>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete
           cds
          Length = 956

 Score =  121 bits (61), Expect = 2e-24
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 259 ggcgggggagcttacgggttcaccttnggcgcccacccggcgatcaggttcttnttggtc 318
           |||||| | |||||||||||||| || |||||||||||||||||||||||||  ||||||
Sbjct: 724 ggcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttctccttggtc 665

                                                   
Query: 319 ggcttggtcttgannaacgactcgtggntgaagagagcct 358
           | |||||||||||  ||||||||| || ||||||||||||
Sbjct: 664 gccttggtcttgacgaacgactcgcggctgaagagagcct 625



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 149 aggctcgctcgcattattccaa 170
           ||||||||||||||||||||||
Sbjct: 806 aggctcgctcgcattattccaa 785

>gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 202

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                       
Query: 268 gcttacgggttcaccttnggcgcccacccggcgatcaggttcttnttggtcggcttggtc 327
           |||||||||||||| || |||||||| ||||||||||||||||  ||||| |||||||||
Sbjct: 200 gcttacgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtc 141

                                             
Query: 328 ttgannaacgactcgtggntgaagagagccttgg 361
           ||||  || || ||  || |||| ||||||||||
Sbjct: 140 ttgacgaaggattcccggctgaacagagccttgg 107

>gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 195

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 273 cgggttcaccttnggcgcccacccggcgatcaggttcttnttggtcggcttggtcttgan 332
           ||||||||| || |||||||| ||||||||||||||||  ||||| ||||||||||||| 
Sbjct: 195 cgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtcttgac 136

                                        
Query: 333 naacgactcgtggntgaagagagccttgg 361
            || || ||  || |||| ||||||||||
Sbjct: 135 gaaggattcccggctgaacagagccttgg 107

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 92      ggggcatgacagtccacgcag 112
               |||||||||||||||||||||
Sbjct: 2056020 ggggcatgacagtccacgcag 2056000

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 130    caggcagagcacacagcaga 149
              ||||||||||||||||||||
Sbjct: 111810 caggcagagcacacagcaga 111829

>emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 in linkage group 2,
             complete sequence
          Length = 185178

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ctcgcattattccaaaccca 175
             ||||||||||||||||||||
Sbjct: 28852 ctcgcattattccaaaccca 28833


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,334,313
Number of Sequences: 3902068
Number of extensions: 1334313
Number of successful extensions: 24459
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24446
Number of HSP's gapped (non-prelim): 13
length of query: 361
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 339
effective length of database: 17,147,199,772
effective search space: 5812900722708
effective search space used: 5812900722708
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)