 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 105022
>dbj|AK098919.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N03, full insert sequence Length = 885 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 607 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 548 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 547 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 488 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 487 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 428 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 427 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 368 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 367 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 308 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 307 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 248
>gb|L29469.1|RICCYP2G Oryza sativa cyclophilin 2 (Cyp2) gene, complete cds Length = 2323 Score = 325 bits (164), Expect = 9e-86 Identities = 311/360 (86%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 1663 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 1604 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 1603 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 1544 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 1543 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 1484 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| |||||||| ||||| || || || ||||||| |||| ||||| Sbjct: 1483 gcccggcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 1424 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 1423 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 1364 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 1363 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 1304
>gb|L29470.1|RICCYP2R Oryza sativa cyclophilin 2 (Cyp2) mRNA, complete cds Length = 824 Score = 301 bits (152), Expect = 1e-78 Identities = 308/360 (85%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||| || |||||| | | | |||| |||||| |||| Sbjct: 552 agagctggccgcagtcggcgatgaccacgggcttggcggtgctcccgccgcgggatccca 493 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgct 318 ||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||| Sbjct: 492 ccttctcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgct 433 Query: 319 tgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgg 378 | ||||| ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||| Sbjct: 432 tcccgtccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgg 373 Query: 379 gcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgt 438 |||||||||| ||| |||| ||||| || || || ||||||| |||| ||||| Sbjct: 372 gcccggcgttcgccgtggacaggatgccggggctgtcgtgcttgaacttgaacacctcgt 313 Query: 439 cggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgc 498 |||||||||||||||||||||| ||||| || || ||||||||||| | ||||||||||| Sbjct: 312 cggcgaacttctcgccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgc 253 Query: 499 cgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 |||||||||||||||| || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 252 cgccctggcacatgaactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 193
>gb|BT016413.1| Zea mays clone Contig246 mRNA sequence Length = 868 Score = 266 bits (134), Expect = 7e-68 Identities = 179/194 (92%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 ||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||| Sbjct: 419 acggtgcagatgaagaattgagagccgttggtgttggggccggcgttggccatggagagc 360 Query: 402 atccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatg 461 | ||| || |||||||||| |||||||||||||||||| ||||||||||||||||||| Sbjct: 359 accccggggccggtgtgcttgcggacgaacttctcgtcggggaacttctcgccgtagatg 300 Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| | |||| Sbjct: 299 gactcgccgccggtgccgttgccgcgggtgaagtcgccgccctggcacatgaactggggg 240 Query: 522 atgacgcggtggaa 535 |||||||||||||| Sbjct: 239 atgacgcggtggaa 226 Score = 123 bits (62), Expect = 7e-25 Identities = 83/90 (92%) Strand = Plus / Minus Query: 242 gccgctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctc 301 |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| Sbjct: 519 gccgctgcgggagcccaccttctcgatggccttgacgacctccatgccctcgacgacctg 460 Query: 302 gccgaagaccacgtgcttgccgtcgagcca 331 ||||||||| ||||||||||| || ||||| Sbjct: 459 gccgaagacgacgtgcttgccatccagcca 430
>gb|BT017873.1| Zea mays clone EL01N0513A10.c mRNA sequence Length = 978 Score = 266 bits (134), Expect = 7e-68 Identities = 179/194 (92%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 ||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||| Sbjct: 535 acggtgcagatgaagaattgagagccgttggtgttggggccggcgttggccatggagagc 476 Query: 402 atccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatg 461 | ||| || |||||||||| |||||||||||||||||| ||||||||||||||||||| Sbjct: 475 accccggggccggtgtgcttgcggacgaacttctcgtcggggaacttctcgccgtagatg 416 Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| | |||| Sbjct: 415 gactcgccgccggtgccgttgccgcgggtgaagtcgccgccctggcacatgaactggggg 356 Query: 522 atgacgcggtggaa 535 |||||||||||||| Sbjct: 355 atgacgcggtggaa 342 Score = 123 bits (62), Expect = 7e-25 Identities = 83/90 (92%) Strand = Plus / Minus Query: 242 gccgctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctc 301 |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| Sbjct: 635 gccgctgcgggagcccaccttctcgatggccttgacgacctccatgccctcgacgacctg 576 Query: 302 gccgaagaccacgtgcttgccgtcgagcca 331 ||||||||| ||||||||||| || ||||| Sbjct: 575 gccgaagacgacgtgcttgccatccagcca 546
>gb|AF263544.1| Oryza sativa clone 20CAC microsatellite sequence Length = 905 Score = 202 bits (102), Expect = 9e-49 Identities = 195/226 (86%) Strand = Plus / Minus Query: 333 ttgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggcc 392 |||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| ||| Sbjct: 474 ttgcagggcacggtgcagatgaagaactgggacccgttagtgttgggcccggcgttcgcc 415 Query: 393 atggagaggatccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcg 452 ||||| ||||| || || || ||||||| |||| |||||||||||||||||| Sbjct: 414 atggacaggatgccggggctgtcgtgcttgaacttgaacacttcgtcggcgaacttctcg 355 Query: 453 ccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatg 512 |||||||| ||||| || || ||||||||||| | ||||||||||||||||||||||||| Sbjct: 354 ccgtagatcgactcccctcccgtgccgttgccgcgggtgaagtcgccgccctggcacatg 295 Query: 513 aagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 || || ||||| ||||||||||| | ||| |||||||||||||||| Sbjct: 294 aactccgggatcacgcggtggaaggtgctccccttgtagtgcagcg 249
>dbj|D29701.1|RICYK13 Oryza sativa mRNA, partial homologous to cyclophilin gene Length = 356 Score = 200 bits (101), Expect = 3e-48 Identities = 219/257 (85%), Gaps = 1/257 (0%) Strand = Plus / Minus Query: 204 tggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagcccaccttc 263 |||||||||||||||||||||||| |||||| | | | |||| |||||| ||||||||| Sbjct: 260 tggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatcccaccttc 201 Query: 264 tcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccg 323 |||||| ||||||||||||||||||||||||||| |||||| || |||||||| ||| Sbjct: 200 tcgatggccttgacgacgtccatgccctcgacgacgcggccgaacacgacgtgcttcccg 141 Query: 324 tcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccg 383 || ||||| ||||||| ||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 140 tccagccagctgcagggcacggtgcagatgaagaactgggacccgttagtgttgggccc- 82 Query: 384 gcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgtcggcg 443 ||||| |||||||| ||||| || || || ||||||| |||| |||||||||| Sbjct: 81 gcgttcgccatggacaggatgccggggctgtcgtgcttgaacttgaacacctcgtcggcg 22 Query: 444 aacttctcgccgtagat 460 ||||||||||||||||| Sbjct: 21 aacttctcgccgtagat 5
>dbj|AB231810.1| Malassezia japonica CYP mRNA for cyclophilin, partial cds Length = 486 Score = 192 bits (97), Expect = 9e-46 Identities = 232/277 (83%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgcc 322 ||||||| |||||||| |||||| || || ||||||||||| ||||| ||||||||||| Sbjct: 423 ctcgatggccttgacgatgtccataccgtcaacgacctcgccaaagacgacgtgcttgcc 364 Query: 323 gtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgggccc 382 ||||||||| ||| | || ||| |||||||||||| ||||||||||||||||| || Sbjct: 363 gtcgagccagttggtgaccacagtggtgatgaagaactgcgagccgttggtgttggggcc 304 Query: 383 ggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgtcggc 442 |||||||||||||||||| | || |||||| ||||||| || ||| ||||||||||| Sbjct: 303 ggcgttggccatggagagcagaccaggcttgttgtgcttcaggttgaagttctcgtcggc 244 Query: 443 gaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgcc 502 |||||| | ||||||||||||| ||| ||||| |||||||| |||||||| || || Sbjct: 243 gaacttggcaccgtagatggacttgccaccggtaccgttgccggcagtgaagtcaccacc 184 Query: 503 ctggcacatgaagtcggggatgacgcggtggaacgag 539 |||| ||| |||||||||||||| |||||||||||| Sbjct: 183 ctggagcataaagtcggggatgacacggtggaacgag 147
>dbj|AK105186.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D12, full insert sequence Length = 682 Score = 184 bits (93), Expect = 2e-43 Identities = 233/277 (84%), Gaps = 2/277 (0%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgcc 322 |||||| |||||||| ||||||||||| |||||||| ||| || || ||||||||||| Sbjct: 505 ctcgatcttcttgacaacgtccatgccgtcgacgacgcggccaaacacaacgtgcttgcc 446 Query: 323 gtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgggccc 382 ||||||||| | ||| ||||||||||||||||| |||||||| ||||| || || Sbjct: 445 gtcgagccacgcggtctcgaccgtgcagatgaagaactgcgagccgttcgtgttagggcc 386 Query: 383 ggcgttggccatggagaggat-ccctggcttggtgtgcttgtggacgaacttctcgtcgg 441 |||||||||||| ||||| || |||| || |||||||| | | ||| |||||||||| Sbjct: 385 ggcgttggccatcgagagaatgccctcgccct-tgtgcttgagcaggaagttctcgtcgg 327 Query: 442 cgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgc 501 |||||||||||||||| || ||||||||||| ||||||||||| | |||||||| |||| Sbjct: 326 cgaacttctcgccgtaaatcgactcgccgcccgtgccgttgccgcgcgtgaagtcaccgc 267 Query: 502 cctggcacatgaagtcggggatgacgcggtggaacga 538 ||||||||||||||| |||||| || ||||||||||| Sbjct: 266 cctggcacatgaagttggggatcacacggtggaacga 230
>ref|XM_366228.1| Magnaporthe grisea 70-15 hypothetical protein (MG10447.4) partial mRNA Length = 648 Score = 178 bits (90), Expect = 1e-41 Identities = 162/186 (87%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| ||||||||||||||||| ||||||||||||||||| |||| || || Sbjct: 492 gatgaagaactgcgagccgttggtgttggggccggcgttggccatggacaggagtccagg 433 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 | ||||||||||| ||| ||||||||||| |||||||||||||||| ||||| ||| Sbjct: 432 cctggtgtgcttgatctggaagttctcgtcggcaaacttctcgccgtagacggacttgcc 373 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 |||||||||||||| | ||||||||| ||||||||| ||||||||||||||||| || Sbjct: 372 accggtgccgttgccacgggtgaagtcaccgccctggagcatgaagtcggggatgatacg 313 Query: 530 gtggaa 535 |||||| Sbjct: 312 gtggaa 307 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtc 325 |||||||| ||||| |||||||||||||| Sbjct: 545 acctcgccaaagacgacgtgcttgccgtc 517
>dbj|AB231812.1| Malassezia obtusa CYP mRNA for cyclophilin, partial cds Length = 486 Score = 178 bits (90), Expect = 1e-41 Identities = 162/186 (87%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| ||||||||||||||||| |||||||||||||||||||| | || || Sbjct: 336 gatgaagaactgcgagccgttggtgttggggccggcgttggccatggagagcaggccagg 277 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||| |||||||| || ||| |||||||| |||||||||| ||||||||| |||| ||| Sbjct: 276 cttgttgtgcttgaggttgaagttctcgtcagcgaacttctggccgtagatcgacttgcc 217 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||| ||||||||||| ||||||||| ||||||||| ||||||||||||||| || || Sbjct: 216 gccagtgccgttgccagcggtgaagtcaccgccctggagcatgaagtcggggatcacacg 157 Query: 530 gtggaa 535 |||||| Sbjct: 156 gtggaa 151 Score = 73.8 bits (37), Expect = 5e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 272 cttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 |||||||||||| ||| || ||||||||||||||||| |||||||||||||||||||| Sbjct: 414 cttgacgacgtcgtagccgtcaacgacctcgccgaagacgacgtgcttgccgtcgagcca 355 Query: 332 a 332 | Sbjct: 354 a 354
>dbj|AB062457.1| Magnaporthe grisea CYP1 mRNA for cyclophilin, complete cds Length = 775 Score = 178 bits (90), Expect = 1e-41 Identities = 162/186 (87%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| ||||||||||||||||| ||||||||||||||||| |||| || || Sbjct: 395 gatgaagaactgcgagccgttggtgttggggccggcgttggccatggacaggagtccagg 336 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 | ||||||||||| ||| ||||||||||| |||||||||||||||| ||||| ||| Sbjct: 335 cctggtgtgcttgatctggaagttctcgtcggcaaacttctcgccgtagacggacttgcc 276 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 |||||||||||||| | ||||||||| ||||||||| ||||||||||||||||| || Sbjct: 275 accggtgccgttgccacgggtgaagtcaccgccctggagcatgaagtcggggatgatacg 216 Query: 530 gtggaa 535 |||||| Sbjct: 215 gtggaa 210 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtc 325 |||||||| ||||| |||||||||||||| Sbjct: 448 acctcgccaaagacgacgtgcttgccgtc 420
>gb|AY705800.1| Pinus halepensis clone 17r cyclophilin mRNA, complete cds Length = 1080 Score = 174 bits (88), Expect = 2e-40 Identities = 169/196 (86%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 |||| |||||||||||||| |||||||| ||||| || |||||||||||||||||||||| Sbjct: 451 cggtacagatgaagaactgcgagccgttagtgttagggccggcgttggccatggagagga 392 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| | || || ||||| ||||| ||||||||||||||||| | Sbjct: 391 tgccaggccccgtgtgcttctttacaaagttctcatcggcaaacttctcgccgtagatag 332 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggga 522 |||| || ||||| ||||||||||| |||||||| ||||||||||||||||| | |||| Sbjct: 331 actctccaccggtaccgttgccccttgtgaagtcaccgccctggcacatgaaccctggga 272 Query: 523 tgacgcggtggaacga 538 | |||||||||||||| Sbjct: 271 tcacgcggtggaacga 256
>gb|AY109901.1| Zea mays CL2214_-5 mRNA sequence Length = 636 Score = 174 bits (88), Expect = 2e-40 Identities = 113/123 (91%) Strand = Plus / Minus Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 155 ggtgtgcttgcggacgaacttctcgtcggggaacttctcgccgtagatggactcgccgcc 96 Query: 473 ggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtg 532 |||||||||||| | ||||||||||||||||||||||||||| | ||||||||||| Sbjct: 95 ggtgccgttgccgcgggtgaagtcgccgccctggcacatgaactnnnnnatgacgcggtg 36 Query: 533 gaa 535 ||| Sbjct: 35 gaa 33 Score = 123 bits (62), Expect = 7e-25 Identities = 83/90 (92%) Strand = Plus / Minus Query: 242 gccgctgcgggagcccaccttctcgatgttcttgacgacgtccatgccctcgacgacctc 301 |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| Sbjct: 326 gccgctgcgggagcccaccttctcgatggccttgacgacctccatgccctcgacgacctg 267 Query: 302 gccgaagaccacgtgcttgccgtcgagcca 331 ||||||||| ||||||||||| || ||||| Sbjct: 266 gccgaagacgacgtgcttgccatccagcca 237
>gb|AY105212.1| Zea mays PCO124469 mRNA sequence Length = 886 Score = 157 bits (79), Expect = 5e-35 Identities = 115/127 (90%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||||||||||||| | |||||||||||||||||||||| ||||||||||||| |||| Sbjct: 545 ttctcgtcggcgaacctggcgccgtagatggactcgccgcccgtgccgttgccccgggtg 486 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 |||||||||||||||||||||||| | ||||||||||||||||| | |||||||||| Sbjct: 485 aagtcgccgccctggcacatgaagcccgggatgacgcggtggaaggccgagcccttgtag 426 Query: 552 tgcagcg 558 ||||||| Sbjct: 425 tgcagcg 419 Score = 99.6 bits (50), Expect = 9e-18 Identities = 56/58 (96%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| Sbjct: 634 cggtgcagatgaagaactgggagccgttggtgtcgggccccgcgttggccatggagag 577 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 291 tcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 |||||||||| ||||||||| |||||||||||||| ||||| Sbjct: 686 tcgacgaccttgccgaagacgacgtgcttgccgtcaagcca 646
>gb|AY232025.1| Drosophila yakuba clone yak-ad_Cyp1 mRNA sequence Length = 456 Score = 155 bits (78), Expect = 2e-34 Identities = 165/194 (85%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 |||||||| |||||||||||||||||||| ||||||| || ||||||||||| || ||| Sbjct: 353 acggtgcaaatgaagaactgggagccgttcgtgttggcgccagcgttggccatcgacagg 294 Query: 402 atccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatg 461 || || | ||||||||| | |||| ||||| |||| |||||| | |||||||||| Sbjct: 293 atgccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatg 234 Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||| |||||| ||||||||| |||||||||||||||||||||||||||||| |||| Sbjct: 233 gacttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttgggg 174 Query: 522 atgacgcggtggaa 535 |||||||||||||| Sbjct: 173 atgacgcggtggaa 160 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 |||||||| || |||| |||||||||||||| |||||||| || |||||| Sbjct: 425 ttcttgaccacatccagaccctcgacgacctcaccgaagacgacatgcttg 375
>gb|AY231912.1| Drosophila yakuba clone yak-em_Cyp1 mRNA sequence Length = 399 Score = 155 bits (78), Expect = 2e-34 Identities = 165/194 (85%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 |||||||| |||||||||||||||||||| ||||||| || ||||||||||| || ||| Sbjct: 257 acggtgcaaatgaagaactgggagccgttcgtgttggcgccagcgttggccatcgacagg 198 Query: 402 atccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatg 461 || || | ||||||||| | |||| ||||| |||| |||||| | |||||||||| Sbjct: 197 atgccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatg 138 Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||| |||||| ||||||||| |||||||||||||||||||||||||||||| |||| Sbjct: 137 gacttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttgggg 78 Query: 522 atgacgcggtggaa 535 |||||||||||||| Sbjct: 77 atgacgcggtggaa 64 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 |||||||| || |||| |||||||||||||| |||||||| || |||||| Sbjct: 329 ttcttgaccacatccagaccctcgacgacctcaccgaagacgacatgcttg 279
>gb|AF542516.1| Beauveria bassiana cyclophilin A mRNA, complete cds Length = 705 Score = 155 bits (78), Expect = 2e-34 Identities = 219/266 (82%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 |||||||| ||||| | |||||||||||||| ||| || || |||||||| ||||| ||| Sbjct: 461 ttcttgacaacgtcgaggccctcgacgaccttgccaaacacgacgtgctttccgtccagc 402 Query: 330 caattgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttg 389 || || | | ||||||| ||||||||||||||||||||||||||| ||||||||| Sbjct: 401 cagccagtggtggcagtgcagaggaagaactgggagccgttggtgttggggccggcgttg 342 Query: 390 gccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttc 449 ||||||||||| || || || |||||||| | ||| ||||| || ||||||||| Sbjct: 341 gccatggagagaataccggggccagtgtgcttcagctggaagttctcatcagcgaacttc 282 Query: 450 tcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcac 509 |||||||||||||||| ||| || |||||||| | ||||| || |||||||||||| Sbjct: 281 tcgccgtagatggacttgccaccagtgccgttatggttcgtgaaatcaccgccctggcac 222 Query: 510 atgaagtcggggatgacgcggtggaa 535 |||||| ||||||||||||||||||| Sbjct: 221 atgaagccggggatgacgcggtggaa 196
>dbj|AB231815.1| Malassezia yamatoensis CYP mRNA for cyclophilin, partial cds Length = 423 Score = 155 bits (78), Expect = 2e-34 Identities = 159/186 (85%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||||||||| ||||| | || || Sbjct: 336 gatgaagaactgcgagccgttcgtgttcgggccggcgttggccatcgagagcagaccagg 277 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||| |||||||| || ||| |||||||| |||||||||| ||||||||| |||| ||| Sbjct: 276 cttgttgtgcttgaggttgaagttctcgtcagcgaacttctggccgtagatcgacttgcc 217 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||| ||||||||||| ||||||||| ||||||||| ||||||||||||||| || || Sbjct: 216 gcccgtgccgttgccggcggtgaagtcaccgccctggagcatgaagtcggggatcacacg 157 Query: 530 gtggaa 535 |||||| Sbjct: 156 gtggaa 151 Score = 97.6 bits (49), Expect = 4e-17 Identities = 64/69 (92%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgcc 322 ||||||| |||||| ||||||||||| |||||||||||||||||||| ||||||||||| Sbjct: 423 ctcgatggccttgacaacgtccatgccgtcgacgacctcgccgaagacgacgtgcttgcc 364 Query: 323 gtcgagcca 331 ||||||||| Sbjct: 363 gtcgagcca 355
>ref|XM_959286.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin (cytosolic form) [Neurospora crassa OR74A] ) (NCU00726.1) partial mRNA Length = 543 Score = 153 bits (77), Expect = 7e-34 Identities = 200/241 (82%) Strand = Plus / Minus Query: 295 cgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatga 354 |||||||||||||||| ||||| ||| |||||||| || |||||| ||| || || Sbjct: 433 cgacctcgccgaagacgacgtggcggccatcgagccagctggtggggacagtggtgacga 374 Query: 355 agaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttgg 414 ||||||||||||||||||||||||| |||||||||||||||||||| | || || | Sbjct: 373 agaactgggagccgttggtgttggggccggcgttggccatggagagaagaccagggcgga 314 Query: 415 tgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccgg 474 |||||| | | |||| ||||| |||||||||||||||||||||||||||| ||| || | Sbjct: 313 cgtgcttcttggcgaagttctcatcggcgaacttctcgccgtagatggacttgccaccag 254 Query: 475 tgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtgga 534 ||||||| || | ||||||||| || |||||| |||||| |||||||| | |||||||| Sbjct: 253 tgccgttaccacgggtgaagtcaccaccctggagcatgaactcggggataatgcggtgga 194 Query: 535 a 535 | Sbjct: 193 a 193
>ref|XM_324905.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin (cytosolic form) [Neurospora crassa OR74A] ) (NCU00726.1) partial mRNA Length = 543 Score = 153 bits (77), Expect = 7e-34 Identities = 200/241 (82%) Strand = Plus / Minus Query: 295 cgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatga 354 |||||||||||||||| ||||| ||| |||||||| || |||||| ||| || || Sbjct: 433 cgacctcgccgaagacgacgtggcggccatcgagccagctggtggggacagtggtgacga 374 Query: 355 agaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttgg 414 ||||||||||||||||||||||||| |||||||||||||||||||| | || || | Sbjct: 373 agaactgggagccgttggtgttggggccggcgttggccatggagagaagaccagggcgga 314 Query: 415 tgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccgg 474 |||||| | | |||| ||||| |||||||||||||||||||||||||||| ||| || | Sbjct: 313 cgtgcttcttggcgaagttctcatcggcgaacttctcgccgtagatggacttgccaccag 254 Query: 475 tgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtgga 534 ||||||| || | ||||||||| || |||||| |||||| |||||||| | |||||||| Sbjct: 253 tgccgttaccacgggtgaagtcaccaccctggagcatgaactcggggataatgcggtgga 194 Query: 535 a 535 | Sbjct: 193 a 193
>ref|XM_501673.1| Yarrowia lipolytica CLIB122, YALI0C10230g predicted mRNA Length = 492 Score = 153 bits (77), Expect = 7e-34 Identities = 224/273 (82%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgcc 322 |||||| |||||||| |||||||| || | | |||||| |||||||| ||||||||||| Sbjct: 426 ctcgatcttcttgacaacgtccataccgttggtgacctcaccgaagacaacgtgcttgcc 367 Query: 323 gtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgggccc 382 ||||||||| ||||||||||||| | ||||||||||||||||||||||||||| || Sbjct: 366 gtcgagccaggggcaggggacggtggtcacgaagaactgggagccgttggtgttggggcc 307 Query: 383 ggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgtcggc 442 || |||||||||||| |||| || || |||||||||| | || |||||||||| Sbjct: 306 ggagttggccatggacaggagaccgggtcgggtgtgcttggcctcaaagttctcgtcggg 247 Query: 443 gaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgcc 502 |||||| ||||||||||||||| ||| ||||| |||||| | ||||||||| || || Sbjct: 246 gaacttggcgccgtagatggacttgcctccggttccgttgtgtcgggtgaagtctccacc 187 Query: 503 ctggcacatgaagtcggggatgacgcggtggaa 535 ||| |||||| | ||||||||| |||||||| Sbjct: 186 ctgcagcatgaactgggggatgactcggtggaa 154
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 153 bits (77), Expect = 7e-34 Identities = 224/273 (82%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgcc 322 |||||| |||||||| |||||||| || | | |||||| |||||||| ||||||||||| Sbjct: 1424455 ctcgatcttcttgacaacgtccataccgttggtgacctcaccgaagacaacgtgcttgcc 1424396 Query: 323 gtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgggccc 382 ||||||||| ||||||||||||| | ||||||||||||||||||||||||||| || Sbjct: 1424395 gtcgagccaggggcaggggacggtggtcacgaagaactgggagccgttggtgttggggcc 1424336 Query: 383 ggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgtcggc 442 || |||||||||||| |||| || || |||||||||| | || |||||||||| Sbjct: 1424335 ggagttggccatggacaggagaccgggtcgggtgtgcttggcctcaaagttctcgtcggg 1424276 Query: 443 gaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgcc 502 |||||| ||||||||||||||| ||| ||||| |||||| | ||||||||| || || Sbjct: 1424275 gaacttggcgccgtagatggacttgcctccggttccgttgtgtcgggtgaagtctccacc 1424216 Query: 503 ctggcacatgaagtcggggatgacgcggtggaa 535 ||| |||||| | ||||||||| |||||||| Sbjct: 1424215 ctgcagcatgaactgggggatgactcggtggaa 1424183 Score = 109 bits (55), Expect = 1e-20 Identities = 160/195 (82%) Strand = Plus / Minus Query: 341 gacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||| || Sbjct: 1368703 gacggtggtgatgaaaaactgggagccgttggtgttggggccggcgttggccatggacag 1368644 Query: 401 gatccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagat 460 | || || ||||||||| | ||| |||||||||| |||||| | ||||||||| Sbjct: 1368643 cagaccgggtcgggtgtgcttcacgttgaagttctcgtcggggaacttttggccgtagat 1368584 Query: 461 ggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggg 520 |||| ||||||||| |||||| |||||||||| || |||||| ||| |||| ||| Sbjct: 1368583 agacttgccgccggtaccgttgtggttggtgaagtcaccaccctggagcataaagttggg 1368524 Query: 521 gatgacgcggtggaa 535 |||||| |||||||| Sbjct: 1368523 gatgactcggtggaa 1368509 Score = 81.8 bits (41), Expect = 2e-12 Identities = 44/45 (97%) Strand = Plus / Plus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccat 394 |||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 2361807 gatgaagaactgcgagccgttggtgttgggcccggcgttggccat 2361851 Score = 56.0 bits (28), Expect = 1e-04 Identities = 61/72 (84%) Strand = Plus / Plus Query: 434 ctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaa 493 |||||| | ||||||||| |||||||||||||| || ||||| |||||||| |||||| Sbjct: 2361891 ctcgtcagggaacttctccccgtagatggactctcctccggtaccgttgccagcggtgaa 2361950 Query: 494 gtcgccgccctg 505 ||| || ||||| Sbjct: 2361951 gtctcctccctg 2361962
>gb|J03963.1|NEUCYCLO N.crassa cytosolic cyclosporin A-binding protein mRNA, complete cds Length = 928 Score = 153 bits (77), Expect = 7e-34 Identities = 200/241 (82%) Strand = Plus / Minus Query: 295 cgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatga 354 |||||||||||||||| ||||| ||| |||||||| || |||||| ||| || || Sbjct: 699 cgacctcgccgaagacgacgtggcggccatcgagccagctggtggggacagtggtgacga 640 Query: 355 agaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttgg 414 ||||||||||||||||||||||||| |||||||||||||||||||| | || || | Sbjct: 639 agaactgggagccgttggtgttggggccggcgttggccatggagagaagaccagggcgga 580 Query: 415 tgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccgg 474 |||||| | | |||| ||||| |||||||||||||||||||||||||||| ||| || | Sbjct: 579 cgtgcttcttggcgaagttctcatcggcgaacttctcgccgtagatggacttgccaccag 520 Query: 475 tgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtgga 534 ||||||| || | ||||||||| || |||||| |||||| |||||||| | |||||||| Sbjct: 519 tgccgttaccacgggtgaagtcaccaccctggagcatgaactcggggataatgcggtgga 460 Query: 535 a 535 | Sbjct: 459 a 459
>ref|XM_754780.1| Ustilago maydis 521 hypothetical protein (UM03726.1) partial mRNA Length = 489 Score = 151 bits (76), Expect = 3e-33 Identities = 205/248 (82%) Strand = Plus / Minus Query: 291 tcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcag 350 |||||||||||||||||||| |||||||||||||||||||| | | ||||||| | Sbjct: 395 tcgacgacctcgccgaagacgacgtgcttgccgtcgagccacgaggtgacgacggtggtg 336 Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggc 410 ||||||||||| ||||||||||||||||| ||||||||||||||||| || | || ||| Sbjct: 335 atgaagaactgcgagccgttggtgttggggccggcgttggccatggaaagaagaccgggc 276 Query: 411 ttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccg 470 ||||||||| | | ||| |||||||| ||||||| |||||||||| |||| ||| Sbjct: 275 ttggtgtgcgagagcttgaagttctcgtcttcgaacttggcgccgtagatcgacttgcct 216 Query: 471 ccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcgg 530 ||||| ||||| || ||||||||| || ||||| ||||||||| |||||||| ||| Sbjct: 215 ccggtaccgttaccggcggtgaagtcaccaccctgcagcatgaagtccgggatgacacgg 156 Query: 531 tggaacga 538 |||||||| Sbjct: 155 tggaacga 148
>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29 Length = 303550 Score = 149 bits (75), Expect = 1e-32 Identities = 213/259 (82%) Strand = Plus / Plus Query: 279 acgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcag 338 |||||| ||||||||||||||| ||||||||| |||||||||||||| ||||| | | Sbjct: 262895 acgtccgtgccctcgacgaccttgccgaagacgacgtgcttgccgtccagccacggggtg 262954 Query: 339 gggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggag 398 |||||||| || ||||||||| |||||||||||||| || || ||||| |||||||| Sbjct: 262955 gggacggtcgtgacgaagaactgcgagccgttggtgttcggacccgcgttcgccatggac 263014 Query: 399 aggatccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtag 458 |||| |||| ||||||||| | ||| |||||||| |||||||||||||||||| Sbjct: 263015 aggaggtacggctcggtgtgcttcagctggaagttctcgtccgcgaacttctcgccgtag 263074 Query: 459 atggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcg 518 ||| || ||| |||||||||||||| |||||||||| ||||||||| |||||| | Sbjct: 263075 atgctcttgcccccggtgccgttgccgttggtgaagtcaccgccctggagcatgaactgc 263134 Query: 519 gggatgacgcggtggaacg 537 ||||| || |||||||||| Sbjct: 263135 gggatcacacggtggaacg 263153
>emb|AJ311666.1|BVE311666 Betula verrucosa mRNA for peptidylprolyl isomerase (cyclophilin), ppiase gene (CyP) Length = 823 Score = 147 bits (74), Expect = 5e-32 Identities = 218/266 (81%) Strand = Plus / Minus Query: 258 accttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgc 317 |||||||||||| || |||| ||||| ||||| ||||||| |||||| ||||||||| Sbjct: 492 accttctcgatggctttcacgatgtccagaccctccacgacctggccgaacaccacgtgc 433 Query: 318 ttgccgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttg 377 |||||||||||||| | | | |||| |||||||||||||| || || |||||| | Sbjct: 432 ttgccgtcgagccactcggtcttggcggtacagatgaagaactgagatccattggtgccg 373 Query: 378 ggcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcg 437 || ||||| || |||||||||||||| || || ||||||||| | || ||| ||||| Sbjct: 372 gggccggcattagccatggagaggatgccggggccggtgtgcttcttgatgaagttctca 313 Query: 438 tcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcg 497 ||||||||||| ||||||||||||||||||| ||||||||||| || ||||||||| Sbjct: 312 tcggcgaacttggcgccgtagatggactcgccaccggtgccgtttccggcagtgaagtcg 253 Query: 498 ccgccctggcacatgaagtcggggat 523 || |||||||||||||| ||||||| Sbjct: 252 cccccctggcacatgaacccggggat 227
>gb|DQ066345.1| Ixodes scapularis isolate IS-6-12-J-cluster-190 cyclophilin A mRNA, complete cds Length = 498 Score = 145 bits (73), Expect = 2e-31 Identities = 166/197 (84%) Strand = Plus / Minus Query: 354 aagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttg 413 ||||||||||| || ||||||||||| || || || |||||||| ||||| ||||| | Sbjct: 338 aagaactgggatccattggtgttggggccagcattagccatggaaaggattcctggtccg 279 Query: 414 gtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccg 473 |||||||| ||| ||| || || || |||||||||||||||||||||||| |||||| Sbjct: 278 gtgtgcttcaggatgaagttttcatcttcgaacttctcgccgtagatggacttgccgccc 219 Query: 474 gtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtgg 533 ||||||||| || ||||||||| || |||||||||||||||| ||||||||| |||||| Sbjct: 218 gtgccgttgtgccgggtgaagtctcctccctggcacatgaagttggggatgactcggtgg 159 Query: 534 aacgagctgcccttgta 550 || |||||||||||| Sbjct: 158 aaaatgctgcccttgta 142 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Minus Query: 306 aagaccacgtgcttgccgtcgagcca 331 |||||||| ||||||||||||||||| Sbjct: 386 aagaccacatgcttgccgtcgagcca 361
>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence Length = 176969 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Plus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||| || ||||||||||||||||| ||||||| || ||||||||||| || ||||| Sbjct: 159631 gtgcaaataaagaactgggagccgttcgtgttggcgccagcgttggccatcgacaggatg 159690 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || | ||||||||| | |||| ||||| |||| |||||| | ||||||||||||| Sbjct: 159691 ccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatggac 159750 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | |||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 159751 ttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttggggatg 159810 Query: 525 acgcggtggaa 535 ||||||||||| Sbjct: 159811 acgcggtggaa 159821 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 264 tcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 ||||| |||||||| || |||| ||||||||||||||||||||||| ||||||||| Sbjct: 159550 tcgatcttcttgaccacatccagtccctcgacgacctcgccgaagacgacgtgcttg 159606
>gb|AC010846.13| Drosophila melanogaster clone BACR13G13, complete sequence Length = 192540 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Plus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||| || ||||||||||||||||| ||||||| || ||||||||||| || ||||| Sbjct: 62195 gtgcaaataaagaactgggagccgttcgtgttggcgccagcgttggccatcgacaggatg 62254 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || | ||||||||| | |||| ||||| |||| |||||| | ||||||||||||| Sbjct: 62255 ccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatggac 62314 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | |||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 62315 ttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttggggatg 62374 Query: 525 acgcggtggaa 535 ||||||||||| Sbjct: 62375 acgcggtggaa 62385 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 264 tcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 ||||| |||||||| || |||| ||||||||||||||||||||||| ||||||||| Sbjct: 62114 tcgatcttcttgaccacatccagtccctcgacgacctcgccgaagacgacgtgcttg 62170
>ref|XM_380953.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00777.1) partial mRNA Length = 675 Score = 141 bits (71), Expect = 3e-30 Identities = 155/183 (84%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 ||||||||||||||||||||||||||| |||||||||||||||||||| | || ||||| Sbjct: 507 gaagaactgggagccgttggtgttggggccggcgttggccatggagagcagaccaggctt 448 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 | |||||| | ||| |||||||| ||||||||||| ||||||||||||| ||| || Sbjct: 447 gtcgtgcttcaaggtgaagttctcgtcagcgaacttctcaccgtagatggacttgccacc 388 Query: 473 ggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtg 532 ||||||||||| | ||||||||| || ||||| ||||||||| ||||||| ||||| Sbjct: 387 agtgccgttgccacgggtgaagtcaccaccctgaagcatgaagtcagggatgattcggtg 328 Query: 533 gaa 535 ||| Sbjct: 327 gaa 325
>gb|BT009946.1| Drosophila melanogaster SD01793 full insert cDNA Length = 796 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||| || ||||||||||||||||| ||||||| || ||||||||||| || ||||| Sbjct: 484 gtgcaaataaagaactgggagccgttcgtgttggcgccagcgttggccatcgacaggatg 425 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || | ||||||||| | |||| ||||| |||| |||||| | ||||||||||||| Sbjct: 424 ccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatggac 365 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | |||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 364 ttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttggggatg 305 Query: 525 acgcggtggaa 535 ||||||||||| Sbjct: 304 acgcggtggaa 294 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 264 tcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 ||||| |||||||| || |||| ||||||||||||||||||||||| ||||||||| Sbjct: 565 tcgatcttcttgaccacatccagtccctcgacgacctcgccgaagacgacgtgcttg 509
>emb|AJ271126.1|PAB271126 Picea abies mRNA for putative cyclosporin A-binding protein, (pPA0005 gene) Length = 1026 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 |||||||| ||||||||||||||||| ||||| || || |||||||||||||||||||| Sbjct: 469 gtgcagataaagaactgggagccgttagtgttagggcccgcgttggccatggagaggatg 410 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || || |||||||| |||| ||||||||||| ||||||||||||||||| ||| Sbjct: 409 ccgggacccgtgtgctttcttgcgaagttctcgtcggcaaacttctcgccgtagatcgac 350 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 || |||||||| ||||| || | |||||||||||||| ||||||||||| | ||||| Sbjct: 349 tccccgccggtaccgttaccacgcgtgaagtcgccgccttggcacatgaaccctgggatc 290 Query: 525 acgcggtggaa 535 ||||||||||| Sbjct: 289 acgcggtggaa 279
>ref|NM_078642.3| Drosophila melanogaster Cyclophilin 1 CG9916-RA (Cyp1), mRNA Length = 1269 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||| || ||||||||||||||||| ||||||| || ||||||||||| || ||||| Sbjct: 612 gtgcaaataaagaactgggagccgttcgtgttggcgccagcgttggccatcgacaggatg 553 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || | ||||||||| | |||| ||||| |||| |||||| | ||||||||||||| Sbjct: 552 ccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatggac 493 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | |||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 492 ttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttggggatg 433 Query: 525 acgcggtggaa 535 ||||||||||| Sbjct: 432 acgcggtggaa 422 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 264 tcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 ||||| |||||||| || |||| ||||||||||||||||||||||| ||||||||| Sbjct: 693 tcgatcttcttgaccacatccagtccctcgacgacctcgccgaagacgacgtgcttg 637
>gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 of 74 of the complete sequence Length = 323840 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Plus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||| || ||||||||||||||||| ||||||| || ||||||||||| || ||||| Sbjct: 309303 gtgcaaataaagaactgggagccgttcgtgttggcgccagcgttggccatcgacaggatg 309362 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || | ||||||||| | |||| ||||| |||| |||||| | ||||||||||||| Sbjct: 309363 ccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatggac 309422 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | |||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 309423 ttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttggggatg 309482 Query: 525 acgcggtggaa 535 ||||||||||| Sbjct: 309483 acgcggtggaa 309493 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 264 tcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 ||||| |||||||| || |||| ||||||||||||||||||||||| ||||||||| Sbjct: 309222 tcgatcttcttgaccacatccagtccctcgacgacctcgccgaagacgacgtgcttg 309278
>gb|M62398.1|DROCYP1 Drosophila melanogaster CYP-1 protein mRNA, complete cds Length = 707 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||| || ||||||||||||||||| ||||||| || ||||||||||| || ||||| Sbjct: 382 gtgcaaataaagaactgggagccgttcgtgttggcgccagcgttggccatcgacaggatg 323 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || | ||||||||| | |||| ||||| |||| |||||| | ||||||||||||| Sbjct: 322 ccggagccggtgtgcttcagctcgaagttctcatcggggaacttgttgccgtagatggac 263 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | |||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 262 ttgccgccagtgccgttgtggttggtgaagtcgccgccctggcacatgaagttggggatg 203 Query: 525 acgcggtggaa 535 ||||||||||| Sbjct: 202 acgcggtggaa 192 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 264 tcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 ||||| |||||||| || |||| ||||||||||||||||||||||| ||||||||| Sbjct: 463 tcgatcttcttgaccacatccagtccctcgacgacctcgccgaagacgacgtgcttg 407
>gb|AF424658.1| Phytophthora infestans clone MY-08-C-01 peptidylprolyl isomerase mRNA, complete cds Length = 700 Score = 139 bits (70), Expect = 1e-29 Identities = 124/142 (87%) Strand = Plus / Minus Query: 415 tgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccgg 474 |||||||| | | ||| |||||||| | |||||||||||||||||||||||| ||||| | Sbjct: 336 tgtgcttgagcaagaagttctcgtctgggaacttctcgccgtagatggactcaccgcccg 277 Query: 475 tgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtgga 534 ||||||| || | ||||||||||||||||||||||| |||| |||||| || ||||||| Sbjct: 276 tgccgttaccacgcgtgaagtcgccgccctggcacataaagttggggatcacacggtgga 217 Query: 535 acgagctgcccttgtagtgcag 556 | |||||||||||| ||||||| Sbjct: 216 aagagctgcccttgaagtgcag 195 Score = 73.8 bits (37), Expect = 5e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 |||||||| |||||||| |||||||| |||||||| ||||||||||||||||| Sbjct: 406 gtgcagataaagaactgcgagccgttcgtgttgggaccggcgttggccatgga 354 Score = 50.1 bits (25), Expect = 0.008 Identities = 55/65 (84%) Strand = Plus / Minus Query: 267 atgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcg 326 ||||||||||| ||||||||||| || ||||| |||||| || ||||| |||||||| Sbjct: 484 atgttcttgaccacgtccatgccgtccacgacacggccgaatacgacgtgtttgccgtcc 425 Query: 327 agcca 331 ||||| Sbjct: 424 agcca 420
>dbj|AB231813.1| Malassezia restricta CYP mRNA for cyclophilin, partial cds Length = 486 Score = 137 bits (69), Expect = 4e-29 Identities = 222/273 (81%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgcc 322 ||||||| |||||||||||||||||| || |||||||| ||||| || ||||||||||| Sbjct: 423 ctcgatggccttgacgacgtccatgccatcaacgacctcaccgaacacaacgtgcttgcc 364 Query: 323 gtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttggtgttgggccc 382 ||||||||| || | |||||| |||||||||||| |||||||| |||||||| || Sbjct: 363 gtcgagccagctggtgacgacggtcgtgatgaagaactgcgagccgttcgtgttgggacc 304 Query: 383 ggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaacttctcgtcggc 442 |||||| ||||| || || | || ||||||| |||||| | ||| ||||||||||| Sbjct: 303 ggcgttagccatcgaaagcagaccaggcttggagtgcttcagctggaagttctcgtcggc 244 Query: 443 gaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgcc 502 |||||| | |||||||| |||| ||| ||||| |||||||| ||||||||| || || Sbjct: 243 gaacttggcaccgtagatcgacttgccaccggtaccgttgccggcggtgaagtcaccacc 184 Query: 503 ctggcacatgaagtcggggatgacgcggtggaa 535 |||| ||| ||||| ||||| || |||||||| Sbjct: 183 ctggagcataaagtcagggatcacacggtggaa 151
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||||||||| ||| | ||||||||||||||||||||||||||||||||||| | |||| Sbjct: 22509186 ttctcgtcggcaaacctgtcgccgtagatggactcgccgccggtgccgttgccgcgggtg 22509127 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||||||||||||||| ||| |||| |||||||| Sbjct: 22509126 aagtcgccgccctggcacatgaagttgggtatgatacggtggaa 22509083 Score = 99.6 bits (50), Expect = 9e-18 Identities = 95/110 (86%) Strand = Plus / Minus Query: 291 tcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcag 350 |||||||||| |||||| || |||||||||||||||||||| || | ||||||| Sbjct: 22509327 tcgacgaccttgccgaaaacgacgtgcttgccgtcgagccaggtggtacgcgtggtgcag 22509268 Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 22509267 atgaagaattgggagccgttggtgtttggccctgcgttggccatggagag 22509218
>dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1331F11 Length = 132205 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||||||||| ||| | ||||||||||||||||||||||||||||||||||| | |||| Sbjct: 24387 ttctcgtcggcaaacctgtcgccgtagatggactcgccgccggtgccgttgccgcgggtg 24328 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||||||||||||||| ||| |||| |||||||| Sbjct: 24327 aagtcgccgccctggcacatgaagttgggtatgatacggtggaa 24284 Score = 99.6 bits (50), Expect = 9e-18 Identities = 95/110 (86%) Strand = Plus / Minus Query: 291 tcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcag 350 |||||||||| |||||| || |||||||||||||||||||| || | ||||||| Sbjct: 24528 tcgacgaccttgccgaaaacgacgtgcttgccgtcgagccaggtggtacgcgtggtgcag 24469 Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 24468 atgaagaattgggagccgttggtgtttggccctgcgttggccatggagag 24419
>dbj|AK103109.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119A20, full insert sequence Length = 757 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||||||||| ||| | ||||||||||||||||||||||||||||||||||| | |||| Sbjct: 352 ttctcgtcggcaaacctgtcgccgtagatggactcgccgccggtgccgttgccgcgggtg 293 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||||||||||||||| ||| |||| |||||||| Sbjct: 292 aagtcgccgccctggcacatgaagttgggtatgatacggtggaa 249 Score = 99.6 bits (50), Expect = 9e-18 Identities = 95/110 (86%) Strand = Plus / Minus Query: 291 tcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcag 350 |||||||||| |||||| || |||||||||||||||||||| || | ||||||| Sbjct: 493 tcgacgaccttgccgaaaacgacgtgcttgccgtcgagccaggtggtacgcgtggtgcag 434 Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 433 atgaagaattgggagccgttggtgtttggccctgcgttggccatggagag 384
>gb|L29471.1|RICCYP1R Oryza sativa cyclophilin 1 (Cyp1) mRNA, complete cds Length = 590 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||||||||| ||| | ||||||||||||||||||||||||||||||||||| | |||| Sbjct: 333 ttctcgtcggcaaacctgtcgccgtagatggactcgccgccggtgccgttgccgcgggtg 274 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||||||||||||||| ||| |||| |||||||| Sbjct: 273 aagtcgccgccctggcacatgaagttgggtatgatacggtggaa 230 Score = 99.6 bits (50), Expect = 9e-18 Identities = 95/110 (86%) Strand = Plus / Minus Query: 291 tcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcag 350 |||||||||| |||||| || |||||||||||||||||||| || | ||||||| Sbjct: 474 tcgacgaccttgccgaaaacgacgtgcttgccgtcgagccaggtggtacgcgtggtgcag 415 Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 |||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 414 atgaagaattgggagccgttggtgtttggccctgcgttggccatggagag 365
>emb|BX933768.2| Gallus gallus finished cDNA, clone ChEST34h10 Length = 735 Score = 133 bits (67), Expect = 7e-28 Identities = 160/191 (83%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 |||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| Sbjct: 400 gtgcagatgaagaactgggagccgttcgtgttggggccggcgttggccatggacaggatg 341 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || ||| |||||||| ||| ||| ||||||||||| |||||||| ||||| ||||| Sbjct: 340 ccgggccccgtgtgcttcaggatgaagttctcgtcggcaaacttctccccgtaaatggat 281 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | ||| || ||||||||| | || ||||| || ||||| ||||||||| |||||||| Sbjct: 280 ttgccaccagtgccgttgtggcgcgtaaagtcaccaccctgacacatgaagccggggatg 221 Query: 525 acgcggtggaa 535 | |||||||| Sbjct: 220 atccggtggaa 210
>gb|AF055990.1|AF055990 Fucus distichus cyclophilin mRNA, partial cds Length = 417 Score = 133 bits (67), Expect = 7e-28 Identities = 94/103 (91%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 |||||||||||||||||||| ||||||||||||||||||||||| ||||| || | ||| Sbjct: 103 ttctcgtcggcgaacttctccccgtagatggactcgccgccggtaccgtttccacgagtg 44 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtgga 534 |||||||| ||||||||||||||||| ||||| |||||||||| Sbjct: 43 aagtcgccaccctggcacatgaagtccgggatcacgcggtgga 1
>gb|AF052206.2| Chlamydomonas reinhardtii cyclophilin 1 (cyp1) mRNA, complete cds Length = 985 Score = 129 bits (65), Expect = 1e-26 Identities = 110/125 (88%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||| |||| |||||||||||||||||||||||| || |||||||||||||| | |||| Sbjct: 303 ttctcatcggggaacttctcgccgtagatggactcaccaccggtgccgttgccgcgggtg 244 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 ||||| ||||||||||||||||||| |||||| || |||||||| | | ||||||| || Sbjct: 243 aagtcaccgccctggcacatgaagttggggatcacacggtggaaggtggagcccttgaag 184 Query: 552 tgcag 556 ||||| Sbjct: 183 tgcag 179 Score = 79.8 bits (40), Expect = 9e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 |||||||| | ||||||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 393 acggtgcacaggaagaactgcgagccgttggtgttggggccggcgttggccatgga 338 Score = 60.0 bits (30), Expect = 8e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 |||||||| ||||||||||||| | ||||| |||||| || |||||||||||||| ||| Sbjct: 465 ttcttgacaacgtccatgcccttgcagaccttgccgaacacgacgtgcttgccgtccagc 406 Query: 330 ca 331 || Sbjct: 405 ca 404
>gb|AY389742.1| Hyacinthus orientalis cyclophilin mRNA, complete cds Length = 681 Score = 125 bits (63), Expect = 2e-25 Identities = 141/167 (84%) Strand = Plus / Minus Query: 348 cagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccct 407 ||||||||||||||||| ||||| ||||||||||||||||||||||| || |||||||| Sbjct: 412 cagatgaagaactgggacccgttcgtgttgggcccggcgttggccatcgacaggatcccc 353 Query: 408 ggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcg 467 ||| |||||||| |||| |||| ||| |||||||| ||||| || |||||| Sbjct: 352 ggccccgtgtgcttcctctcgaagttctggtcctcgaacttcgacccgtatatagactcg 293 Query: 468 ccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaa 514 |||||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 292 ccgccggtcccgttgccggcggtgaagtcgccgccctggcacatgaa 246
>dbj|AB020612.1| Vigna radiata mRNA for CYP1, complete cds Length = 823 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||||||||||||||| || |||||||| || |||||||| ||||||||||| || Sbjct: 406 gtgcagatgaagaactgagatccgttggttccaggaccggcgttcgccatggagagaatg 347 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || || ||||||||| | ||||| ||||||||||||||||| |||||||||| ||| Sbjct: 346 ccaggaccggtgtgcttcttcacgaagttctcgtcggcgaacttggcgccgtagatcgac 287 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 |||||||| |||||||| || |||||||||||| || ||||||||||||| ||||| Sbjct: 286 tcgccgcctgtgccgtttccggcggtgaagtcgcctccttggcacatgaagttcgggatc 227 Query: 525 acgcggtggaa 535 || |||||||| Sbjct: 226 acacggtggaa 216 Score = 60.0 bits (30), Expect = 8e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 258 accttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgc 317 ||||||||||| | ||| || |||| || ||||| ||||||| ||||| ||||||||| Sbjct: 493 accttctcgatctccttcaccacgttcagtccctcaacgacctgtccgaacaccacgtgc 434 Query: 318 ttgccgtcgagcca 331 |||||||||||||| Sbjct: 433 ttgccgtcgagcca 420
>gb|AF263543.1| Oryza sativa clone 15CAC microsatellite sequence Length = 435 Score = 119 bits (60), Expect = 1e-23 Identities = 90/100 (90%) Strand = Plus / Minus Query: 199 agagctggccgcagtcggcgatgacgacctgcttggagcagatgccgctgcgggagccca 258 ||||||||||||||||||||||||||||| |||||| | | | |||| |||||| |||| Sbjct: 120 agagctggccgcagtcggcgatgacgaccggcttggcggtgctcccgccgcgggatccca 61 Query: 259 ccttctcgatgttcttgacgacgtccatgccctcgacgac 298 ||||||||||| ||||||||||||||||||||||||||| Sbjct: 60 ccttctcgatggccttgacgacgtccatgccctcgacgac 21
>emb|Z15137.1|SCCYCLOA Streptomyces chrysomallus orfA, estA, cypA genes Length = 3538 Score = 119 bits (60), Expect = 1e-23 Identities = 93/104 (89%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 |||||||||||||||||||||||||||||| || |||||||||||||| || | |||| Sbjct: 2690 ttctcgtcggcgaacttctcgccgtagatgctcttgccgccggtgccgtcaccgcgggtg 2631 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||||| ||||||||| | ||||||||||||||| Sbjct: 2630 aagtcgccgccctggagcatgaagtccgtgatgacgcggtggaa 2587 Score = 67.9 bits (34), Expect = 3e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 295 cgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatga 354 ||||||||||||||||||||||||||||||| ||||| | | | || ||| ||||| Sbjct: 2827 cgacctcgccgaagaccacgtgcttgccgtccagccacggggtgagcaccgtggtgatga 2768 Query: 355 agaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||| || ||||||||||| |||||||||||||| ||||| Sbjct: 2767 agaactgcgaaccgttggtgttctttccggcgttggccatcgagag 2722
>emb|X17692.1|NCCYCGEN Neurospora crassa cyclophilin gene Length = 2719 Score = 119 bits (60), Expect = 1e-23 Identities = 153/184 (83%) Strand = Plus / Minus Query: 295 cgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatga 354 |||||||||||||||| ||||| ||| |||||||| || |||||| ||| || || Sbjct: 2263 cgacctcgccgaagacgacgtggcggccatcgagccagctggtggggacagtggtgacga 2204 Query: 355 agaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttgg 414 ||||||||||||||||||||||||| |||||||||||||||||||| | || || | Sbjct: 2203 agaactgggagccgttggtgttggggccggcgttggccatggagagaagaccagggcgga 2144 Query: 415 tgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccgg 474 |||||| | | |||| ||||| |||||||||||||||||||||||||||| ||| || | Sbjct: 2143 cgtgcttcttggcgaagttctcatcggcgaacttctcgccgtagatggacttgccaccag 2084 Query: 475 tgcc 478 |||| Sbjct: 2083 tgcc 2080
>emb|Y08273.1|DLCYP18 D.lanata CYP18 gene Length = 1363 Score = 117 bits (59), Expect = 4e-23 Identities = 161/195 (82%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||||||||| || || ||||| || || |||||||||||||| |||| Sbjct: 878 cggtgcagatgaagaactgagatccattggttcccggtccagcgttggccatggacagga 819 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | ||||| |||||||| | ||||| |||||||||||||| ||| |||||||||| | Sbjct: 818 ttcctggaccagtgtgcttcttcacgaagttctcgtcggcgaatttcgcgccgtagatcg 759 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggga 522 | ||||| ||||||||||| || |||||| ||||||||||| |||||||| |||||| Sbjct: 758 attcgcctccggtgccgtttccagcggtgaaatcgccgccctgacacatgaacccgggga 699 Query: 523 tgacgcggtggaacg 537 | || |||||||||| Sbjct: 698 tcactcggtggaacg 684
>dbj|AB231814.1| Malassezia slooffiae CYP mRNA for cyclophilin, partial cds Length = 486 Score = 117 bits (59), Expect = 4e-23 Identities = 197/243 (81%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| ||||| || |||||||||||||||||||| || ||| || ||| ||||||| Sbjct: 389 acctcaccgaacacgacgtgcttgccgtcgagccagctggtgggcaccgtggtgatgaag 330 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggcttggtg 416 ||||| ||||||||||||||||| || ||||| ||||| ||||| | || |||||| || Sbjct: 329 aactgcgagccgttggtgttggggcccgcgttagccatcgagagcagaccaggcttgttg 270 Query: 417 tgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtg 476 ||||| | | || |||||||| | |||||| | ||||||||| || ||| |||||| Sbjct: 269 tgcttaagcgctaagttctcgtccgggaacttggcaccgtagatgctcttgccaccggtg 210 Query: 477 ccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaac 536 ||||||||| |||||||| || |||||| ||||||||| ||||| || ||||||||| Sbjct: 209 ccgttgcccgcagtgaagtcaccaccctggagcatgaagtcagggatcacacggtggaac 150 Query: 537 gag 539 ||| Sbjct: 149 gag 147
>emb|AJ011956.1|MFU011956 Malassezia sympodialis mRNA for allergen Mal s 6, strain ATCC no. 42132 Length = 573 Score = 115 bits (58), Expect = 2e-22 Identities = 154/186 (82%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||||||||| || || ||||||||||| ||||| | || || Sbjct: 351 gatgaagaactgcgagccgttggtgttaggaccagcgttggccatcgagagcagaccagg 292 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||| |||||||| | ||| |||||||| |||||||| |||||||||| |||| ||| Sbjct: 291 cttgttgtgcttgagctggaagttctcgtcagcgaacttggcgccgtagatcgacttgcc 232 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||| ||||||||||| ||||||||| || |||||| ||| ||||| ||||| || || Sbjct: 231 gcccgtgccgttgccagcggtgaagtcaccaccctggagcataaagtcagggatcacacg 172 Query: 530 gtggaa 535 |||||| Sbjct: 171 gtggaa 166 Score = 58.0 bits (29), Expect = 3e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgcc 322 ||||||| |||||| |||| |||||| || | |||||| |||||||| ||||||||||| Sbjct: 438 ctcgatggccttgacaacgttcatgccgtcaatgacctcaccgaagacgacgtgcttgcc 379 Query: 323 gtcgagcca 331 ||| ||||| Sbjct: 378 gtccagcca 370
>ref|XM_504296.1| Yarrowia lipolytica CLIB122, YALI0E23155g predicted mRNA Length = 687 Score = 115 bits (58), Expect = 2e-22 Identities = 187/230 (81%) Strand = Plus / Minus Query: 287 gccctcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggt 346 |||||||| |||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 489 gccctcgagaacctcgccaaagacaacgtgcttgccgtcgagccagctggtaaccacggt 430 Query: 347 gcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccc 406 | |||||||||||||||||||||||||| | ||||||||||||||||| || | Sbjct: 429 ggtgatgaagaactgggagccgttggtgtctcggccggcgttggccatggacagcttgta 370 Query: 407 tggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactc 466 ||||||||||||||| | ||| |||||||||| |||||| ||||||||||||||| Sbjct: 369 aggcttggtgtgcttgagctggaagttctcgtcggggaactttcggccgtagatggactc 310 Query: 467 gccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagt 516 ||| || ||||||| || | ||||||||| ||||||||| |||||||| Sbjct: 309 gcctccagtgccgtctcctcgggtgaagtctccgccctggatcatgaagt 260
>gb|DQ012959.1| Streptomyces antibioticus strain ETH7451 cyclophilin gene, partial cds Length = 393 Score = 115 bits (58), Expect = 2e-22 Identities = 94/106 (88%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 |||||||| ||||||||||||||||||||| || |||||||||||||||||| ||| Sbjct: 215 ttctcgtccgcgaacttctcgccgtagatgctcttgccgccggtgccgttgccttgggta 156 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaacg 537 ||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 155 aagtcgccgccctggagcatgaagttcgggatgacgcggtggaacg 110 Score = 93.7 bits (47), Expect = 6e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 296 gacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaa 355 ||||||||||||||| |||||||||||||||||||| | | | ||| ||| |||||| Sbjct: 351 gacctcgccgaagacgacgtgcttgccgtcgagccagtcggtgacgaccgtggtgatgaa 292 Query: 356 gaactgggagccgttggtgttgggcccggcgttggccat 394 |||||| ||||||||||||||| | |||||||||||||| Sbjct: 291 gaactgcgagccgttggtgttgcggccggcgttggccat 253
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 115 bits (58), Expect = 2e-22 Identities = 187/230 (81%) Strand = Plus / Minus Query: 287 gccctcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggt 346 |||||||| |||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 2720047 gccctcgagaacctcgccaaagacaacgtgcttgccgtcgagccagctggtaaccacggt 2719988 Query: 347 gcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccc 406 | |||||||||||||||||||||||||| | ||||||||||||||||| || | Sbjct: 2719987 ggtgatgaagaactgggagccgttggtgtctcggccggcgttggccatggacagcttgta 2719928 Query: 407 tggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactc 466 ||||||||||||||| | ||| |||||||||| |||||| ||||||||||||||| Sbjct: 2719927 aggcttggtgtgcttgagctggaagttctcgtcggggaactttcggccgtagatggactc 2719868 Query: 467 gccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagt 516 ||| || ||||||| || | ||||||||| ||||||||| |||||||| Sbjct: 2719867 gcctccagtgccgtctcctcgggtgaagtctccgccctggatcatgaagt 2719818
>gb|AY351891.1| Nothofagus cunninghamii clone ncutas20 microsatellite sequence Length = 778 Score = 113 bits (57), Expect = 6e-22 Identities = 72/77 (93%) Strand = Plus / Minus Query: 255 cccaccttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacg 314 ||||||||||||||| |||||||||||||| |||||||||||||| ||||||||| ||| Sbjct: 92 cccaccttctcgatggccttgacgacgtccaagccctcgacgacctggccgaagacgacg 33 Query: 315 tgcttgccgtcgagcca 331 ||||||||||||||||| Sbjct: 32 tgcttgccgtcgagcca 16
>gb|AF456323.1|AF456323 Glycine max cyclophilin (Cyp) mRNA, complete cds Length = 873 Score = 113 bits (57), Expect = 6e-22 Identities = 171/209 (81%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||| ||||||||||| || |||||||| ||| |||||||| |||||||||||||| Sbjct: 436 gtgcaaatgaagaactgagatccgttggttccgggaccggcgttcgccatggagaggatg 377 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || || ||||||||| | ||||| ||||||||||||||||| |||| || || ||| Sbjct: 376 ccgggaccggtgtgcttcttcacgaagttctcgtcggcgaacttggcgccataaatcgac 317 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 ||||||||||| ||||| || |||||||||||| ||||| |||||||| ||||| Sbjct: 316 tcgccgccggttccgtttccggcggtgaagtcgccaccctgacacatgaaactcgggatc 257 Query: 525 acgcggtggaacgagctgcccttgtagtg 553 ||||||||||| || |||||||||||| Sbjct: 256 acgcggtggaaggacgagcccttgtagtg 228 Score = 44.1 bits (22), Expect = 0.48 Identities = 61/74 (82%) Strand = Plus / Minus Query: 258 accttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgc 317 ||||||||||||| |||||| |||| || || |||| ||||| ||||| || || ||| Sbjct: 523 accttctcgatgtccttgacaacgttcaatccttcgatgacctgtccgaacacgacatgc 464 Query: 318 ttgccgtcgagcca 331 || ||||||||||| Sbjct: 463 tttccgtcgagcca 450
>emb|AJ862840.1| Streptomyces griseus subsp. griseus streptomycin gene cluster, strain DSM 40236 Length = 90600 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 |||||||||||||||||||||||||||||| || |||||||||||||| || | |||| Sbjct: 55983 ttctcgtcggcgaacttctcgccgtagatgctcttgccgccggtgccgtcaccgcgggtg 55924 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 |||||||||||||| ||||||||||| |||||| |||||||| Sbjct: 55923 aagtcgccgccctgaagcatgaagtcggtgatgacacggtggaa 55880 Score = 83.8 bits (42), Expect = 6e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 295 cgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatga 354 ||||||||||||||||||||||||||||||||||||| | | | || ||| || || Sbjct: 56120 cgacctcgccgaagaccacgtgcttgccgtcgagccacggggtgagcaccgtggtgacga 56061 Query: 355 agaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||| || ||||||||||| || |||||||||||||| ||||| Sbjct: 56060 agaactgcgaaccgttggtgttcggtccggcgttggccatcgagag 56015
>ref|XM_851866.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans isomerase E (PPIase E) (Rotamase E) (Cyclophilin E) (Cyclophilin 33), transcript variant 3 (LOC607232), mRNA Length = 1159 Score = 109 bits (55), Expect = 1e-20 Identities = 151/183 (82%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 ||||||||||||||| ||||||||||| || | ||||||||||||||| | ||||| Sbjct: 715 gaagaactgggagccattggtgttggggccagagttggccatggagagcaggcctggtcc 656 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||| ||| ||| || ||||| || ||||||||| ||||||||||||| ||| || Sbjct: 655 cgtgtgtttgaggataaagttctcatcatcgaacttcttcccgtagatggacttgccccc 596 Query: 473 ggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtg 532 |||||||||| | ||||| |||||||||||||||||||| | |||||||| |||||| Sbjct: 595 ggtgccgttgtggttcgtgaaatcgccgccctggcacatgaactgggggatgatgcggtg 536 Query: 533 gaa 535 ||| Sbjct: 535 gaa 533
>ref|XM_843646.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans isomerase E (PPIase E) (Rotamase E) (Cyclophilin E) (Cyclophilin 33), transcript variant 2 (LOC607232), mRNA Length = 1216 Score = 109 bits (55), Expect = 1e-20 Identities = 151/183 (82%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 ||||||||||||||| ||||||||||| || | ||||||||||||||| | ||||| Sbjct: 772 gaagaactgggagccattggtgttggggccagagttggccatggagagcaggcctggtcc 713 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||| ||| ||| || ||||| || ||||||||| ||||||||||||| ||| || Sbjct: 712 cgtgtgtttgaggataaagttctcatcatcgaacttcttcccgtagatggacttgccccc 653 Query: 473 ggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtg 532 |||||||||| | ||||| |||||||||||||||||||| | |||||||| |||||| Sbjct: 652 ggtgccgttgtggttcgtgaaatcgccgccctggcacatgaactgggggatgatgcggtg 593 Query: 533 gaa 535 ||| Sbjct: 592 gaa 590
>ref|XM_501664.1| Yarrowia lipolytica CLIB122, YALI0C09988g predicted mRNA Length = 531 Score = 109 bits (55), Expect = 1e-20 Identities = 160/195 (82%) Strand = Plus / Minus Query: 341 gacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||| || Sbjct: 387 gacggtggtgatgaaaaactgggagccgttggtgttggggccggcgttggccatggacag 328 Query: 401 gatccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagat 460 | || || ||||||||| | ||| |||||||||| |||||| | ||||||||| Sbjct: 327 cagaccgggtcgggtgtgcttcacgttgaagttctcgtcggggaacttttggccgtagat 268 Query: 461 ggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggg 520 |||| ||||||||| |||||| |||||||||| || |||||| ||| |||| ||| Sbjct: 267 agacttgccgccggtaccgttgtggttggtgaagtcaccaccctggagcataaagttggg 208 Query: 521 gatgacgcggtggaa 535 |||||| |||||||| Sbjct: 207 gatgactcggtggaa 193
>emb|Y08320.1|DLCYCLO D.lanata mRNA for cyclophilin Length = 765 Score = 109 bits (55), Expect = 1e-20 Identities = 160/195 (82%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||||||||| || || ||||| || || ||||| |||||||| |||| Sbjct: 416 cggtgcagatgaagaactgagatccattggttcccggtcctgcgttcgccatggacagga 357 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | ||||| |||||||| | ||||| |||||||| ||||| ||| |||||||||| | Sbjct: 356 ttcctggaccagtgtgcttcttcacgaagttctcgtccgcgaatttcgcgccgtagatag 297 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggga 522 | ||||| ||||||||||| || |||||||||||| |||||||||||||| |||||| Sbjct: 296 attcgcctccggtgccgtttccggcggtgaagtcgcctccctggcacatgaacccgggga 237 Query: 523 tgacgcggtggaacg 537 | |||||||| |||| Sbjct: 236 tcacgcggtgaaacg 222
>gb|DQ012958.1| Streptomyces antibioticus strain ATCC 11891 cyclophilin gene, partial cds Length = 457 Score = 109 bits (55), Expect = 1e-20 Identities = 94/107 (87%) Strand = Plus / Minus Query: 288 ccctcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtg 347 ||||||||||||||||||||||| |||||||||||||||||||| | | | ||| ||| Sbjct: 359 ccctcgacgacctcgccgaagacgacgtgcttgccgtcgagccagtcggtgacgaccgtg 300 Query: 348 cagatgaagaactgggagccgttggtgttgggcccggcgttggccat 394 |||||||||||| ||||||||||||||| | |||||||||||||| Sbjct: 299 gtgatgaagaactgcgagccgttggtgttgcggccggcgttggccat 253 Score = 107 bits (54), Expect = 4e-20 Identities = 97/109 (88%), Gaps = 3/109 (2%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctgg-- 489 |||||||| ||||||||||||||||||||| || |||||||||||||||| |||||| Sbjct: 215 ttctcgtccgcgaacttctcgccgtagatgctcttgccgccggtgccgttgaccctgggt 156 Query: 490 tg-aagtcgccgccctggcacatgaagtcggggatgacgcggtggaacg 537 || ||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 155 tgaaagtcgccgccctggagcatgaagttcgggatgacgcggtggaacg 107
>emb|AJ417659.1|POS417659 Pleurotus ostreatus partial mRNA for putative cyclophilin (cpa1 gene) Length = 595 Score = 107 bits (54), Expect = 4e-20 Identities = 126/150 (84%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 ||||||||| ||||||||||||||||| || |||||||||||||| || | || || Sbjct: 344 gatgaagaattgggagccgttggtgttcttgccagcgttggccatggaaagaagaccagg 285 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||||||||||| | ||| |||||||| ||||| ||||| ||||||||||||| || Sbjct: 284 cttggtgtgcttaagctggaagttctcgtctgcgaatttctctccgtagatggactttcc 225 Query: 470 gccggtgccgttgcccctggtgaagtcgcc 499 ||| |||||||||||| ||||||||||||| Sbjct: 224 gccagtgccgttgcccttggtgaagtcgcc 195 Score = 42.1 bits (21), Expect = 1.9 Identities = 39/45 (86%) Strand = Plus / Minus Query: 263 ctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaa 307 |||||| |||||||||| ||| | |||||||||||| || ||||| Sbjct: 431 ctcgatcttcttgacgatgtcaaagccctcgacgacttctccgaa 387
>dbj|AB231808.1| Malassezia dermatis CYP mRNA for cyclophilin, partial cds Length = 486 Score = 107 bits (54), Expect = 4e-20 Identities = 153/186 (82%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| ||||||||||||||||| || ||||||||||| || |||| || || Sbjct: 336 gatgaagaactgcgagccgttggtgttgggaccagcgttggccatcgaaaggagaccagg 277 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||| |||||||| | ||| |||||||| |||||||| | |||||||| |||| ||| Sbjct: 276 cttgttgtgcttgagctggaagttctcgtcagcgaacttggcaccgtagatcgacttgcc 217 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 || ||||||||||| ||||||||| || |||||| ||| ||||| ||||| || || Sbjct: 216 accagtgccgttgccagcggtgaagtcaccaccctggagcataaagtcagggatcacacg 157 Query: 530 gtggaa 535 |||||| Sbjct: 156 gtggaa 151 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 272 cttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 |||||| |||||||| ||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 414 cttgacaacgtccataccctcgacgacctcgccgaagacgacgtgcttgccgtccagcca 355
>ref|XM_676782.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8605.2), mRNA Length = 489 Score = 99.6 bits (50), Expect = 9e-18 Identities = 152/186 (81%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| ||||||||||||||| | |||||||||||||||||||||| || Sbjct: 336 gatgaagaactgagagccgttggtgttgcggccggcgttggccatggagaggaggtaagg 277 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 | || ||||||| | ||| |||||||| |||||||||| ||||||||||||| ||| Sbjct: 276 cctgtcgtgcttgagtgtgaagttctcgtcctcgaacttctcaccgtagatggacttgcc 217 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||| |||||||| | ||||||||| || |||||| |||||| | ||| ||||| || Sbjct: 216 gccagtgccgttctggcgggtgaagtcaccaccctggagcatgaactggggaatgacacg 157 Query: 530 gtggaa 535 |||||| Sbjct: 156 gtggaa 151
>gb|AF180337.1|AF180337 Filobasidiella neoformans var. neoformans cyclophilin A (CPA2) gene, complete cds Length = 1620 Score = 99.6 bits (50), Expect = 9e-18 Identities = 92/106 (86%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||||| | ||| ||| ||||||| Sbjct: 727 acctcaccgaagacgacgtgcttgccgtcgagccaagaggtaacgacagtggtgatgaag 668 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||||||||||||||| |||||||||||||||||||||| Sbjct: 667 aactgagagccgttggtgttgggaccggcgttggccatggagagga 622 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 435 tcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttg 482 |||||||||||||| | |||||||||||||| |||||| ||||||||| Sbjct: 589 tcgtcggcgaacttgttgccgtagatggacttgccgccagtgccgttg 542
>gb|AF180336.1|AF180336 Filobasidiella neoformans var. neoformans cyclophilin A (CPA1) gene, complete cds Length = 1298 Score = 99.6 bits (50), Expect = 9e-18 Identities = 92/106 (86%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||||| | ||| ||| ||||||| Sbjct: 642 acctcaccgaagacgacgtgcttgccgtcgagccaagaggtaacgacagtggtgatgaag 583 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||||||||||||||| |||||||||||||||||||||| Sbjct: 582 aactgagagccgttggtgttgggaccggcgttggccatggagagga 537 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttg 482 ||||||||||||||||| | ||||||||||||| |||||| ||||||||| Sbjct: 507 ttctcgtcggcgaacttgtttccgtagatggacttgccgccagtgccgttg 457
>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV, complete sequence Length = 1466886 Score = 99.6 bits (50), Expect = 9e-18 Identities = 95/110 (86%) Strand = Plus / Plus Query: 427 cgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccc 486 |||| |||||||| |||||||||||||||||||||||||||| || ||||||| ||| Sbjct: 867123 cgaagttctcgtcctcgaacttctcgccgtagatggactcgccacccgtgccgtcgccgt 867182 Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaac 536 |||||||||||||| ||||||||||||| | ||| |||||||||||| Sbjct: 867183 tggtgaagtcgccgaactggcacatgaagcccttgatcacgcggtggaac 867232 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccat 394 ||||||| |||| ||||||||||||||||| |||||||||||||| Sbjct: 867046 gatgaagcactgcgagccgttggtgttggggccggcgttggccat 867090 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Plus Query: 297 acctcgccgaagaccacgtgcttgccgtc 325 ||||||||||| || |||||||||||||| Sbjct: 866993 acctcgccgaacacgacgtgcttgccgtc 867021
>gb|AF025803.1|AF025803 Drosophila pseudoobscura cyclophilin 1 (Cyp1) mRNA, partial cds Length = 471 Score = 99.6 bits (50), Expect = 9e-18 Identities = 158/194 (81%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 |||||||| |||||||||||||| || |||||||||| || || |||||||| || || Sbjct: 353 acggtgcaaatgaagaactgggatccattggtgttggcgcccgcattggccatcgacaga 294 Query: 402 atccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatg 461 || || | ||||||||| | | ||| ||||| |||| |||||| | |||||||||| Sbjct: 293 atgccagtgccggtgtgcttcagcaggaagttctcatcggggaacttgttgccgtagatg 234 Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||| |||||||||||||||| ||||||||||||| || ||||||||||||| ||| Sbjct: 233 gacttgccgccggtgccgttgtggttggtgaagtcgcctccttggcacatgaagttggga 174 Query: 522 atgacgcggtggaa 535 || ||||| ||||| Sbjct: 173 ataacgcgatggaa 160 Score = 46.1 bits (23), Expect = 0.12 Identities = 44/51 (86%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 |||||||| | ||||| |||||| || |||||||||||||| || |||||| Sbjct: 425 ttcttgacaatgtccaagccctcaacaacctcgccgaagacaacatgcttg 375
>ref|NM_209536.1| Eremothecium gossypii ADR087Cp (ADR087C), mRNA Length = 1110 Score = 99.6 bits (50), Expect = 9e-18 Identities = 95/110 (86%) Strand = Plus / Minus Query: 427 cgaacttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccc 486 |||| |||||||| |||||||||||||||||||||||||||| || ||||||| ||| Sbjct: 295 cgaagttctcgtcctcgaacttctcgccgtagatggactcgccacccgtgccgtcgccgt 236 Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaac 536 |||||||||||||| ||||||||||||| | ||| |||||||||||| Sbjct: 235 tggtgaagtcgccgaactggcacatgaagcccttgatcacgcggtggaac 186 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccat 394 ||||||| |||| ||||||||||||||||| |||||||||||||| Sbjct: 372 gatgaagcactgcgagccgttggtgttggggccggcgttggccat 328 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtc 325 ||||||||||| || |||||||||||||| Sbjct: 425 acctcgccgaacacgacgtgcttgccgtc 397
>ref|XM_850619.1| PREDICTED: Canis familiaris peptidylprolyl isomerase A, transcript variant 3 (PPIA), mRNA Length = 702 Score = 97.6 bits (49), Expect = 4e-17 Identities = 139/169 (82%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 349 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 290 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||||||| | |||||||| |||||||||| Sbjct: 289 tgccaggccctgtgtgcttcaggatgaagttctcgtcatcaaacttctccccgtagatgg 230 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 ||| |||||| ||||| ||| | |||||||| || ||||||||||| Sbjct: 229 acttgccgccagtgccattgtgacgcgtgaagtccccaccctggcacat 181
>ref|XM_850591.1| PREDICTED: Canis familiaris peptidylprolyl isomerase A, transcript variant 2 (PPIA), mRNA Length = 655 Score = 97.6 bits (49), Expect = 4e-17 Identities = 139/169 (82%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 302 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 243 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||||||| | |||||||| |||||||||| Sbjct: 242 tgccaggccctgtgtgcttcaggatgaagttctcgtcatcaaacttctccccgtagatgg 183 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 ||| |||||| ||||| ||| | |||||||| || ||||||||||| Sbjct: 182 acttgccgccagtgccattgtgacgcgtgaagtccccaccctggcacat 134
>ref|XM_537928.2| PREDICTED: Canis familiaris peptidylprolyl isomerase A, transcript variant 1 (PPIA), mRNA Length = 735 Score = 97.6 bits (49), Expect = 4e-17 Identities = 139/169 (82%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 382 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 323 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||||||| | |||||||| |||||||||| Sbjct: 322 tgccaggccctgtgtgcttcaggatgaagttctcgtcatcaaacttctccccgtagatgg 263 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 ||| |||||| ||||| ||| | |||||||| || ||||||||||| Sbjct: 262 acttgccgccagtgccattgtgacgcgtgaagtccccaccctggcacat 214
>emb|CR720665.2|CNS0GJ0F Tetraodon nigroviridis full-length cDNA Length = 786 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 411 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 359 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 269 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 221
>emb|CR715907.2|CNS0GFCF Tetraodon nigroviridis full-length cDNA Length = 772 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 411 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 359 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 269 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 221
>emb|CR711184.2|CNS0GBP8 Tetraodon nigroviridis full-length cDNA Length = 771 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 411 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 359 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 269 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 221
>emb|CR708069.2|CNS0G9AP Tetraodon nigroviridis full-length cDNA Length = 772 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 411 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 359 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 269 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 221
>emb|CR706426.2|CNS0G812 Tetraodon nigroviridis full-length cDNA Length = 773 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 410 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 358 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 268 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 220
>emb|CR701424.2|CNS0G464 Tetraodon nigroviridis full-length cDNA Length = 783 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 412 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 360 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 270 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 222
>emb|CR691294.2|CNS0FWCQ Tetraodon nigroviridis full-length cDNA Length = 594 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 224 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 172 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 82 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 34
>emb|CR694759.2|CNS0FZ0Z Tetraodon nigroviridis full-length cDNA Length = 782 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 410 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 358 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 268 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 220
>emb|CR680454.2|CNS0FNZM Tetraodon nigroviridis full-length cDNA Length = 776 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 405 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 353 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 263 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 215
>emb|CR679705.2|CNS0FNET Tetraodon nigroviridis full-length cDNA Length = 769 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 398 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 346 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 256 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 208
>emb|CR679007.2|CNS0FMVF Tetraodon nigroviridis full-length cDNA Length = 679 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 308 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 256 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 166 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 118
>emb|CR672286.2|CNS0FHPG Tetraodon nigroviridis full-length cDNA Length = 781 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 410 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 358 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 268 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 220
>emb|CR664740.2|CNS0FBVU Tetraodon nigroviridis full-length cDNA Length = 778 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 407 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 355 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 265 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 217
>emb|CR663102.2|CNS0FAMC Tetraodon nigroviridis full-length cDNA Length = 784 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 411 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 359 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtgg 533 ||||||| || || |||||||||||||| | ||||||||||||||| Sbjct: 269 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtgg 223
>emb|CR660141.2|CNS0F8C3 Tetraodon nigroviridis full-length cDNA Length = 767 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 395 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 343 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 253 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 205
>emb|CR659051.2|CNS0F7HT Tetraodon nigroviridis full-length cDNA Length = 782 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 411 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 359 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 269 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 221
>emb|CR658192.2|CNS0F6TY Tetraodon nigroviridis full-length cDNA Length = 783 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 412 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 360 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 270 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 222
>emb|CR656960.2|CNS0F5VQ Tetraodon nigroviridis full-length cDNA Length = 694 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 323 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 271 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 181 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 133
>emb|CR653466.2|CNS0F36O Tetraodon nigroviridis full-length cDNA Length = 780 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 409 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 357 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 267 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 219
>emb|CR650031.2|CNS0F0J9 Tetraodon nigroviridis full-length cDNA Length = 781 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 410 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 358 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 268 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 220
>emb|CR646067.2|CNS0EXH5 Tetraodon nigroviridis full-length cDNA Length = 779 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 409 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 357 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 267 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 219
>emb|CR642611.2|CNS0EUT5 Tetraodon nigroviridis full-length cDNA Length = 780 Score = 97.6 bits (49), Expect = 4e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 410 gtgcagatgaagaactgggagccgttggtgttggggccggcgttggccatgga 358 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 268 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 220
>dbj|AB226263.1| Aspergillus oryzae cDNA, contig sequence: AoEST3122 Length = 1101 Score = 97.6 bits (49), Expect = 4e-17 Identities = 155/188 (82%), Gaps = 3/188 (1%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||||||||||||||||||||| || |||||||||||||| || | || || Sbjct: 618 gatgaagaactgggagccgttggtgttggggccagcgttggccatggaaagaagaccggg 559 Query: 410 cttggtgtgcttgtggac--gaacttctcgtcggcgaacttctcgccgtagatggactcg 467 |||| |||||||| || ||| ||||| || | ||||||||| ||||||||||||| Sbjct: 558 cttgttgtgcttg-aaacttgaagttctcatcagggaacttctcaccgtagatggactta 500 Query: 468 ccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacg 527 || || ||||||||||| | ||||||||| || |||||| ||| || ||||||||| Sbjct: 499 ccaccagtgccgttgccacgggtgaagtcacctccctggagcataaaactggggatgaca 440 Query: 528 cggtggaa 535 |||||||| Sbjct: 439 cggtggaa 432 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagcca 331 |||||||||||||| ||||||||||| |||||||| Sbjct: 671 acctcgccgaagacaacgtgcttgccatcgagcca 637
>gb|AF243140.1| Canis familiaris cyclophilin A mRNA, partial cds Length = 507 Score = 97.6 bits (49), Expect = 4e-17 Identities = 139/169 (82%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 325 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 266 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||||||| | |||||||| |||||||||| Sbjct: 265 tgccaggccctgtgtgcttcaggatgaagttctcgtcatcaaacttctccccgtagatgg 206 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 ||| |||||| ||||| ||| | |||||||| || ||||||||||| Sbjct: 205 acttgccgccagtgccattgtgacgcgtgaagtccccaccctggcacat 157
>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete sequence Length = 1519138 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 296 gacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaa 355 |||||||||||| ||||||||||| ||||| ||||| |||||| |||||| |||||| Sbjct: 930678 gacctcgccgaacaccacgtgcttcccgtcaagccatgggcagggcacggtggtgatgaa 930737 Query: 356 gaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||||| ||||||||||| | || ||||||||||||||||| Sbjct: 930738 gaactgggacccgttggtgttccggcccgcgttggccatggagag 930782
>ref|NM_210368.1| Eremothecium gossypii AER156Cp (AER156C), mRNA Length = 567 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 296 gacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaa 355 |||||||||||| ||||||||||| ||||| ||||| |||||| |||||| |||||| Sbjct: 462 gacctcgccgaacaccacgtgcttcccgtcaagccatgggcagggcacggtggtgatgaa 403 Query: 356 gaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||||| ||||||||||| | || ||||||||||||||||| Sbjct: 402 gaactgggacccgttggtgttccggcccgcgttggccatggagag 358
>ref|XM_586293.2| PREDICTED: Bos taurus similar to Peptidyl-prolyl cis-trans isomerase E (PPIase E) (Rotamase E) (Cyclophilin E) (Cyclophilin 33) (LOC509352), mRNA Length = 2522 Score = 95.6 bits (48), Expect = 1e-16 Identities = 159/196 (81%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||||||||||||||||||||| || |||| |||||||||||| || | ||||| Sbjct: 594 gaagaactgggagccgttggtgtttgggccggagttggccatggacagcaggcctggtcc 535 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||| ||| ||| || || || ||| | ||||||| ||||||||||||| ||| || Sbjct: 534 cgtgtgtttgaggataaagttttcatcgtcaaacttcttcccgtagatggacttgccccc 475 Query: 473 ggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtg 532 |||||| ||| ||||||| || ||||||||||||||||| | |||||||| |||||| Sbjct: 474 ggtgccattgtggttggtgaaatcaccgccctggcacatgaactgggggatgatgcggtg 415 Query: 533 gaacgagctgcccttg 548 ||| |||||||||| Sbjct: 414 gaaactgctgcccttg 399
>gb|DQ122910.1| Chlamydomonas incerta peptidylprolyl isomerase/cyclophilin-like protein mRNA, complete cds Length = 739 Score = 95.6 bits (48), Expect = 1e-16 Identities = 54/56 (96%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 458 acggtgcagatgaagaactgcgagccgttggtgttggggccggcgttggccatgga 403 Score = 81.8 bits (41), Expect = 2e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 451 cgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcaca 510 ||||||||||||||| |||||||||||||||||| ||||||||||||||||||| || Sbjct: 349 cgccgtagatggacttgccgccggtgccgttgccggcggtgaagtcgccgccctggatca 290 Query: 511 tgaagtcggggatgacgcggtggaa 535 |||| | ||||||||||||||| Sbjct: 289 tgaactgcttgatgacgcggtggaa 265
>gb|AF096318.1|AF096318 Aspergillus niger cyclophilin-like peptidyl prolyl cis-trans isomerase (cypA) gene, complete cds Length = 1600 Score = 95.6 bits (48), Expect = 1e-16 Identities = 81/92 (88%) Strand = Plus / Minus Query: 372 gtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaac 431 |||||||| || ||||||||||||||||||| || |||||| ||||||||| || ||| Sbjct: 1142 gtgttgggaccagcgttggccatggagaggagaccgggcttgttgtgcttgtagatgaag 1083 Query: 432 ttctcgtcggcgaacttctcgccgtagatgga 463 ||||| |||||||||||||| ||||||||||| Sbjct: 1082 ttctcatcggcgaacttctcaccgtagatgga 1051 Score = 54.0 bits (27), Expect = 5e-04 Identities = 63/75 (84%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||| ||||||||| | | |||||| ||||||| Sbjct: 1276 acctcaccgaagacgacgtgcttgccatcgagccaagaggtgacaacggtggtgatgaag 1217 Query: 357 aactgggagccgttg 371 ||||||||||||||| Sbjct: 1216 aactgggagccgttg 1202
>emb|AL115635.1|CNS01CKB Botrytis cinerea strain T4 cDNA library Length = 600 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 346 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 287 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 286 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 227 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 226 ggtaccgttgccacgggtgaagtc 203
>emb|AL116652.1|CNS01DCK Botrytis cinerea strain T4 cDNA library Length = 660 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 391 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 332 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 331 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 272 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 271 ggtaccgttgccacgggtgaagtc 248
>emb|AL116469.1|CNS01D7H Botrytis cinerea strain T4 cDNA library Length = 600 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 354 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 295 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 294 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 235 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 234 ggtaccgttgccacgggtgaagtc 211
>emb|AL116187.1|CNS01CZN Botrytis cinerea strain T4 cDNA library Length = 708 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 416 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 357 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 356 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 297 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 296 ggtaccgttgccacgggtgaagtc 273
>emb|AL115447.1|CNS01CF3 Botrytis cinerea strain T4 cDNA library Length = 660 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 404 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 345 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 344 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 285 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 284 ggtaccgttgccacgggtgaagtc 261
>emb|AL115226.1|CNS01C8Y Botrytis cinerea strain T4 cDNA library Length = 626 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 414 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 355 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 354 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 295 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 294 ggtaccgttgccacgggtgaagtc 271
>emb|AL112224.1|CNS019XK Botrytis cinerea strain T4 cDNA library Length = 696 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 419 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 360 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 359 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 300 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 299 ggtaccgttgccacgggtgaagtc 276
>emb|AL112374.1|CNS01A1Q Botrytis cinerea strain T4 cDNA library Length = 530 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 284 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 225 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 224 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 165 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 164 ggtaccgttgccacgggtgaagtc 141
>emb|AL112297.1|CNS019ZL Botrytis cinerea strain T4 cDNA library Length = 710 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 418 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 359 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 358 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 299 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 298 ggtaccgttgccacgggtgaagtc 275
>emb|AL111927.1|CNS019PB Botrytis cinerea strain T4 cDNA library Length = 756 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 400 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 341 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 340 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 281 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 280 ggtaccgttgccacgggtgaagtc 257
>emb|AL111642.1|CNS019HE Botrytis cinerea strain T4 cDNA library Length = 660 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 418 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 359 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 358 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 299 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 298 ggtaccgttgccacgggtgaagtc 275
>emb|AL111866.1|CNS019NM Botrytis cinerea strain T4 cDNA library Length = 576 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 295 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 236 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 235 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 176 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 175 ggtaccgttgccacgggtgaagtc 152
>emb|AL111458.1|CNS019CA Botrytis cinerea strain T4 cDNA library Length = 660 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 386 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 327 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 326 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 267 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 266 ggtaccgttgccacgggtgaagtc 243
>emb|AL111202.1|CNS01956 Botrytis cinerea strain T4 cDNA library Length = 636 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 414 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 355 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 354 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 295 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 294 ggtaccgttgccacgggtgaagtc 271
>emb|AL111165.1|CNS01946 Botrytis cinerea strain T4 cDNA library Length = 396 Score = 95.6 bits (48), Expect = 1e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 149 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 90 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 89 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 30 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 29 ggtaccgttgccacgggtgaagtc 6
>ref|NM_199957.1| Danio rerio peptidylprolyl isomerase A, like (ppial), mRNA Length = 822 Score = 95.6 bits (48), Expect = 1e-16 Identities = 81/92 (88%) Strand = Plus / Minus Query: 303 ccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgg 362 ||||| ||||||||||| ||||| ||||| ||| | | ||||||||||||||||||| Sbjct: 529 ccgaacaccacgtgcttaccgtccagccagttggtgtcggcggtgcagatgaagaactgc 470 Query: 363 gagccgttggtgttgggcccggcgttggccat 394 ||||||||||||||||| |||||||||||||| Sbjct: 469 gagccgttggtgttggggccggcgttggccat 438 Score = 63.9 bits (32), Expect = 5e-07 Identities = 71/84 (84%) Strand = Plus / Minus Query: 452 gccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 |||||||||||||| || ||||| |||||| ||||||| || |||||||| ||||| Sbjct: 380 gccgtagatggactttcctccggttccgttgtgattggtgaaatcaccgccctgacacat 321 Query: 512 gaagtcggggatgacgcggtggaa 535 ||| | |||||||||||||||||| Sbjct: 320 gaattgggggatgacgcggtggaa 297 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 198 tagagctggccgcagtcggcgatgacgacct 228 |||||||||||||||| |||||| ||||||| Sbjct: 634 tagagctggccgcagttggcgatcacgacct 604
>gb|BC071370.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone MGC:86688 IMAGE:6895545), complete cds Length = 784 Score = 95.6 bits (48), Expect = 1e-16 Identities = 81/92 (88%) Strand = Plus / Minus Query: 303 ccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgg 362 ||||| ||||||||||| ||||| ||||| ||| | | ||||||||||||||||||| Sbjct: 461 ccgaacaccacgtgcttaccgtccagccagttggtgtcggcggtgcagatgaagaactgc 402 Query: 363 gagccgttggtgttgggcccggcgttggccat 394 ||||||||||||||||| |||||||||||||| Sbjct: 401 gagccgttggtgttggggccggcgttggccat 370 Score = 63.9 bits (32), Expect = 5e-07 Identities = 71/84 (84%) Strand = Plus / Minus Query: 452 gccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 |||||||||||||| || ||||| |||||| ||||||| || |||||||| ||||| Sbjct: 312 gccgtagatggactttcctccggttccgttgtgattggtgaaatcaccgccctgacacat 253 Query: 512 gaagtcggggatgacgcggtggaa 535 ||| | |||||||||||||||||| Sbjct: 252 gaattgggggatgacgcggtggaa 229 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 198 tagagctggccgcagtcggcgatgacgacct 228 |||||||||||||||| |||||| ||||||| Sbjct: 566 tagagctggccgcagttggcgatcacgacct 536
>gb|BC059470.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone MGC:73102 IMAGE:4786094), complete cds Length = 822 Score = 95.6 bits (48), Expect = 1e-16 Identities = 81/92 (88%) Strand = Plus / Minus Query: 303 ccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgg 362 ||||| ||||||||||| ||||| ||||| ||| | | ||||||||||||||||||| Sbjct: 529 ccgaacaccacgtgcttaccgtccagccagttggtgtcggcggtgcagatgaagaactgc 470 Query: 363 gagccgttggtgttgggcccggcgttggccat 394 ||||||||||||||||| |||||||||||||| Sbjct: 469 gagccgttggtgttggggccggcgttggccat 438 Score = 63.9 bits (32), Expect = 5e-07 Identities = 71/84 (84%) Strand = Plus / Minus Query: 452 gccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 |||||||||||||| || ||||| |||||| ||||||| || |||||||| ||||| Sbjct: 380 gccgtagatggactttcctccggttccgttgtgattggtgaaatcaccgccctgacacat 321 Query: 512 gaagtcggggatgacgcggtggaa 535 ||| | |||||||||||||||||| Sbjct: 320 gaattgggggatgacgcggtggaa 297 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 198 tagagctggccgcagtcggcgatgacgacct 228 |||||||||||||||| |||||| ||||||| Sbjct: 634 tagagctggccgcagttggcgatcacgacct 604
>ref|XM_749773.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis-trans isomerase (Afu3g07430) partial mRNA Length = 492 Score = 93.7 bits (47), Expect = 6e-16 Identities = 158/195 (81%) Strand = Plus / Minus Query: 341 gacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 348 gacggtggtgatgaagaactgggagccgttggtgttcttgccggcgttggccatggagag 289 Query: 401 gatccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagat 460 | || |||||| |||||| | ||| ||||| || | |||| | || |||||||| Sbjct: 288 cagaccgggcttgtcgtgcttcagctggaagttctcatccgggaacctgtcaccgtagat 229 Query: 461 ggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggg 520 ||||| ||| || |||||||||||| ||||||| || || ||||| |||||| | ||| Sbjct: 228 ggacttgccaccagtgccgttgcccttggtgaaatcaccaccctgcagcatgaactgggg 169 Query: 521 gatgacgcggtggaa 535 ||||| ||||||||| Sbjct: 168 gatgatgcggtggaa 154
>emb|BX072404.1|CNS09S14 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 566 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Plus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 320 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 379 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 380 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 439 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 440 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 499 Query: 530 gtg 532 ||| Sbjct: 500 gtg 502
>emb|BX069873.1|CNS09Q2T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 511 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 452 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 451 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 392 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 391 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 332 Query: 530 gtg 532 ||| Sbjct: 331 gtg 329
>emb|BX014873.1|CNS08JN1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 518 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 459 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 458 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 399 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 398 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 339 Query: 530 gtg 532 ||| Sbjct: 338 gtg 336
>emb|BX011227.1|CNS08GTR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA17DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 810 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 507 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 448 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 447 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 388 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 387 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 328 Query: 530 gtg 532 ||| Sbjct: 327 gtg 325
>emb|BX008702.1|CNS08EVM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 505 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 446 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 445 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 386 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 385 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 326 Query: 530 gtg 532 ||| Sbjct: 325 gtg 323
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence Length = 1476513 Score = 93.7 bits (47), Expect = 6e-16 Identities = 154/187 (82%), Gaps = 2/187 (1%) Strand = Plus / Plus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||||||||||||||||||||| || ||||||||||| || | | ||||| Sbjct: 366113 gatgaagaactgggagccgttggtgttggggcccgcgttggccatcgacaacaaacctgg 366172 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||| |||||| | |||||| |||||||| | |||||| |||||||||| |||| ||| Sbjct: 366173 cttctcgtgcttcttgacgaagttctcgtctgggaacttgccgccgtagatcgacttgcc 366232 Query: 470 gccggtgccgttgcccctg-gtgaagtcgccgccctggcacatgaagtcggggatgacgc 528 ||| |||| | ||| || |||||||| |||||||| |||||||||| |||||||| | Sbjct: 366233 gcccacgccggt-cccgtgagtgaagtcaccgccctgcaacatgaagtcagggatgactc 366291 Query: 529 ggtggaa 535 |||||| Sbjct: 366292 tgtggaa 366298 Score = 46.1 bits (23), Expect = 0.12 Identities = 47/55 (85%) Strand = Plus / Plus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgt 324 |||||||| |||||||| |||||| ||||||||||| || |||||||| |||| Sbjct: 366033 ttcttgacaacgtccataccctcgctcacctcgccgaacacaacgtgcttaccgt 366087
>ref|XM_216524.3| PREDICTED: Rattus norvegicus peptidylprolyl isomerase E (cyclophilin E) (predicted) (Ppie_predicted), mRNA Length = 944 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 ||||||||||||||| |||||||| || || | |||||||||||||||| |||||| Sbjct: 784 gaagaactgggagccattggtgtttgggccagaattggccatggagaggaggcctggccc 725 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||| || ||| ||| || || || ||||||||| ||| |||||||||| ||| || Sbjct: 724 tgtgtgtttaaggatgaagttttcatcatcgaacttcttgccatagatggacttgccccc 665 Query: 473 ggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtg 532 ||||||||| | |||||||| ||||||||||||||||| | |||||||| |||||| Sbjct: 664 tgtgccgttgtggtttgtgaagtcaccgccctggcacatgaactgggggatgatgcggtg 605 Query: 533 gaa 535 ||| Sbjct: 604 gaa 602
>ref|XM_310632.2| Anopheles gambiae str. PEST ENSANGP00000020778 (ENSANGG00000018289), mRNA Length = 1289 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 826 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 767 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 766 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 707 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 706 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 647 Query: 530 gtg 532 ||| Sbjct: 646 gtg 644
>ref|NM_211552.1| Eremothecium gossypii AGL177Cp (AGL177C), mRNA Length = 489 Score = 93.7 bits (47), Expect = 6e-16 Identities = 154/187 (82%), Gaps = 2/187 (1%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||||||||||||||||||||| || ||||||||||| || | | ||||| Sbjct: 336 gatgaagaactgggagccgttggtgttggggcccgcgttggccatcgacaacaaacctgg 277 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||| |||||| | |||||| |||||||| | |||||| |||||||||| |||| ||| Sbjct: 276 cttctcgtgcttcttgacgaagttctcgtctgggaacttgccgccgtagatcgacttgcc 217 Query: 470 gccggtgccgttgcccctg-gtgaagtcgccgccctggcacatgaagtcggggatgacgc 528 ||| |||| | ||| || |||||||| |||||||| |||||||||| |||||||| | Sbjct: 216 gcccacgccggt-cccgtgagtgaagtcaccgccctgcaacatgaagtcagggatgactc 158 Query: 529 ggtggaa 535 |||||| Sbjct: 157 tgtggaa 151 Score = 46.1 bits (23), Expect = 0.12 Identities = 47/55 (85%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgt 324 |||||||| |||||||| |||||| ||||||||||| || |||||||| |||| Sbjct: 416 ttcttgacaacgtccataccctcgctcacctcgccgaacacaacgtgcttaccgt 362
>emb|AJ937743.1| Aspergillus fumigatus mRNA for cyclophilin (asp f 27 gene), strain ATCC 42202 Length = 492 Score = 93.7 bits (47), Expect = 6e-16 Identities = 158/195 (81%) Strand = Plus / Minus Query: 341 gacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 348 gacggtggtgatgaagaactgggagccgttggtgttcttgccggcgttggccatggagag 289 Query: 401 gatccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagat 460 | || |||||| |||||| | ||| ||||| || | |||| | || |||||||| Sbjct: 288 cagaccgggcttgtcgtgcttcagctggaagttctcatccgggaacctgtcaccgtagat 229 Query: 461 ggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggg 520 ||||| ||| || |||||||||||| ||||||| || || ||||| |||||| | ||| Sbjct: 228 ggacttgccaccagtgccgttgcccttggtgaaatcaccaccctgcagcatgaactgggg 169 Query: 521 gatgacgcggtggaa 535 ||||| ||||||||| Sbjct: 168 gatgatgcggtggaa 154
>emb|Y13576.1|LMCYCL Leishmania major mRNA for cyclophilin Length = 2165 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 452 gccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 |||||||||||||| |||||| ||||||||||| |||||||||| || ||||||||||| Sbjct: 397 gccgtagatggacttgccgccagtgccgttgccgttggtgaagtcaccaccctggcacat 338 Query: 512 gaagtcggggatgacgcggtggaacg 537 ||| || ||||| || |||||||||| Sbjct: 337 gaaatccgggatcacacggtggaacg 312
>dbj|AB231811.1| Malassezia nana CYP mRNA for cyclophilin, partial cds Length = 486 Score = 91.7 bits (46), Expect = 2e-15 Identities = 151/186 (81%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| ||||||||||||||||| |||||||| ||||| || || | || || Sbjct: 336 gatgaagaactgcgagccgttggtgttggggccggcgttcgccatcgacagcagaccagg 277 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||| |||||||| | ||| |||||||| |||||||| | |||||||| |||| ||| Sbjct: 276 cttgttgtgcttgagctggaagttctcgtcagcgaacttggcaccgtagatcgacttgcc 217 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 || ||||||||||| ||| ||||| || |||||| ||| ||||| ||||| || || Sbjct: 216 accagtgccgttgccagcggtaaagtcaccaccctggagcataaagtcagggatcacacg 157 Query: 530 gtggaa 535 |||||| Sbjct: 156 gtggaa 151 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 272 cttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 ||||||||||||||| || |||| |||||| || ||||| |||||||||||||||||||| Sbjct: 414 cttgacgacgtccataccttcgatgacctcaccaaagacgacgtgcttgccgtcgagcca 355
>gb|AF025804.1|AF025804 Drosophila subobscura cyclophilin 1 (Cyp1) mRNA, partial cds Length = 471 Score = 91.7 bits (46), Expect = 2e-15 Identities = 157/194 (80%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 |||||||| |||||||||||||| || |||||||||| || ||||||||||| || || Sbjct: 353 acggtgcaaatgaagaactgggatccattggtgttggcgcccgcgttggccatcgacaga 294 Query: 402 atccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatg 461 || || | ||||||||| | ||| ||||| ||||||||||| | |||||||||| Sbjct: 293 atgccagtgccggtgtgcttcagctggaagttctcatcggcgaacttgttgccgtagatg 234 Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||| |||||| ||||||||| |||||||||| || || ||||||||||||| ||| Sbjct: 233 gacttgccgccagtgccgttgtggttggtgaagtcacctccttggcacatgaagttggga 174 Query: 522 atgacgcggtggaa 535 || ||||| ||||| Sbjct: 173 ataacgcgatggaa 160
>gb|AY754447.1| Drosophila affinis cyclophylin 1 (Cyp1) gene, exons 1, 2 and partial cds Length = 1783 Score = 91.7 bits (46), Expect = 2e-15 Identities = 157/194 (80%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 |||||||| |||||||||||||| || |||||||||| || || |||||||| || || Sbjct: 1665 acggtgcaaatgaagaactgggatccattggtgttggcgcccgcattggccatcgacaga 1606 Query: 402 atccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatg 461 || || | ||||||||| | ||| ||||| |||| |||||| | |||||||||| Sbjct: 1605 atgccagtgccggtgtgcttcagctggaagttctcatcggggaacttgttgccgtagatg 1546 Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||| |||||| ||||||||| ||||||||||||| |||||||||||||||| ||| Sbjct: 1545 gacttgccgccagtgccgttgtggttggtgaagtcgcctccctggcacatgaagttggga 1486 Query: 522 atgacgcggtggaa 535 || ||||| ||||| Sbjct: 1485 ataacgcgatggaa 1472 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttg 320 |||||||| | ||||| ||||||||| |||||||||||||| ||||||||| Sbjct: 1737 ttcttgacaatgtccaggccctcgacaacctcgccgaagacaacgtgcttg 1687
>ref|XM_532723.2| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A isoform 1 (LOC608151), mRNA Length = 941 Score = 89.7 bits (45), Expect = 9e-15 Identities = 138/169 (81%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 574 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 515 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||||||| | |||||||| |||||||||| Sbjct: 514 tgccaggccctgtgtgcttcaggatgaagttctcgtcatcaaacttctccccgtagatgg 455 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 ||| ||| || ||||| ||| | |||||||| || ||||||||||| Sbjct: 454 acttgcctccagtgccattgtgacgcgtgaagtccccaccctggcacat 406
>emb|BX045917.1|CNS097LD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 791 Score = 89.7 bits (45), Expect = 9e-15 Identities = 105/121 (86%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 582 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 639 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 640 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 699 Query: 551 g 551 | Sbjct: 700 g 700
>emb|BX045916.1|CNS097LC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 89.7 bits (45), Expect = 9e-15 Identities = 104/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 427 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 369 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 368 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 309 Query: 551 g 551 | Sbjct: 308 g 308
>emb|BX032973.1|CNS08XLT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 89.7 bits (45), Expect = 9e-15 Identities = 105/121 (86%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 586 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 643 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 644 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 703 Query: 551 g 551 | Sbjct: 704 g 704
>emb|BX032972.1|CNS08XLS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1012 Score = 89.7 bits (45), Expect = 9e-15 Identities = 104/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 464 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 406 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 405 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 346 Query: 551 g 551 | Sbjct: 345 g 345
>emb|BX027426.1|CNS08TBQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 89.7 bits (45), Expect = 9e-15 Identities = 105/121 (86%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 516 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 573 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 574 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 633 Query: 551 g 551 | Sbjct: 634 g 634
>emb|BX027425.1|CNS08TBP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 89.7 bits (45), Expect = 9e-15 Identities = 104/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 403 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 345 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 344 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 285 Query: 551 g 551 | Sbjct: 284 g 284
>emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 89.7 bits (45), Expect = 9e-15 Identities = 105/121 (86%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 591 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 648 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 649 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 708 Query: 551 g 551 | Sbjct: 709 g 709
>emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 89.7 bits (45), Expect = 9e-15 Identities = 104/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 468 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 410 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 409 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 350 Query: 551 g 551 | Sbjct: 349 g 349
>emb|BX010692.1|CNS08GEW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 89.7 bits (45), Expect = 9e-15 Identities = 105/121 (86%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 604 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 661 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 662 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 721 Query: 551 g 551 | Sbjct: 722 g 722
>emb|BX010691.1|CNS08GEV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 89.7 bits (45), Expect = 9e-15 Identities = 104/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 465 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 407 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 406 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 347 Query: 551 g 551 | Sbjct: 346 g 346
>emb|AL111766.1|CNS019KU Botrytis cinerea strain T4 cDNA library Length = 660 Score = 89.7 bits (45), Expect = 9e-15 Identities = 121/145 (83%), Gaps = 1/145 (0%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttgg-tgttgggcccggcgttggccatggagaggatccctggct 411 |||||| ||||| ||||||| |||| ||||| ||||||||||||||||||| ||||| Sbjct: 420 gaagaattgggatccgttgggtgtttggcccagcgttggccatggagaggagacctggac 361 Query: 412 tggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgc 471 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || | Sbjct: 360 gggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccac 301 Query: 472 cggtgccgttgcccctggtgaagtc 496 |||| |||||||| | ||||||||| Sbjct: 300 cggtaccgttgccacgggtgaagtc 276
>ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257 (ENSANGG00000008768), mRNA Length = 1064 Score = 89.7 bits (45), Expect = 9e-15 Identities = 104/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 468 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 410 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 409 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 350 Query: 551 g 551 | Sbjct: 349 g 349
>gb|AY391451.1| Danio rerio peptidylprolyl isomerase A (PPIA-1) mRNA, complete cds Length = 743 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 303 ccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgg 362 ||||| ||||||||||| ||||| ||||| ||| | | ||||||| ||||||||||| Sbjct: 452 ccgaacaccacgtgcttaccgtccagccagttggtgtcggcggtgcaaatgaagaactgc 393 Query: 363 gagccgttggtgttgggcccggcgttggccat 394 ||||||||||||||||| |||||||||||||| Sbjct: 392 gagccgttggtgttggggccggcgttggccat 361 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 452 gccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 |||||||||||||| || ||||| |||||| |||| || || |||||||| ||||| Sbjct: 303 gccgtagatggactttcctccggttccgttgtgattggtaaaatcaccgccctgacacat 244 Query: 512 gaagtcggggatgacgcggtggaa 535 ||| | |||||||||||||||||| Sbjct: 243 gaattgggggatgacgcggtggaa 220 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 198 tagagctggccgcagtcggcgatgacgacct 228 |||||||||||||||| |||||| ||||||| Sbjct: 557 tagagctggccgcagttggcgatcacgacct 527
>ref|NM_194920.1| Oryza sativa (japonica cultivar-group) putative cyclophilin (OSJNAa0034B05.5), mRNA Length = 546 Score = 87.7 bits (44), Expect = 4e-14 Identities = 47/48 (97%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 393 gatgaagaactgggagccgttggtgttgggcccggcgttcgccatgga 346 Score = 63.9 bits (32), Expect = 5e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||||||||||||||||||| || |||| ||||||||||||||||||||| |||| Sbjct: 272 gactcgccgccggtgccgttcccggccgtgatgtcgccgccctggcacatgaacccgggc 213 Query: 522 atgacgcggtggaacg 537 | ||||||||||||| Sbjct: 212 accacgcggtggaacg 197
>gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0004E08, complete sequence Length = 158294 Score = 87.7 bits (44), Expect = 4e-14 Identities = 47/48 (97%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 9123 gatgaagaactgggagccgttggtgttgggcccggcgttcgccatgga 9076 Score = 63.9 bits (32), Expect = 5e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||||||||||||||||||| || |||| ||||||||||||||||||||| |||| Sbjct: 9002 gactcgccgccggtgccgttcccggccgtgatgtcgccgccctggcacatgaacccgggc 8943 Query: 522 atgacgcggtggaacg 537 | ||||||||||||| Sbjct: 8942 accacgcggtggaacg 8927 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||| ||||||||| ||||||||||||||| ||||||| ||||||| Sbjct: 16693 gatgatgaactgggaaccgttggtgttgggctcggcgttcaccatgga 16646
>ref|XM_956473.1| Neurospora crassa OR74A hypothetical protein (NCU01200.1) partial mRNA Length = 849 Score = 87.7 bits (44), Expect = 4e-14 Identities = 176/220 (80%) Strand = Plus / Minus Query: 287 gccctcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggt 346 |||||||| ||||||||||||||| ||||||||||| ||||||||| | | ||| || Sbjct: 498 gccctcgaggacctcgccgaagacgacgtgcttgccatcgagccaagaggtgatgacagt 439 Query: 347 gcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccc 406 | ||||||||||||||||||||||| | || ||||||||||| ||||||| || Sbjct: 438 ggtaatgaagaactgggagccgttggtatccttgccagcgttggccattgagaggagacc 379 Query: 407 tggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactc 466 ||||| ||||||| | ||| ||||| |||| |||||| || || |||||||||| Sbjct: 378 cttcttggagtgcttgagcttgaagttctcatcggggaacttgtcaccatagatggactt 319 Query: 467 gccgccggtgccgttgcccctggtgaagtcgccgccctgg 506 ||| |||||||| | |||| |||||||||| || |||||| Sbjct: 318 gccaccggtgccatcgcccttggtgaagtcaccaccctgg 279
>ref|XM_326692.1| Neurospora crassa OR74A hypothetical protein (NCU01200.1) partial mRNA Length = 849 Score = 87.7 bits (44), Expect = 4e-14 Identities = 176/220 (80%) Strand = Plus / Minus Query: 287 gccctcgacgacctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggt 346 |||||||| ||||||||||||||| ||||||||||| ||||||||| | | ||| || Sbjct: 498 gccctcgaggacctcgccgaagacgacgtgcttgccatcgagccaagaggtgatgacagt 439 Query: 347 gcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccc 406 | ||||||||||||||||||||||| | || ||||||||||| ||||||| || Sbjct: 438 ggtaatgaagaactgggagccgttggtatccttgccagcgttggccattgagaggagacc 379 Query: 407 tggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactc 466 ||||| ||||||| | ||| ||||| |||| |||||| || || |||||||||| Sbjct: 378 cttcttggagtgcttgagcttgaagttctcatcggggaacttgtcaccatagatggactt 319 Query: 467 gccgccggtgccgttgcccctggtgaagtcgccgccctgg 506 ||| |||||||| | |||| |||||||||| || |||||| Sbjct: 318 gccaccggtgccatcgcccttggtgaagtcaccaccctgg 279
>gb|AY029366.1| Felis catus cyclophilin A (cypA) mRNA, complete cds Length = 738 Score = 87.7 bits (44), Expect = 4e-14 Identities = 113/136 (83%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| || || |||||||| |||||||| |||||||| |||| Sbjct: 373 cggtgcagatgaaaaactgggaaccattcgtgttgggtccggcgttcgccatggacagga 314 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || || |||||||| ||| ||| ||||||||| | |||||||| |||||||||| Sbjct: 313 tgccaggacctgtgtgcttcaggatgaaattctcgtcgtcaaacttctccccgtagatgg 254 Query: 463 actcgccgccggtgcc 478 ||| ||| || ||||| Sbjct: 253 acttgcctccagtgcc 238
>ref|XM_853487.1| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A isoform 1, transcript variant 3 (LOC607390), mRNA Length = 728 Score = 87.7 bits (44), Expect = 4e-14 Identities = 113/136 (83%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 359 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 300 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| ||||| || | |||||||| |||||||||| Sbjct: 299 tgccaggccctgtgtgcttcaggatgaagttctcatcatcaaacttctccccgtagatgg 240 Query: 463 actcgccgccggtgcc 478 ||| |||||| ||||| Sbjct: 239 acttgccgccagtgcc 224
>ref|XM_853443.1| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A isoform 1, transcript variant 2 (LOC607390), mRNA Length = 680 Score = 87.7 bits (44), Expect = 4e-14 Identities = 113/136 (83%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 312 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 253 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| ||||| || | |||||||| |||||||||| Sbjct: 252 tgccaggccctgtgtgcttcaggatgaagttctcatcatcaaacttctccccgtagatgg 193 Query: 463 actcgccgccggtgcc 478 ||| |||||| ||||| Sbjct: 192 acttgccgccagtgcc 177
>ref|XM_844247.1| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A isoform 1, transcript variant 1 (LOC607390), mRNA Length = 760 Score = 87.7 bits (44), Expect = 4e-14 Identities = 113/136 (83%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 392 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 333 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| ||||| || | |||||||| |||||||||| Sbjct: 332 tgccaggccctgtgtgcttcaggatgaagttctcatcatcaaacttctccccgtagatgg 273 Query: 463 actcgccgccggtgcc 478 ||| |||||| ||||| Sbjct: 272 acttgccgccagtgcc 257
>emb|X74403.1|PVCYCGNA P.vulgaris gene for cyclophilin Length = 969 Score = 87.7 bits (44), Expect = 4e-14 Identities = 140/172 (81%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||||||||||||||| || |||||||| || ||||||||||||||||| || || Sbjct: 586 gtgcagatgaagaactgagatccgttggttccaggaccggcgttggccatggacagaatg 527 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || || ||||||||| | ||||| |||||||| |||||||| |||||||||| ||| Sbjct: 526 ccggggccggtgtgcttcttcacgaagttctcgtctgcgaacttggcgccgtagatcgac 467 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagt 516 ||||| || || ||||| || || ||||| ||||||||||||||||||| Sbjct: 466 tcgcctcctgtaccgtttccggcagtaaagtcaccgccctggcacatgaagt 415 Score = 83.8 bits (42), Expect = 6e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 258 accttctcgatgttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgc 317 ||||||||||| | ||| || ||||||| ||| |||||||||| ||||||||||||||| Sbjct: 673 accttctcgatatccttcaccacgtccaggccttcgacgacctgtccgaagaccacgtgc 614 Query: 318 ttgccgtcgagcca 331 |||||||||||||| Sbjct: 613 ttgccgtcgagcca 600
>gb|AC122145.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0034B05, complete sequence Length = 125655 Score = 87.7 bits (44), Expect = 4e-14 Identities = 47/48 (97%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 74778 gatgaagaactgggagccgttggtgttgggcccggcgttcgccatgga 74731 Score = 63.9 bits (32), Expect = 5e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||||||||||||||||||| || |||| ||||||||||||||||||||| |||| Sbjct: 74657 gactcgccgccggtgccgttcccggccgtgatgtcgccgccctggcacatgaacccgggc 74598 Query: 522 atgacgcggtggaacg 537 | ||||||||||||| Sbjct: 74597 accacgcggtggaacg 74582 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||| ||||||||| ||||||||||||||| ||||||| ||||||| Sbjct: 82348 gatgatgaactgggaaccgttggtgttgggctcggcgttcaccatgga 82301
>emb|AL117008.1|CNS01DMG Botrytis cinerea strain T4 cDNA library Length = 420 Score = 87.7 bits (44), Expect = 4e-14 Identities = 110/132 (83%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 137 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 78 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| ||||| |||||||||||||| |||||||| |||| || || Sbjct: 77 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagattgactttccacc 18 Query: 473 ggtgccgttgcc 484 ||| |||||||| Sbjct: 17 ggtaccgttgcc 6
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 87.7 bits (44), Expect = 4e-14 Identities = 47/48 (97%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 3417994 gatgaagaactgggagccgttggtgttgggcccggcgttcgccatgga 3417947 Score = 63.9 bits (32), Expect = 5e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||||||||||||||||||| || |||| ||||||||||||||||||||| |||| Sbjct: 3417873 gactcgccgccggtgccgttcccggccgtgatgtcgccgccctggcacatgaacccgggc 3417814 Query: 522 atgacgcggtggaacg 537 | ||||||||||||| Sbjct: 3417813 accacgcggtggaacg 3417798 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||| ||||||||| ||||||||||||||| ||||||| ||||||| Sbjct: 3425564 gatgatgaactgggaaccgttggtgttgggctcggcgttcaccatgga 3425517
>ref|NM_001009370.1| Felis catus peptidylprolyl isomerase A (PPIA), mRNA Length = 738 Score = 87.7 bits (44), Expect = 4e-14 Identities = 113/136 (83%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| || || |||||||| |||||||| |||||||| |||| Sbjct: 373 cggtgcagatgaaaaactgggaaccattcgtgttgggtccggcgttcgccatggacagga 314 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || || |||||||| ||| ||| ||||||||| | |||||||| |||||||||| Sbjct: 313 tgccaggacctgtgtgcttcaggatgaaattctcgtcgtcaaacttctccccgtagatgg 254 Query: 463 actcgccgccggtgcc 478 ||| ||| || ||||| Sbjct: 253 acttgcctccagtgcc 238
>dbj|AK058898.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-H03, full insert sequence Length = 927 Score = 87.7 bits (44), Expect = 4e-14 Identities = 47/48 (97%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 515 gatgaagaactgggagccgttggtgttgggcccggcgttcgccatgga 468 Score = 63.9 bits (32), Expect = 5e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||||||||||||||||||| || |||| ||||||||||||||||||||| |||| Sbjct: 394 gactcgccgccggtgccgttcccggccgtgatgtcgccgccctggcacatgaacccgggc 335 Query: 522 atgacgcggtggaacg 537 | ||||||||||||| Sbjct: 334 accacgcggtggaacg 319
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 87.7 bits (44), Expect = 4e-14 Identities = 47/48 (97%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 3417915 gatgaagaactgggagccgttggtgttgggcccggcgttcgccatgga 3417868 Score = 63.9 bits (32), Expect = 5e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 462 gactcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggg 521 |||||||||||||||||||| || |||| ||||||||||||||||||||| |||| Sbjct: 3417794 gactcgccgccggtgccgttcccggccgtgatgtcgccgccctggcacatgaacccgggc 3417735 Query: 522 atgacgcggtggaacg 537 | ||||||||||||| Sbjct: 3417734 accacgcggtggaacg 3417719 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||| ||||||||| ||||||||||||||| ||||||| ||||||| Sbjct: 3425485 gatgatgaactgggaaccgttggtgttgggctcggcgttcaccatgga 3425438
>ref|XM_445739.1| Candida glabrata CBS138, CAGL0E01177g partial mRNA Length = 489 Score = 85.7 bits (43), Expect = 1e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 303 ccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgg 362 |||||||| |||||||||||||| | ||| ||| || |||||| ||||||||| ||| Sbjct: 383 ccgaagactacgtgcttgccgtccaaccatgggcatggcacggtggtgatgaagaattgg 324 Query: 363 gagccgttggtgttgggcccggcgttggccatgga 397 |||||||||||||| || ||||||||||||||||| Sbjct: 323 gagccgttggtgtttggaccggcgttggccatgga 289
>ref|XM_852517.1| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A isoform 1, transcript variant 2 (LOC607403), mRNA Length = 704 Score = 85.7 bits (43), Expect = 1e-13 Identities = 103/123 (83%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 348 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 289 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||||||| | |||||||| |||||||||| Sbjct: 288 tgccaggccccgtgtgcttcaggatgaagttctcgtcatcaaacttctccccgtagatgg 229 Query: 463 act 465 ||| Sbjct: 228 act 226
>ref|XM_843869.1| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A isoform 1, transcript variant 1 (LOC607403), mRNA Length = 737 Score = 85.7 bits (43), Expect = 1e-13 Identities = 103/123 (83%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||||||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 381 cggtgcagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 322 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||||||| | |||||||| |||||||||| Sbjct: 321 tgccaggccccgtgtgcttcaggatgaagttctcgtcatcaaacttctccccgtagatgg 262 Query: 463 act 465 ||| Sbjct: 261 act 259
>emb|BX057302.1|CNS09GDM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 564 Score = 85.7 bits (43), Expect = 1e-13 Identities = 148/183 (80%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || || ||||| ||||| || ||||| || || Sbjct: 500 gatgaagaactgcgagccgttcgtgttcgggcccgcgttcgccatcgacaggatgcccgg 441 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 440 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 381 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 380 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 321 Query: 530 gtg 532 ||| Sbjct: 320 gtg 318
>emb|BX050608.1|CNS09B7O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 504 Score = 85.7 bits (43), Expect = 1e-13 Identities = 148/183 (80%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || || ||||| ||||| || ||||| || || Sbjct: 485 gatgaagaactgcgagccgttcgtgttcgggcccgcgttcgccatcgacaggatgcccgg 426 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 425 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 366 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||||| ||||| ||||| Sbjct: 365 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagttcgggatcacgcg 306 Query: 530 gtg 532 ||| Sbjct: 305 gtg 303
>emb|BX014874.1|CNS08JN2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA22BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 784 Score = 85.7 bits (43), Expect = 1e-13 Identities = 136/167 (81%) Strand = Plus / Plus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 610 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 669 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 670 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 729 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagt 516 ||||||||||||| | ||||||||| |||||||||||||||| Sbjct: 730 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaagt 776
>emb|BX006580.1|CNS08D8O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA11AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 85.7 bits (43), Expect = 1e-13 Identities = 148/183 (80%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||| ||||| || |||||||| ||||| || ||||| || || Sbjct: 505 gatgaagaactgcgagccgttcgtgttcgggccggcgttcgccatcgacaggatgcccgg 446 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||||| ||| ||| |||||||| ||||||| | ||||||||| || | ||| Sbjct: 445 gccggtgtgcttcaggatgaagttctcgtcctcgaacttgttgccgtagatcgatttgcc 386 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 ||||||||||||| | ||||||||| |||||||||||||| | ||||| ||||| Sbjct: 385 gccggtgccgttgtggttctggaagtcgcccccctggcacatgaaattcgggatcacgcg 326 Query: 530 gtg 532 ||| Sbjct: 325 gtg 323
>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence Length = 687501 Score = 85.7 bits (43), Expect = 1e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 303 ccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaagaactgg 362 |||||||| |||||||||||||| | ||| ||| || |||||| ||||||||| ||| Sbjct: 107507 ccgaagactacgtgcttgccgtccaaccatgggcatggcacggtggtgatgaagaattgg 107448 Query: 363 gagccgttggtgttgggcccggcgttggccatgga 397 |||||||||||||| || ||||||||||||||||| Sbjct: 107447 gagccgttggtgtttggaccggcgttggccatgga 107413
>gb|AF293848.1| Pyricularia grisea cyclophilin (CYP1) gene, complete cds; nuclear gene encoding mitochondrial and cytosolic products Length = 2215 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 372 gtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaac 431 |||||||| ||||||||||||||||| |||| || ||| ||||||||||| ||| Sbjct: 1196 gtgttggggccggcgttggccatggacaggagtccaggcctggtgtgcttgatctggaag 1137 Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgcc 478 ||||||||||| |||||||||||||||| ||||| ||| |||||||| Sbjct: 1136 ttctcgtcggcaaacttctcgccgtagacggacttgccaccggtgcc 1090 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 478 cgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| | ||||||||| ||||||||| ||||||||||||||||| |||||||| Sbjct: 1012 cgttgccacgggtgaagtcaccgccctggagcatgaagtcggggatgatacggtggaa 955 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtc 325 |||||||| ||||| |||||||||||||| Sbjct: 1371 acctcgccaaagacgacgtgcttgccgtc 1343
>ref|NM_166539.1| Drosophila melanogaster CG2852-RB, transcript variant B (CG2852), mRNA Length = 759 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Minus Query: 449 ctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggca 508 ||||||||||||||| ||||||||||||| |||| |||||||||| ||||||||| Sbjct: 268 ctcgccgtagatggagcgaccgccggtgccgtcgcccttggtgaagtcaccgccctggat 209 Query: 509 catgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 ||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 208 catgaagtccttgatgatgcggtggaacttgctgcccttgtag 166
>ref|NM_137851.2| Drosophila melanogaster CG2852-RA, transcript variant A (CG2852), mRNA Length = 887 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Minus Query: 449 ctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggca 508 ||||||||||||||| ||||||||||||| |||| |||||||||| ||||||||| Sbjct: 393 ctcgccgtagatggagcgaccgccggtgccgtcgcccttggtgaagtcaccgccctggat 334 Query: 509 catgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 ||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 333 catgaagtccttgatgatgcggtggaacttgctgcccttgtag 291
>gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, region 58E-59A, BAC clone BACR11M08, complete sequence Length = 169534 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Plus Query: 449 ctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggca 508 ||||||||||||||| ||||||||||||| |||| |||||||||| ||||||||| Sbjct: 41197 ctcgccgtagatggagcgaccgccggtgccgtcgcccttggtgaagtcaccgccctggat 41256 Query: 509 catgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 ||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 41257 catgaagtccttgatgatgcggtggaacttgctgcccttgtag 41299
>gb|AF139893.1|AF139893 Oryctolagus cuniculus cyclophilin 18 mRNA, complete cds Length = 682 Score = 85.7 bits (43), Expect = 1e-13 Identities = 136/167 (81%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 |||||||||||||||||||||||||| ||||||||||| ||||| |||||||| | ||| Sbjct: 400 gtgcagatgaagaactgggagccgtttgtgttgggcccagcgtttgccatggacaagatg 341 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 || || |||||||| | | ||| || || || |||||||||| || ||||||||| Sbjct: 340 ccaggacctgtgtgcttcagcaggaagttttcatcctcgaacttctctccatagatggac 281 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 | |||||||||||| ||| | |||||||| || ||||||||||| Sbjct: 280 ttgccgccggtgccattgtggcgtgtgaagtcaccaccctggcacat 234
>gb|BT021266.1| Drosophila melanogaster RE50843 full insert cDNA Length = 898 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Minus Query: 449 ctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggca 508 ||||||||||||||| ||||||||||||| |||| |||||||||| ||||||||| Sbjct: 393 ctcgccgtagatggagcgaccgccggtgccgtcgcccttggtgaagtcaccgccctggat 334 Query: 509 catgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 ||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 333 catgaagtccttgatgatgcggtggaacttgctgcccttgtag 291
>dbj|AK062540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-G01, full insert sequence Length = 749 Score = 85.7 bits (43), Expect = 1e-13 Identities = 97/115 (84%) Strand = Plus / Minus Query: 444 aacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccc 503 ||||||||||||||||| ||||||||||| |||||||||| || ||||| |||||| Sbjct: 380 aacttctcgccgtagatcgactcgccgcccatgccgttgccgtccgtaaagtcaccgccc 321 Query: 504 tggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtagtgcagcg 558 ||| ||| |||| |||||| | ||||||||| | ||||||||||||||| |||| Sbjct: 320 tggatcataaagttggggataatgcggtggaaagtgctgcccttgtagtggagcg 266 Score = 44.1 bits (22), Expect = 0.48 Identities = 43/50 (86%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccat 394 ||||| ||||| ||||| |||||||| ||||||| || ||||||||||| Sbjct: 479 gtgcaaatgaaaaactgcgagccgttcgtgttggcgccagcgttggccat 430
>gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66 of 73 of the complete sequence Length = 302225 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Plus Query: 449 ctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggca 508 ||||||||||||||| ||||||||||||| |||| |||||||||| ||||||||| Sbjct: 51679 ctcgccgtagatggagcgaccgccggtgccgtcgcccttggtgaagtcaccgccctggat 51738 Query: 509 catgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 ||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 51739 catgaagtccttgatgatgcggtggaacttgctgcccttgtag 51781
>gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 DS00837 (D87)), complete sequence Length = 81677 Score = 85.7 bits (43), Expect = 1e-13 Identities = 88/103 (85%) Strand = Plus / Minus Query: 449 ctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccctggca 508 ||||||||||||||| ||||||||||||| |||| |||||||||| ||||||||| Sbjct: 12870 ctcgccgtagatggagcgaccgccggtgccgtcgcccttggtgaagtcaccgccctggat 12811 Query: 509 catgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 ||||||||| ||||| |||||||||| ||||||||||||| Sbjct: 12810 catgaagtccttgatgatgcggtggaacttgctgcccttgtag 12768
>dbj|AB012947.1| Vicia faba vcCyP mRNA, complete cds Length = 829 Score = 85.7 bits (43), Expect = 1e-13 Identities = 154/191 (80%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||||||||||||||| || |||||||| ||| || ||||| |||||||| | ||| Sbjct: 414 gtgcagatgaagaactgagatccgttggttccgggtccagcgttcgccatggataagatt 355 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 ||||| ||||||||| | || ||| |||||||| |||||||| |||||||| || Sbjct: 354 cctggaccggtgtgcttcttgatgaagttctcgtcagcgaacttggaaccgtagatcgat 295 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 || || ||||||||||| || ||||||||| || |||||||||||||||| ||||| Sbjct: 294 tctcctccggtgccgtttccggcggtgaagtcacctccctggcacatgaagttagggatc 235 Query: 525 acgcggtggaa 535 || |||||||| Sbjct: 234 acacggtggaa 224
>dbj|AB062672.1| Magnaporthe grisea CYP1 gene for cyclophilin, complete cds Length = 1652 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 372 gtgttgggcccggcgttggccatggagaggatccctggcttggtgtgcttgtggacgaac 431 |||||||| ||||||||||||||||| |||| || ||| ||||||||||| ||| Sbjct: 895 gtgttggggccggcgttggccatggacaggagtccaggcctggtgtgcttgatctggaag 836 Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgcc 478 ||||||||||| |||||||||||||||| ||||| ||| |||||||| Sbjct: 835 ttctcgtcggcaaacttctcgccgtagacggacttgccaccggtgcc 789 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 478 cgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| | ||||||||| ||||||||| ||||||||||||||||| |||||||| Sbjct: 711 cgttgccacgggtgaagtcaccgccctggagcatgaagtcggggatgatacggtggaa 654 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtc 325 |||||||| ||||| |||||||||||||| Sbjct: 1070 acctcgccaaagacgacgtgcttgccgtc 1042
>ref|XM_362521.1| Magnaporthe grisea 70-15 hypothetical protein (MG08104.4) partial mRNA Length = 1131 Score = 83.8 bits (42), Expect = 6e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgccc 485 ||||||||| | |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 305 ttctcgtcgtcaaacttctcgccgtagatggactcgccgccggtaccgttgccc 252
>ref|XM_744411.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis-trans isomerase (Afu2g03720) partial mRNA Length = 618 Score = 83.8 bits (42), Expect = 6e-13 Identities = 150/186 (80%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||||||||| || || |||||||||||||||||||| || Sbjct: 453 gatgaagaactgagagccgttggtgttaggaccagcgttggccatggagaggataccctt 394 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||| ||||||| || ||| ||||||||||| || || || ||||| || || || Sbjct: 393 cttgtcgtgcttgcggctgaagttctcgtcggcaaatttgtctccgtaaatagagcgacc 334 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 || ||||| ||||| | |||||||| || |||||| |||||||| |||||||| ||| Sbjct: 333 accagtgccattgcctcgagtgaagtcaccaccctggatcatgaagttggggatgatgcg 274 Query: 530 gtggaa 535 |||||| Sbjct: 273 gtggaa 268
>ref|XM_568801.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A (CNB01290) partial mRNA Length = 591 Score = 83.8 bits (42), Expect = 6e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||||| | ||||||| ||||||| Sbjct: 491 acctcaccgaagacgacgtgcttgccgtcgagccaagaggtaacgacggtggtgatgaag 432 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||| ||||||||||| || ||||| ||||||||||||| Sbjct: 431 aactgagagccattggtgttgggaccagcgttagccatggagagga 386 Score = 79.8 bits (40), Expect = 9e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||||||||||||||| | |||||||||||||| |||||| ||||||||| ||||| Sbjct: 356 ttctcgtcggcgaacttgttgccgtagatggacttgccgccagtgccgttgtggttggtg 297 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||| || |||||| |||||| | |||||| || |||||||| Sbjct: 296 aagtcaccaccctggagcatgaactgggggatcactcggtggaa 253
>emb|CR680608.2|CNS0FO3W Tetraodon nigroviridis full-length cDNA Length = 764 Score = 83.8 bits (42), Expect = 6e-13 Identities = 52/54 (96%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgtt-gggcccggcgttggccatgga 397 |||||||||||||||||||||||||||||||| ||| ||||||||||||||||| Sbjct: 393 gtgcagatgaagaactgggagccgttggtgttgggggccggcgttggccatgga 340 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||| || || |||||||||||||| | ||||||||||||||||| Sbjct: 250 tggtgaaatcacctccctggcacatgaactgagggatgacgcggtggaa 202
>emb|AJ006689.2|AFU6689 Aspergillus fumigatus mRNA for rAsp f 11 allergen Length = 675 Score = 83.8 bits (42), Expect = 6e-13 Identities = 150/186 (80%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 |||||||||||| |||||||||||||| || || |||||||||||||||||||| || Sbjct: 372 gatgaagaactgagagccgttggtgttaggaccagcgttggccatggagaggataccctt 313 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 |||| ||||||| || ||| ||||||||||| || || || ||||| || || || Sbjct: 312 cttgtcgtgcttgcggctgaagttctcgtcggcaaatttgtctccgtaaatagagcgacc 253 Query: 470 gccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcg 529 || ||||| ||||| | |||||||| || |||||| |||||||| |||||||| ||| Sbjct: 252 accagtgccattgcctcgagtgaagtcaccaccctggatcatgaagttggggatgatgcg 193 Query: 530 gtggaa 535 |||||| Sbjct: 192 gtggaa 187
>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete sequence Length = 1632307 Score = 83.8 bits (42), Expect = 6e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||||| | ||||||| ||||||| Sbjct: 394619 acctcaccgaagacgacgtgcttgccgtcgagccaagaggtaacgacggtggtgatgaag 394560 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||| ||||||||||| || ||||| ||||||||||||| Sbjct: 394559 aactgagagccattggtgttgggaccagcgttagccatggagagga 394514 Score = 69.9 bits (35), Expect = 8e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttg 482 ||||||||||||||||| | |||||||||||||| |||||| ||||||||| Sbjct: 394484 ttctcgtcggcgaacttgttgccgtagatggacttgccgccagtgccgttg 394434 Score = 69.9 bits (35), Expect = 8e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttg 482 ||||||||||||||||| | |||||||||||||| |||||| ||||||||| Sbjct: 372666 ttctcgtcggcgaacttgttgccgtagatggacttgccgccagtgccgttg 372716 Score = 67.9 bits (34), Expect = 3e-08 Identities = 88/106 (83%) Strand = Plus / Plus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||| | ||||||| ||||||| Sbjct: 372531 acctcaccgaagacacagtgcttgccgtcgagccaagaggtaacgacggtggtgatgaag 372590 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||| ||||||||||| || ||||| ||||||||||||| Sbjct: 372591 aactgagagccattggtgttgggaccagcgttagccatggagagga 372636
>gb|AF333997.1|AF333997 Filobasidiella neoformans var. neoformans cyclophilin A (CPA2) gene, complete cds Length = 762 Score = 83.8 bits (42), Expect = 6e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||||| | ||||||| ||||||| Sbjct: 612 acctcaccgaagacgacgtgcttgccgtcgagccaagaggtaacgacggtggtgatgaag 553 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||| ||||||||||| || ||||| ||||||||||||| Sbjct: 552 aactgagagccattggtgttgggaccagcgttagccatggagagga 507 Score = 69.9 bits (35), Expect = 8e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttg 482 ||||||||||||||||| | |||||||||||||| |||||| ||||||||| Sbjct: 477 ttctcgtcggcgaacttgttgccgtagatggacttgccgccagtgccgttg 427
>gb|AF333996.1|AF333996 Filobasidiella neoformans var. neoformans cyclophilin A (CPA1) gene, complete cds Length = 716 Score = 83.8 bits (42), Expect = 6e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||||| | ||||||| ||||||| Sbjct: 566 acctcaccgaagacgacgtgcttgccgtcgagccaagaggtaacgacggtggtgatgaag 507 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||| ||||||||||| || ||||| ||||||||||||| Sbjct: 506 aactgagagccattggtgttgggaccagcgttagccatggagagga 461 Score = 69.9 bits (35), Expect = 8e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttg 482 ||||||||||||||||| | |||||||||||||| |||||| ||||||||| Sbjct: 431 ttctcgtcggcgaacttgttgccgtagatggacttgccgccagtgccgttg 381
>gb|AY440343.1| Armigeres subalbatus ASAP ID: 39123 cyclophilin-type peptidy-prolyl cis-trans isomerase mRNA sequence Length = 903 Score = 81.8 bits (41), Expect = 2e-12 Identities = 110/133 (82%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctgg 409 ||||||||||||||| |||||||| ||||| ||||||||||||||||| | ||| || || Sbjct: 667 gatgaagaactgggatccgttggtattgggtccggcgttggccatggacatgataccggg 608 Query: 410 cttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgcc 469 ||||||| ||| ||| ||||| || ||||||| | |||||||||||||| ||| Sbjct: 607 accggtgtgccgcaggatgaagttctcatcctcgaacttgttgccgtagatggacttgcc 548 Query: 470 gccggtgccgttg 482 |||||||||||| Sbjct: 547 tccggtgccgttg 535
>ref|XM_366921.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein (MG02997.4) partial mRNA Length = 480 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccc 406 |||||||||||| ||||||||||||||||||||||||||||||||| |||||||| Sbjct: 315 gatgaagaactgactgccgttggtgttgggcccggcgttggccatggacaggatccc 259
>ref|XM_533873.2| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A isoform 1 (LOC609903), mRNA Length = 738 Score = 81.8 bits (41), Expect = 2e-12 Identities = 137/169 (81%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 |||| |||||||| |||||||| ||||| |||||||| || |||||||||||||| | || Sbjct: 372 cggtacagatgaaaaactgggaaccgtttgtgttgggtccagcgttggccatggacaaga 313 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | || ||| |||||||| ||| ||| |||| ||| | |||||||| |||||||||| Sbjct: 312 tgccaggccccgtgtgcttcaggatgaagttcttgtcatcaaacttctccccgtagatgg 253 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacat 511 ||| |||||| ||||| ||| | |||||||| || ||||||||||| Sbjct: 252 acttgccgccagtgccattgtgacgcgtgaagtccccaccctggcacat 204
>ref|XM_848021.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans isomerase, mitochondrial precursor (PPIase) (Rotamase) (Cyclophilin F) (LOC610502), mRNA Length = 1374 Score = 81.8 bits (41), Expect = 2e-12 Identities = 56/61 (91%) Strand = Plus / Minus Query: 342 acggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagg 401 |||||||||||||||||||||||||||||||||||||| || || || |||||||| ||| Sbjct: 311 acggtgcagatgaagaactgggagccgttggtgttggggcctgcatttgccatggacagg 252 Query: 402 a 402 | Sbjct: 251 a 251 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaag 515 ||||||||||||| |||||||||||||| Sbjct: 166 tggtgaagtcgcccgcctggcacatgaag 138
>ref|XM_501918.1| Yarrowia lipolytica CLIB122, YALI0C16775g predicted mRNA Length = 1104 Score = 81.8 bits (41), Expect = 2e-12 Identities = 44/45 (97%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccat 394 |||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 363 gatgaagaactgcgagccgttggtgttgggcccggcgttggccat 319 Score = 56.0 bits (28), Expect = 1e-04 Identities = 61/72 (84%) Strand = Plus / Minus Query: 434 ctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaa 493 |||||| | ||||||||| |||||||||||||| || ||||| |||||||| |||||| Sbjct: 279 ctcgtcagggaacttctccccgtagatggactctcctccggtaccgttgccagcggtgaa 220 Query: 494 gtcgccgccctg 505 ||| || ||||| Sbjct: 219 gtctcctccctg 208
>emb|BX053495.1|CNS09DFV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/121 (85%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||| ||| ||| |||| Sbjct: 357 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgtcgtctcccttggt 414 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 415 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 474 Query: 551 g 551 | Sbjct: 475 g 475
>emb|BX053494.1|CNS09DFU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 81.8 bits (41), Expect = 2e-12 Identities = 103/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||| ||| ||| |||| Sbjct: 458 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgtcgtctcccttggt 400 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 399 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 340 Query: 551 g 551 | Sbjct: 339 g 339
>emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 81.8 bits (41), Expect = 2e-12 Identities = 103/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 454 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 396 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||| ||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 395 gaagtcaccgccttggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 336 Query: 551 g 551 | Sbjct: 335 g 335
>emb|BX043476.1|CNS095PK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/121 (85%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||| ||| ||| |||| Sbjct: 357 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgtcgtctcccttggt 414 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 415 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 474 Query: 551 g 551 | Sbjct: 475 g 475
>emb|BX043545.1|CNS095RH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/121 (85%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 ||||||||||||||| |||||||||||| || ||| ||||||||| ||| ||| |||| Sbjct: 357 ttctcgtcggcgaacg-ctcgccgtagatcga-tcgtccgccggtgtcgtctcccttggt 414 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 415 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 474 Query: 551 g 551 | Sbjct: 475 g 475
>emb|BX043544.1|CNS095RG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 81.8 bits (41), Expect = 2e-12 Identities = 103/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||| ||| ||| |||| Sbjct: 477 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgtcgtctcccttggt 419 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 418 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 359 Query: 551 g 551 | Sbjct: 358 g 358
>emb|BX025264.1|CNS08RNO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 667 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/121 (85%), Gaps = 3/121 (2%) Strand = Plus / Plus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 357 ttctcgtcggcgaagg-ctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 414 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||||||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 415 gaagtcaccgccctggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 474 Query: 551 g 551 | Sbjct: 475 g 475
>emb|BX025263.1|CNS08RNN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 81.8 bits (41), Expect = 2e-12 Identities = 103/121 (85%), Gaps = 2/121 (1%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcg-ccgccggtgccgttgcccctggt 490 |||||||||||||| |||||||||||| || ||| ||||||||||||| ||| |||| Sbjct: 445 ttctcgtcggcgaagcgctcgccgtagatcga-tcgtccgccggtgccgtctcccttggt 387 Query: 491 gaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgta 550 |||||| ||||| ||| |||||||||| |||| || ||||||||| |||||||||||| Sbjct: 386 gaagtcaccgccgtggatcatgaagtcgcggatcacccggtggaacttgctgcccttgta 327 Query: 551 g 551 | Sbjct: 326 g 326
>gb|AF182826.1| Drosophila melanogaster cyclophilin-33 (cyp33) mRNA, complete cds Length = 945 Score = 81.8 bits (41), Expect = 2e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 443 gaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgcc 502 |||||| | ||| |||||||||| |||||||||||| ||| |||||||||||||||| Sbjct: 661 gaactttttgccatagatggacttgccgccggtgccattgttgttggtgaagtcgccgcc 602 Query: 503 ctggcacatgaagtcggggatgacgcggtggaacgagctgcccttgtag 551 |||||||| || ||||| || ||||||||||| |||| ||| |||||| Sbjct: 601 ttggcacataaactcgggtatcacgcggtggaaggagcagcctttgtag 553
>emb|AL116618.1|CNS01DBM Botrytis cinerea strain T4 cDNA library Length = 720 Score = 81.8 bits (41), Expect = 2e-12 Identities = 118/144 (81%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || | ||||||||||||||||||| ||||| Sbjct: 419 gaagaattgggatccgttggtgtttggtcaagcgttggccatggagaggagacctggacg 360 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | |||| |||| |||||||||||||| |||||||| |||| || || Sbjct: 359 ggtgtgctttcgctcgaagttctnatcggcgaacttctcaccgtagattgactttccacc 300 Query: 473 ggtgccgttgcccctggtgaagtc 496 ||| |||||||| | ||||||||| Sbjct: 299 ggtaccgttgccacgggtgaagtc 276
>ref|XM_568796.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A (CNB01230) partial mRNA Length = 620 Score = 79.8 bits (40), Expect = 9e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||||||||||||||| | |||||||||||||| |||||| ||||||||| ||||| Sbjct: 305 ttctcgtcggcgaacttgttgccgtagatggacttgccgccagtgccgttgtggttggtg 246 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||| || |||||| |||||| | |||||| || |||||||| Sbjct: 245 aagtcaccaccctggagcatgaactgggggatcactcggtggaa 202 Score = 67.9 bits (34), Expect = 3e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagccaattgcaggggacggtgcagatgaag 356 ||||| |||||||| ||||||||||||||||||| | ||||||| ||||||| Sbjct: 440 acctcaccgaagacacagtgcttgccgtcgagccaagaggtaacgacggtggtgatgaag 381 Query: 357 aactgggagccgttggtgttgggcccggcgttggccatggagagga 402 ||||| ||||| ||||||||||| || ||||| ||||||||||||| Sbjct: 380 aactgagagccattggtgttgggaccagcgttagccatggagagga 335
>gb|AY232181.1| Drosophila yakuba clone yak-ad_CG2852 mRNA sequence Length = 417 Score = 79.8 bits (40), Expect = 9e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 468 ccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacg 527 ||||||||||||| |||| |||||||||| ||||||||| ||||||||| ||||| | Sbjct: 299 ccgccggtgccgtcgcccttggtgaagtcaccgccctggatcatgaagtccttgatgatg 240 Query: 528 cggtggaacgagctgcccttgtag 551 ||||||||| ||||||||||||| Sbjct: 239 cggtggaacttgctgcccttgtag 216
>dbj|AB231809.1| Malassezia globosa CYP mRNA for cyclophilin, partial cds Length = 486 Score = 79.8 bits (40), Expect = 9e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 272 cttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 ||||||||||| |||||| || || |||||||||||||| |||||||||||||||||||| Sbjct: 414 cttgacgacgttcatgccatcaacaacctcgccgaagacgacgtgcttgccgtcgagcca 355 Score = 65.9 bits (33), Expect = 1e-07 Identities = 147/185 (79%) Strand = Plus / Minus Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggc 410 ||||||||||| || |||||||||||||| || ||||| ||||| || || | || ||| Sbjct: 335 atgaagaactgcgaaccgttggtgttggggcccgcgttagccatcgatagaagaccaggc 276 Query: 411 ttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccg 470 || | ||||||| | ||| ||||| ||||| ||||| | ||||||||| |||| ||| Sbjct: 275 ttcgagtgcttgagctggaagttctcatcggcaaacttttggccgtagatcgacttgcca 216 Query: 471 ccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcgg 530 || |||||||| || |||||||| |||||||| |||||||||||| || || ||| Sbjct: 215 ccagtgccgttcccagccgtgaagtcaccgccctgaagcatgaagtcgggaatcacacgg 156 Query: 531 tggaa 535 ||||| Sbjct: 155 tggaa 151
>gb|U68268.1|TCU68268 Trypanosoma congolense cyclophilin A (cypA) mRNA, complete cds Length = 1179 Score = 79.8 bits (40), Expect = 9e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 444 aacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgccc 503 ||||||||||||||||| || | |||||| ||||||||| | ||||||||||| ||| Sbjct: 368 aacttctcgccgtagatagatttgccgcccgtgccgttgtgacgagtgaagtcgccaccc 309 Query: 504 tggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||| |||||||| ||| ||||| Sbjct: 308 tggcacatgaagttggggatgatgcgatggaa 277 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 354 aagaactgggagccgttggtgttgggcccggcgttggccatggagag 400 |||||||| ||||||||||||||||| || ||||| ||||||||||| Sbjct: 467 aagaactgtgagccgttggtgttggggcccgcgttcgccatggagag 421 Score = 48.1 bits (24), Expect = 0.031 Identities = 48/56 (85%) Strand = Plus / Minus Query: 276 acgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 ||||||| |||||| |||| |||| ||| || |||||||| |||||||||||||| Sbjct: 545 acgacgttcatgccatcgagcacctggccaaaaaccacgtgtttgccgtcgagcca 490
>emb|AL116509.1|CNS01D8L Botrytis cinerea strain T4 cDNA library Length = 360 Score = 79.8 bits (40), Expect = 9e-12 Identities = 91/108 (84%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 110 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 51 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagat 460 ||||||||| | |||| ||||| |||||||||||||| |||||||| Sbjct: 50 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagat 3
>emb|AL114644.1|CNS01BSS Botrytis cinerea strain T4 cDNA library Length = 360 Score = 79.8 bits (40), Expect = 9e-12 Identities = 91/108 (84%) Strand = Plus / Minus Query: 353 gaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatccctggctt 412 |||||| ||||| ||||||||||| || || ||||||||||||||||||| ||||| Sbjct: 112 gaagaattgggatccgttggtgtttggtccagcgttggccatggagaggagacctggacg 53 Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagat 460 ||||||||| | |||| ||||| |||||||||||||| |||||||| Sbjct: 52 ggtgtgctttcgctcgaagttctcatcggcgaacttctcaccgtagat 5
>gb|AF158368.1|AF158368 Leishmania donovani cyclophilin (CYP) gene, complete cds Length = 945 Score = 79.8 bits (40), Expect = 9e-12 Identities = 88/104 (84%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 |||||||| |||||||| ||||||||||| |||| |||||| ||||| | | ||||| Sbjct: 586 ttctcgtccgcgaacttttcgccgtagatcgacttgccgcccgtgccatcgaagttggtg 527 Query: 492 aagtcgccgccctggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||||| |||||||| |||||||||||||||| Sbjct: 526 aagtcgccgccctggatcatgaagttttggatgacgcggtggaa 483 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 |||||||||||| |||||||| |||||||| |||||||| |||||||| Sbjct: 665 gatgaagaactgcgagccgtttgtgttggggccggcgtttgccatgga 618
>gb|AY594335.1| Bos taurus cyclophilin F mRNA, complete cds Length = 640 Score = 77.8 bits (39), Expect = 3e-11 Identities = 54/59 (91%) Strand = Plus / Minus Query: 344 ggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 |||||| ||||||||||||||||||||||||||||| || || ||||||||||| |||| Sbjct: 477 ggtgcaaatgaagaactgggagccgttggtgttggggcccgcattggccatggacagga 419 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaag 515 |||||||||| ||| |||||||||||||| Sbjct: 334 tggtgaagtcaccggcctggcacatgaag 306
>ref|XM_785050.1| PREDICTED: Strongylocentrotus purpuratus similar to Peptidyl-prolyl cis-trans isomerase, mitochondrial precursor (PPIase) (Rotamase) (Cyclophilin F) (LOC585216), mRNA Length = 847 Score = 77.8 bits (39), Expect = 3e-11 Identities = 153/191 (80%) Strand = Plus / Minus Query: 345 gtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagaggatc 404 ||||||||||| ||||| || || ||||||||||| || ||||| ||||| || ||| | Sbjct: 569 gtgcagatgaaaaactgtgatccattggtgttgggtccagcgttagccattgacagggtt 510 Query: 405 cctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggac 464 ||||||| |||||||| | ||| ||||| ||||| |||||||| ||||||||| | Sbjct: 509 cctggctcagtgtgcttcagagtgaagttctcatcggcaaacttctctccgtagatgctc 450 Query: 465 tcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatg 524 | || || |||||||||||| | |||||||| || || ||||||||||| | |||||| Sbjct: 449 tttccaccagtgccgttgcccttagtgaagtccccaccttggcacatgaactttgggatg 390 Query: 525 acgcggtggaa 535 || || ||||| Sbjct: 389 acacgatggaa 379
>ref|NM_001001597.1| Bos taurus cyclophilin F (LOC414346), mRNA Length = 640 Score = 77.8 bits (39), Expect = 3e-11 Identities = 54/59 (91%) Strand = Plus / Minus Query: 344 ggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 |||||| ||||||||||||||||||||||||||||| || || ||||||||||| |||| Sbjct: 477 ggtgcaaatgaagaactgggagccgttggtgttggggcccgcattggccatggacagga 419 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 487 tggtgaagtcgccgccctggcacatgaag 515 |||||||||| ||| |||||||||||||| Sbjct: 334 tggtgaagtcaccggcctggcacatgaag 306
>gb|DQ237913.1| Oryctolagus cuniculus cyclophilin C mRNA, partial cds Length = 837 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatg 395 |||||||||||||||||||||||||| ||||||||| ||||||||| Sbjct: 330 gatgaagaactgggagccgttggtgtcgggcccggcattggccatg 285 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 303 ccgaagaccacgtgcttgccgtc 325 ||||||||||||||||||||||| Sbjct: 377 ccgaagaccacgtgcttgccgtc 355
>gb|AY391452.1| Danio rerio 2-peptidylprolyl isomerase A (PPIA-2) mRNA, complete cds Length = 1005 Score = 75.8 bits (38), Expect = 1e-10 Identities = 106/126 (84%), Gaps = 2/126 (1%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 ||||||| ||| |||| |||||| || |||| || ||||| |||||||||||||| ||| Sbjct: 683 ttcttgatgacatccaagccctccacaacctgtccaaagacaacgtgcttgccgtccagc 624 Query: 330 ca-attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgtt 388 || || | ||| | ||||||||||||||||||||||||||||||||||| || || || Sbjct: 623 catgatgtaaggg-ctgtgcagatgaagaactgggagccgttggtgttggggccagcatt 565 Query: 389 ggccat 394 |||||| Sbjct: 564 ggccat 559
>ref|XM_823088.1| Trypanosoma brucei TREU927 cyclophilin A (Tb11.03.0250) partial mRNA Length = 534 Score = 75.8 bits (38), Expect = 1e-10 Identities = 104/126 (82%) Strand = Plus / Minus Query: 272 cttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 |||||||||||||||||| || | |||| |||||||| ||||| |||||||| ||||| Sbjct: 459 cttgacgacgtccatgccttcaagcacctgaccgaagacgacgtgtttgccgtcaagcca 400 Query: 332 attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggc 391 | ||| | ||||| |||||||||||||| ||||| |||||||| || |||||||| Sbjct: 399 ctgagtgggagccgtgcaaatgaagaactgggaaccgttcgtgttggggccagcgttggc 340 Query: 392 catgga 397 |||||| Sbjct: 339 catgga 334
>gb|AY325152.1| Rattus norvegicus Ab1-210 mRNA, complete cds Length = 814 Score = 75.8 bits (38), Expect = 1e-10 Identities = 80/94 (85%) Strand = Plus / Minus Query: 442 cgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtgaagtcgccgc 501 ||||||||| ||| |||||||||| ||| || ||||||||| | |||||||| |||| Sbjct: 698 cgaacttcttgccatagatggacttgccccctgtgccgttgtggtttgtgaagtcaccgc 639 Query: 502 cctggcacatgaagtcggggatgacgcggtggaa 535 ||||||||||||| | |||||||| ||||||||| Sbjct: 638 cctggcacatgaactgggggatgatgcggtggaa 605
>gb|BC100002.1| Danio rerio peptidylprolyl isomerase A (cyclophilin A), mRNA (cDNA clone MGC:110094 IMAGE:7284149), complete cds Length = 980 Score = 75.8 bits (38), Expect = 1e-10 Identities = 106/126 (84%), Gaps = 2/126 (1%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 ||||||| ||| |||| |||||| || |||| || ||||| |||||||||||||| ||| Sbjct: 657 ttcttgatgacatccaagccctccacaacctgtccaaagacaacgtgcttgccgtccagc 598 Query: 330 ca-attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgtt 388 || || | ||| | ||||||||||||||||||||||||||||||||||| || || || Sbjct: 597 catgatgtaaggg-ctgtgcagatgaagaactgggagccgttggtgttggggccagcatt 539 Query: 389 ggccat 394 |||||| Sbjct: 538 ggccat 533
>gb|U68270.1|TBU68270 Trypanosoma brucei brucei cyclophilin A (cypA) mRNA, complete cds Length = 1087 Score = 75.8 bits (38), Expect = 1e-10 Identities = 104/126 (82%) Strand = Plus / Minus Query: 272 cttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagcca 331 |||||||||||||||||| || | |||| |||||||| ||||| |||||||| ||||| Sbjct: 537 cttgacgacgtccatgccttcaagcacctgaccgaagacgacgtgtttgccgtcaagcca 478 Query: 332 attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggc 391 | ||| | ||||| |||||||||||||| ||||| |||||||| || |||||||| Sbjct: 477 ctgagtgggagccgtgcaaatgaagaactgggaaccgttcgtgttggggccagcgttggc 418 Query: 392 catgga 397 |||||| Sbjct: 417 catgga 412
>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I, complete sequence Length = 691920 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 488 ggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacg 537 ||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct: 250018 ggtgaagtcgccgccctggatcatgaagttggggatgacgcggtggaacg 250067 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Plus Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||| ||||||||||||| | | ||| |||||||||||| Sbjct: 249881 atgaagaactgcgagccgttggtgtcgcggccgcggttggccatgga 249927 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 303 ccgaagaccacgtgcttgccgtcg 326 ||||||||||||| |||||||||| Sbjct: 421788 ccgaagaccacgttcttgccgtcg 421811
>ref|NM_212758.1| Danio rerio peptidylprolyl isomerase A (cyclophilin A) (ppia), mRNA Length = 965 Score = 75.8 bits (38), Expect = 1e-10 Identities = 106/126 (84%), Gaps = 2/126 (1%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 ||||||| ||| |||| |||||| || |||| || ||||| |||||||||||||| ||| Sbjct: 643 ttcttgatgacatccaagccctccacaacctgtccaaagacaacgtgcttgccgtccagc 584 Query: 330 ca-attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgtt 388 || || | ||| | ||||||||||||||||||||||||||||||||||| || || || Sbjct: 583 catgatgtaaggg-ctgtgcagatgaagaactgggagccgttggtgttggggccagcatt 525 Query: 389 ggccat 394 |||||| Sbjct: 524 ggccat 519
>gb|AF242312.1|AF242312 Euphorbia esula cyclophilin mRNA, partial cds Length = 695 Score = 75.8 bits (38), Expect = 1e-10 Identities = 104/126 (82%) Strand = Plus / Minus Query: 413 ggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgcc 472 ||||||||| | || ||| ||||||||||||||||| | |||||||| || ||||| || Sbjct: 266 ggtgtgcttcttgatgaagttctcgtcggcgaacttagctccgtagatcgattcgcctcc 207 Query: 473 ggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtg 532 ||||||||| || ||||| ||||| || ||||||||||| | ||||| |||||||| Sbjct: 206 ggtgccgtttccggcagtgaaatcgcctccttggcacatgaatccagggatcacgcggtg 147 Query: 533 gaacga 538 |||||| Sbjct: 146 gaacga 141
>ref|NM_207839.1| Eremothecium gossypii AAL056Cp (AAL056C), mRNA Length = 612 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Minus Query: 488 ggtgaagtcgccgccctggcacatgaagtcggggatgacgcggtggaacg 537 ||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct: 267 ggtgaagtcgccgccctggatcatgaagttggggatgacgcggtggaacg 218 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Minus Query: 351 atgaagaactgggagccgttggtgttgggcccggcgttggccatgga 397 ||||||||||| ||||||||||||| | | ||| |||||||||||| Sbjct: 404 atgaagaactgcgagccgttggtgtcgcggccgcggttggccatgga 358
>gb|BC062863.1| Danio rerio peptidylprolyl isomerase A (cyclophilin A), mRNA (cDNA clone IMAGE:7002384), partial cds Length = 1591 Score = 75.8 bits (38), Expect = 1e-10 Identities = 106/126 (84%), Gaps = 2/126 (1%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 ||||||| ||| |||| |||||| || |||| || ||||| |||||||||||||| ||| Sbjct: 482 ttcttgatgacatccaagccctccacaacctgtccaaagacaacgtgcttgccgtccagc 423 Query: 330 ca-attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgtt 388 || || | ||| | ||||||||||||||||||||||||||||||||||| || || || Sbjct: 422 catgatgtaaggg-ctgtgcagatgaagaactgggagccgttggtgttggggccagcatt 364 Query: 389 ggccat 394 |||||| Sbjct: 363 ggccat 358
>gb|BC059458.1| Danio rerio peptidylprolyl isomerase A (cyclophilin A), mRNA (cDNA clone IMAGE:4199657), partial cds Length = 831 Score = 75.8 bits (38), Expect = 1e-10 Identities = 106/126 (84%), Gaps = 2/126 (1%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 ||||||| ||| |||| |||||| || |||| || ||||| |||||||||||||| ||| Sbjct: 480 ttcttgatgacatccaagccctccacaacctgtccaaagacaacgtgcttgccgtccagc 421 Query: 330 ca-attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgtt 388 || || | ||| | ||||||||||||||||||||||||||||||||||| || || || Sbjct: 420 catgatgtaaggg-ctgtgcagatgaagaactgggagccgttggtgttggggccagcatt 362 Query: 389 ggccat 394 |||||| Sbjct: 361 ggccat 356
>gb|BC049009.1| Danio rerio peptidylprolyl isomerase A (cyclophilin A), mRNA (cDNA clone IMAGE:5604178), partial cds Length = 822 Score = 75.8 bits (38), Expect = 1e-10 Identities = 106/126 (84%), Gaps = 2/126 (1%) Strand = Plus / Minus Query: 270 ttcttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc 329 ||||||| ||| |||| |||||| || |||| || ||||| |||||||||||||| ||| Sbjct: 501 ttcttgatgacatccaagccctccacaacctgtccaaagacaacgtgcttgccgtccagc 442 Query: 330 ca-attgcaggggacggtgcagatgaagaactgggagccgttggtgttgggcccggcgtt 388 || || | ||| | ||||||||||||||||||||||||||||||||||| || || || Sbjct: 441 catgatgtaaggg-ctgtgcagatgaagaactgggagccgttggtgttggggccagcatt 383 Query: 389 ggccat 394 |||||| Sbjct: 382 ggccat 377
>ref|XM_656326.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3814.2), mRNA Length = 519 Score = 73.8 bits (37), Expect = 5e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 350 gatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 |||||||||||||||||||||||||||||| || ||||| |||||||| |||| Sbjct: 354 gatgaagaactgggagccgttggtgttggggccagcgttagccatggaaagga 302 Score = 46.1 bits (23), Expect = 0.12 Identities = 32/35 (91%) Strand = Plus / Minus Query: 297 acctcgccgaagaccacgtgcttgccgtcgagcca 331 ||||| |||||||| ||||||||||| |||||||| Sbjct: 407 acctcaccgaagacaacgtgcttgccatcgagcca 373 Score = 42.1 bits (21), Expect = 1.9 Identities = 69/85 (81%) Strand = Plus / Minus Query: 432 ttctcgtcggcgaacttctcgccgtagatggactcgccgccggtgccgttgcccctggtg 491 ||||| ||||| ||||| |||||||||||||| ||||| || |||||||| | ||| Sbjct: 272 ttctcatcggcaaacttgtcgccgtagatggagcgaccgccagtaccgttgccacgagtg 213 Query: 492 aagtcgccgccctggcacatgaagt 516 ||||| || |||||| |||||||| Sbjct: 212 aagtcaccaccctggagcatgaagt 188
>gb|AY392408.1| Thellungiella halophila cyclophilin mRNA, complete cds Length = 760 Score = 73.8 bits (37), Expect = 5e-10 Identities = 154/193 (79%) Strand = Plus / Minus Query: 343 cggtgcagatgaagaactgggagccgttggtgttgggcccggcgttggccatggagagga 402 |||| |||||||| ||||| || || |||||||||| || ||||| ||||||||||| | Sbjct: 426 cggtacagatgaaaaactgagatccattggtgttggcaccagcgttagccatggagagaa 367 Query: 403 tccctggcttggtgtgcttgtggacgaacttctcgtcggcgaacttctcgccgtagatgg 462 | ||||| ||||||||| | | ||| |||||||| ||| ||| ||||||||| | Sbjct: 366 tacctggaccggtgtgcttcttggtgaagttctcgtccttgaatttcatgccgtagatcg 307 Query: 463 actcgccgccggtgccgttgcccctggtgaagtcgccgccctggcacatgaagtcgggga 522 ||||||| ||||| ||||| || ||||||| || || ||||| |||||||| | ||||| Sbjct: 306 actcgcctccggttccgtttcctttggtgaaatctcctccctgacacatgaatttgggga 247 Query: 523 tgacgcggtggaa 535 | || |||||||| Sbjct: 246 tcacacggtggaa 234 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,844,661 Number of Sequences: 3902068 Number of extensions: 2844661 Number of successful extensions: 60623 Number of sequences better than 10.0: 1089 Number of HSP's better than 10.0 without gapping: 1084 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 54496 Number of HSP's gapped (non-prelim): 5927 length of query: 558 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 535 effective length of database: 17,143,297,704 effective search space: 9171664271640 effective search space used: 9171664271640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
