>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete
           cds
          Length = 956

 Score =  236 bits (119), Expect = 5e-59
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                       
Query: 269 ggcgggggagcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtc 328
           |||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 724 ggcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttctccttggtc 665

                                                                       
Query: 329 ggcttggtcttgacgaacgactcgcggntgaagagagcctcggtgtaggcatggacgctg 388
           | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 664 gccttggtcttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctg 605

                                           
Query: 389 gtcantgtttcagggaccttccagnctttgaa 420
           ||||  |||||||||||||||||| | |||||
Sbjct: 604 gtcagggtttcagggaccttccagcccttgaa 573



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 159 aggctcgctcgcattattccaa 180
           ||||||||||||||||||||||
Sbjct: 806 aggctcgctcgcattattccaa 785

>gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 202

 Score =  170 bits (86), Expect = 2e-39
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                       
Query: 278 gcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtc 337
           |||||||||||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 200 gcttacgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtc 141

                                                                       
Query: 338 ttgacgaacgactcgcggntgaagagagcctcggtgtaggcatggacgctggtcantgtt 397
           |||||||| || || ||| |||| ||||||| |||||||||||||||||||||||  |||
Sbjct: 140 ttgacgaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtt 81

                                  
Query: 398 tcagggaccttccagnctttgaa 420
           || |||||||||||  |||||||
Sbjct: 80  tcggggaccttccatcctttgaa 58

>gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 195

 Score =  168 bits (85), Expect = 9e-39
 Identities = 124/138 (89%)
 Strand = Plus / Minus

                                                                       
Query: 283 cgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtcttgac 342
           ||||||||| || |||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 195 cgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtcttgac 136

                                                                       
Query: 343 gaacgactcgcggntgaagagagcctcggtgtaggcatggacgctggtcantgtttcagg 402
           ||| || || ||| |||| ||||||| |||||||||||||||||||||||  ||||||||
Sbjct: 135 gaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtttcagg 76

                             
Query: 403 gaccttccagnctttgaa 420
           |||||||||  |||||||
Sbjct: 75  gaccttccatcctttgaa 58

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 325     ggtcggcttggtcttgacgaacgact 350
               ||||||| ||||||||||||||||||
Sbjct: 1119794 ggtcggcctggtcttgacgaacgact 1119769

>gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, complete sequence
          Length = 195657

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 93    agccaggcagggggcagacag 113
             |||||||||||||||||||||
Sbjct: 71257 agccaggcagggggcagacag 71277

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 282    acgggttcaccttcggcgccc 302
              |||||||||||||||||||||
Sbjct: 209716 acgggttcaccttcggcgccc 209736

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    ccttggtcggcttggtcttg 340
              ||||||||||||||||||||
Sbjct: 505341 ccttggtcggcttggtcttg 505322

>ref|XM_366481.1| Magnaporthe grisea 70-15 chromosome VII predicted protein
           (MG02557.4) partial mRNA
          Length = 966

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 328 cggcttggtcttgacgaacg 347
           ||||||||||||||||||||
Sbjct: 216 cggcttggtcttgacgaacg 197

>ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (CaO19_14092), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 220  tactactgccatcactactggcac 243
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340

>ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (CaO19_6800), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 220  tactactgccatcactactggcac 243
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 140    caggcagagcacacagcaga 159
              ||||||||||||||||||||
Sbjct: 111810 caggcagagcacacagcaga 111829

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 306     cggcgatcaggttctccttg 325
               ||||||||||||||||||||
Sbjct: 3304928 cggcgatcaggttctccttg 3304947

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 310     gatcaggttctccttggtcg 329
               ||||||||||||||||||||
Sbjct: 3814314 gatcaggttctccttggtcg 3814295

>emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 in linkage group 2,
             complete sequence
          Length = 185178

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 166   ctcgcattattccaaaccca 185
             ||||||||||||||||||||
Sbjct: 28852 ctcgcattattccaaaccca 28833

>emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on chromosome 3, complete
             sequence
          Length = 16950

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    agccaggcagggggcagaca 112
             ||||||||||||||||||||
Sbjct: 12882 agccaggcagggggcagaca 12863


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,741,841
Number of Sequences: 3902068
Number of extensions: 1741841
Number of successful extensions: 34120
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33987
Number of HSP's gapped (non-prelim): 133
length of query: 420
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 398
effective length of database: 17,147,199,772
effective search space: 6824585509256
effective search space used: 6824585509256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)