| Clone Name | rbags28c03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC004875.2| Homo sapiens PAC clone RP4-745K6 from 7, complete sequence Length = 130607 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 tattcacaccccaagcaaca 173 |||||||||||||||||||| Sbjct: 18321 tattcacaccccaagcaaca 18302
>gb|AY790256.1| Trichinella spiralis newborn larvae-specific DNase II-3 mRNA, complete cds Length = 1259 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 40 gataacaattattgagatg 58 ||||||||||||||||||| Sbjct: 60 gataacaattattgagatg 42
>emb|BX323464.18| Zebrafish DNA sequence from clone CH211-93E11 in linkage group 12, complete sequence Length = 167058 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 41 ataacaattattgagatgt 59 ||||||||||||||||||| Sbjct: 36719 ataacaattattgagatgt 36701
>gb|AC000117.1| Homo sapiens BAC clone CTB-62A19 from 7, complete sequence Length = 110384 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 41 ataacaattattgagatgt 59 ||||||||||||||||||| Sbjct: 97703 ataacaattattgagatgt 97721
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 40 gataacaattattgagatg 58 ||||||||||||||||||| Sbjct: 4610241 gataacaattattgagatg 4610223
>emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on chromosome 1 Contains a novel gene and the 3' end of a variant of novel gene (MGC22773), complete sequence Length = 169434 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 139 atgtgtttctttctctatt 157 ||||||||||||||||||| Sbjct: 137080 atgtgtttctttctctatt 137062
>emb|AL627168.10| Zebrafish DNA sequence from clone RP71-1M12 in linkage group 24 Contains a gene for a novel trypsin inhibitor, a novel gene similar to human GDAP1 (ganglioside-induced differentiation-associated protein 1), a gene for a novel protein similar to vertebrate junctophilins and three CpG islands, complete sequence Length = 180922 Score = 38.2 bits (19), Expect = 9.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 139 atgtgtttctttctctattcaca 161 |||||||||||||||| |||||| Sbjct: 6117 atgtgtttctttctctgttcaca 6139
>emb|BX005299.9| Zebrafish DNA sequence from clone CH211-107C24, complete sequence Length = 163047 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 144 tttctttctctattcacac 162 ||||||||||||||||||| Sbjct: 158925 tttctttctctattcacac 158943
>gb|AC155884.2| Medicago truncatula chromosome 2 BAC clone mth2-10d10, complete sequence Length = 79222 Score = 38.2 bits (19), Expect = 9.7 Identities = 22/23 (95%) Strand = Plus / Plus Query: 145 ttctttctctattcacaccccaa 167 ||||||| ||||||||||||||| Sbjct: 16873 ttctttcactattcacaccccaa 16895
>gb|AE017195.1| Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence Length = 208369 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 ttaacgataacaattattg 53 ||||||||||||||||||| Sbjct: 172190 ttaacgataacaattattg 172172
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 38.2 bits (19), Expect = 9.7 Identities = 21/22 (95%) Strand = Plus / Minus Query: 48 ttattgagatgtgangttatca 69 |||||||||||||| ||||||| Sbjct: 2732355 ttattgagatgtgaagttatca 2732334
>gb|AC172892.1| Mus musculus BAC clone RP23-269B2 from chromosome 16, complete sequence Length = 206740 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 141 gtgtttctttctctattca 159 ||||||||||||||||||| Sbjct: 194206 gtgtttctttctctattca 194224 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,528,398 Number of Sequences: 3902068 Number of extensions: 1528398 Number of successful extensions: 91671 Number of sequences better than 10.0: 12 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 91634 Number of HSP's gapped (non-prelim): 37 length of query: 196 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 174 effective length of database: 17,147,199,772 effective search space: 2983612760328 effective search space used: 2983612760328 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)