ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags28c03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC004875.2| Homo sapiens PAC clone RP4-745K6 from 7, complete... 40 2.5
2gb|AY790256.1| Trichinella spiralis newborn larvae-specific DNas... 38 9.7
3emb|BX323464.18| Zebrafish DNA sequence from clone CH211-93E11 i... 38 9.7
4gb|AC000117.1| Homo sapiens BAC clone CTB-62A19 from 7, complete... 38 9.7
5gb|CP000316.1| Polaromonas sp. JS666, complete genome 38 9.7
6emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on ch... 38 9.7
7emb|AL627168.10| Zebrafish DNA sequence from clone RP71-1M12 in ... 38 9.7
8emb|BX005299.9| Zebrafish DNA sequence from clone CH211-107C24, ... 38 9.7
9gb|AC155884.2| Medicago truncatula chromosome 2 BAC clone mth2-1... 38 9.7
10gb|AE017195.1| Bacillus cereus ATCC 10987 plasmid pBc10987, comp... 38 9.7
11emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 38 9.7
12gb|AC172892.1| Mus musculus BAC clone RP23-269B2 from chromosome... 38 9.7

>gb|AC004875.2| Homo sapiens PAC clone RP4-745K6 from 7, complete sequence
          Length = 130607

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   tattcacaccccaagcaaca 173
             ||||||||||||||||||||
Sbjct: 18321 tattcacaccccaagcaaca 18302



to top

>gb|AY790256.1| Trichinella spiralis newborn larvae-specific DNase II-3 mRNA,
          complete cds
          Length = 1259

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 40 gataacaattattgagatg 58
          |||||||||||||||||||
Sbjct: 60 gataacaattattgagatg 42



to top

>emb|BX323464.18| Zebrafish DNA sequence from clone CH211-93E11 in linkage group 12,
             complete sequence
          Length = 167058

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 41    ataacaattattgagatgt 59
             |||||||||||||||||||
Sbjct: 36719 ataacaattattgagatgt 36701



to top

>gb|AC000117.1| Homo sapiens BAC clone CTB-62A19 from 7, complete sequence
          Length = 110384

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 41    ataacaattattgagatgt 59
             |||||||||||||||||||
Sbjct: 97703 ataacaattattgagatgt 97721



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 40      gataacaattattgagatg 58
               |||||||||||||||||||
Sbjct: 4610241 gataacaattattgagatg 4610223



to top

>emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on chromosome 1 Contains a
              novel gene and the 3' end of a variant of novel gene
              (MGC22773), complete sequence
          Length = 169434

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 139    atgtgtttctttctctatt 157
              |||||||||||||||||||
Sbjct: 137080 atgtgtttctttctctatt 137062



to top

>emb|AL627168.10| Zebrafish DNA sequence from clone RP71-1M12 in linkage group 24
            Contains a gene for a novel trypsin inhibitor, a novel
            gene similar to human GDAP1 (ganglioside-induced
            differentiation-associated protein 1), a gene for a novel
            protein similar to vertebrate junctophilins and three CpG
            islands, complete sequence
          Length = 180922

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 139  atgtgtttctttctctattcaca 161
            |||||||||||||||| ||||||
Sbjct: 6117 atgtgtttctttctctgttcaca 6139



to top

>emb|BX005299.9| Zebrafish DNA sequence from clone CH211-107C24, complete sequence
          Length = 163047

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 144    tttctttctctattcacac 162
              |||||||||||||||||||
Sbjct: 158925 tttctttctctattcacac 158943



to top

>gb|AC155884.2| Medicago truncatula chromosome 2 BAC clone mth2-10d10, complete
             sequence
          Length = 79222

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 145   ttctttctctattcacaccccaa 167
             ||||||| |||||||||||||||
Sbjct: 16873 ttctttcactattcacaccccaa 16895



to top

>gb|AE017195.1| Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence
          Length = 208369

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 35     ttaacgataacaattattg 53
              |||||||||||||||||||
Sbjct: 172190 ttaacgataacaattattg 172172



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 48      ttattgagatgtgangttatca 69
               |||||||||||||| |||||||
Sbjct: 2732355 ttattgagatgtgaagttatca 2732334



to top

>gb|AC172892.1| Mus musculus BAC clone RP23-269B2 from chromosome 16, complete sequence
          Length = 206740

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 141    gtgtttctttctctattca 159
              |||||||||||||||||||
Sbjct: 194206 gtgtttctttctctattca 194224


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,528,398
Number of Sequences: 3902068
Number of extensions: 1528398
Number of successful extensions: 91671
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91634
Number of HSP's gapped (non-prelim): 37
length of query: 196
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 174
effective length of database: 17,147,199,772
effective search space: 2983612760328
effective search space used: 2983612760328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top