ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags27m08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochro... 682 0.0
2gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H)... 537 e-149
3gb|AY104175.1| Zea mays PCO098406 mRNA sequence 515 e-143
4gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome... 496 e-137
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 496 e-137
6dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clon... 496 e-137
7dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clon... 496 e-137
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 289 5e-75
9dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic D... 289 5e-75
10gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA... 123 7e-25
11ref|XM_465542.1| Oryza sativa (japonica cultivar-group), mRNA 90 9e-15
12ref|XM_465538.1| Oryza sativa (japonica cultivar-group), mRNA 90 9e-15
13dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 90 9e-15
14dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic D... 90 9e-15
15dbj|AK072588.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 9e-15
16gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase ... 64 5e-07
17ref|XM_368073.1| Magnaporthe grisea 70-15 chromosome III hypothe... 52 0.002
18gb|AF097664.1|AF097664 Mesembryanthemum crystallinum cinnamate 4... 50 0.008
19ref|NM_117451.2| Arabidopsis thaliana CYP83A1 (CYTOCHROME P450 8... 48 0.032
20emb|AL161537.2|ATCHRIV37 Arabidopsis thaliana DNA chromosome 4, ... 48 0.032
21emb|AL035528.2|ATF18A5 Arabidopsis thaliana DNA chromosome 4, BA... 48 0.032
22gb|AY102146.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, co... 48 0.032
23gb|AY091779.1| Arabidopsis thaliana AT5g65110/MQN23_4 mRNA sequence 48 0.032
24gb|AY075697.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, co... 48 0.032
25gb|AY057637.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, co... 48 0.032
26gb|AF428469.1|AF428469 Arabidopsis thaliana AT4g13770/F18A5_160 ... 48 0.032
27dbj|AK220835.1| Arabidopsis thaliana mRNA for cytochrome P450 mo... 48 0.032
28emb|BX827552.1|CNS0A3O7 Arabidopsis thaliana Full-length cDNA Co... 48 0.032
29dbj|D78599.1| Arabidopsis thaliana mRNA for cytochrome P450 mono... 48 0.032
30gb|U69134.1|ATU69134 Arabidopsis thaliana cytochrome P450 monoox... 48 0.032
31gb|U18929.1|ATU18929 Arabidopsis thaliana cytochrome p450 depend... 48 0.032
32gb|AC132485.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.13
33gb|AC158158.6| Mus musculus chromosome 1, clone RP23-10D8, compl... 46 0.13
34gb|AC110266.15| Mus musculus chromosome 1, clone RP23-319C1, com... 46 0.13
35dbj|AK062293.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.13
36gb|AY670393.1| Pinus taeda isolate 27 trans-cinnamate 4-hydroxyl... 44 0.50
37gb|AY670388.1| Pinus taeda isolate 28 trans-cinnamate 4-hydroxyl... 44 0.50
38gb|AY670384.1| Pinus taeda isolate 10 trans-cinnamate 4-hydroxyl... 44 0.50
39gb|AY670382.1| Pinus taeda isolate 30 trans-cinnamate 4-hydroxyl... 44 0.50
40gb|AY670380.1| Pinus taeda isolate 25 trans-cinnamate 4-hydroxyl... 44 0.50
41gb|AY670377.1| Pinus taeda isolate 24 trans-cinnamate 4-hydroxyl... 44 0.50
42gb|AY670376.1| Pinus taeda isolate 20 trans-cinnamate 4-hydroxyl... 44 0.50
43gb|AY670375.1| Pinus taeda isolate 15 trans-cinnamate 4-hydroxyl... 44 0.50
44gb|AY670372.1| Pinus taeda isolate 21 trans-cinnamate 4-hydroxyl... 44 0.50
45gb|AY670371.1| Pinus taeda isolate 18 trans-cinnamate 4-hydroxyl... 44 0.50
46gb|AY670370.1| Pinus taeda isolate 12 trans-cinnamate 4-hydroxyl... 44 0.50
47gb|AY670367.1| Pinus taeda isolate 23 trans-cinnamate 4-hydroxyl... 44 0.50
48gb|AY670363.1| Pinus taeda isolate 6 trans-cinnamate 4-hydroxyla... 44 0.50
49gb|AY670362.1| Pinus taeda isolate 16 trans-cinnamate 4-hydroxyl... 44 0.50
50ref|XM_543150.2| PREDICTED: Canis familiaris similar to PABP1-de... 44 0.50
51gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) ... 44 0.50
52dbj|AB232856.1| Lactuca sativa mRNA for cinnamate 4-hydroxylase,... 44 0.50
53gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 44 0.50
54dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complet... 44 0.50
55gb|U55006.1|PEU55006 Pinus elliottii PEC18 mRNA, partial sequence 44 0.50
56gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 42 2.0
57gb|AC124764.3| Mus musculus BAC clone RP23-166K1 from chromosome... 42 2.0
58dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 42 2.0
59emb|BX294118.4| Zebrafish DNA sequence from clone DKEYP-38B6, co... 42 2.0
60emb|AJ583532.1| Triticum aestivum mRNA for cytochrome P450 (CYP9... 42 2.0
61ref|NM_128601.2| Arabidopsis thaliana ATC4H (CINNAMATE-4-HYDROXY... 40 7.8
62ref|NM_198321.2| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine... 40 7.8
63gb|AY528720.1| Danio rerio activation-induced cytidine deaminase... 40 7.8
64gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 7.8
65gb|AE008947.1| Agrobacterium tumefaciens str. C58 AT plasmid sec... 40 7.8
66gb|AE007894.1| Agrobacterium tumefaciens str. C58 plasmid AT, se... 40 7.8
67gb|BC050333.1| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:p... 40 7.8
68ref|XM_976546.1| PREDICTED: Mus musculus membrane-associated rin... 40 7.8
69ref|XM_804275.1| Trypanosoma cruzi strain CL Brener 40S ribosoma... 40 7.8
70ref|XM_812245.1| Trypanosoma cruzi strain CL Brener 40S ribosoma... 40 7.8
71ref|XM_816173.1| Trypanosoma cruzi strain CL Brener 40S ribosoma... 40 7.8
72ref|XM_816528.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 7.8
73ref|XM_546283.2| PREDICTED: Canis familiaris similar to GalNAc t... 40 7.8
74gb|AC079804.5| Homo sapiens BAC clone RP11-740N7 from 7, complet... 40 7.8
75gb|AC010295.7| Homo sapiens chromosome 5 clone CTB-143H13, compl... 40 7.8
76ref|NM_001008403.1| Danio rerio activation-induced cytidine deam... 40 7.8
77ref|XM_775811.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.8
78gb|BT008875.1| Arabidopsis thaliana At2g30490 mRNA, complete cds 40 7.8
79emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin hea... 40 7.8
80emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 7.8
81gb|AC148832.5| Pan troglodytes BAC clone CH251-48K6 from chromos... 40 7.8
82gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 7.8
83dbj|AK127135.1| Homo sapiens cDNA FLJ45192 fis, clone BRAWH30495... 40 7.8
84dbj|AB234902.1| Verbena x hybrida mRNA for Cinnamic acid 4-hydro... 40 7.8
85gb|U93215.3| Arabidopsis thaliana chromosome 2 BAC T6B20 genomic... 40 7.8
86gb|AF368379.1| Nicotiana tabacum elicitor-inducible cytochrome P... 40 7.8
87gb|AF368378.1| Nicotiana tabacum elicitor-inducible cytochrome P... 40 7.8
88dbj|AK158026.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 40 7.8
89gb|AY065145.1| Arabidopsis thaliana cinnamate-4-hydroxylase (At2... 40 7.8
90gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex B... 40 7.8
91gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B... 40 7.8
92gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex B... 40 7.8
93emb|BX819707.1|CNS0AA1Q Arabidopsis thaliana Full-length cDNA Co... 40 7.8
94emb|BX820902.1|CNS0A9NW Arabidopsis thaliana Full-length cDNA Co... 40 7.8
95gb|AC113052.10| Mus musculus chromosome 5, clone RP23-250D22, co... 40 7.8
96dbj|D78596.1| Arabidopsis thaliana mRNA for trans-cinnamate 4-hy... 40 7.8
97gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1... 40 7.8
98gb|U37235.1|ATU37235 Arabidopsis thaliana cinnamate 4-hydroxylas... 40 7.8
99ref|NM_001033262.1| Mus musculus membrane-associated ring finger... 40 7.8
100emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 40 7.8
101gb|AC131760.4| Mus musculus BAC clone RP24-220M2 from 10, comple... 40 7.8
102gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, compl... 40 7.8
103emb|CR848818.10| Zebrafish DNA sequence from clone DKEY-38O19 in... 40 7.8
104gb|U71081.1|ATU71081 Arabidopsis thaliana cinnamate-4-hydroxylas... 40 7.8
105gb|U71080.1|ATU71080 Arabidopsis thaliana cinnamate-4-hydroxylas... 40 7.8
106dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 40 7.8 
>gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochrome P450 mRNA, complete cds
          Length = 1506

 Score =  682 bits (344), Expect = 0.0
 Identities = 386/400 (96%)
 Strand = Plus / Minus

                                                                        
Query: 178  aagcctcgagtggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgcc 237
            |||||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||
Sbjct: 1504 aagcctcgagtggcttgcagacaatggtggcgtgcttgaggatctggttggtaaactgcc 1445

                                                                        
Query: 238  ctggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttct 297
            | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1444 cgggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctggaagttct 1385

                                                                        
Query: 298  gcaccaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagc 357
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1384 gcaccaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagc 1325

                                                                        
Query: 358  tccggcggccgacgccgaagggcacgaaccggaagtcgttgccgtgggcctcgacggact 417
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 1324 tccggcggccgacgccgaagggcacgaaccggaaatcgttgccgtgggcctcgacggcct 1265

                                                                        
Query: 418  tctcctcctcgaggaagcgctcgggcctgaactcgtcggcgcgcacccaccgcttggggt 477
            |||||||||||||||| | ||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 1264 tctcctcctcgaggaacctctccggcctgaactcatcggcgcgcacccaccgcttggggt 1205

                                                                        
Query: 478  cgttggcgaggaaccaggcgttgacgaggatcttggattcggcggggatgtcgtaaccgg 537
            ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 1204 cgttggcgaggaaccaggcgttgacgaggatcttggactcggcggggatgtcgtagccgg 1145

                                                    
Query: 538  cgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            |||||||||| |||||||||||||||||||||||||||||
Sbjct: 1144 cgagcttggcgtcgctgaggttcatgtgcggcaccaggag 1105
to top
>gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H) mRNA, complete cds
          Length = 1762

 Score =  537 bits (271), Expect = e-149
 Identities = 364/395 (92%)
 Strand = Plus / Minus

                                                                        
Query: 180  gcctcgagtggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccct 239
            |||||||| |||||||||||||| ||||| |||||   |||||||||||||||||| || 
Sbjct: 1568 gcctcgaggggcttgcagacgattgtggcatgcttagcgatctggttgctgaactggccg 1509

                                                                        
Query: 240  ggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgc 299
            |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1508 ggcttctccgtggtgtcgatcttgtcctgccccggcggcggcagcagctggaagttctgc 1449

                                                                        
Query: 300  accaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctc 359
            ||||| |  || || |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1448 accagcctgcccagggtgatgccgatgataggcagcgcgaggatgatcccggggcagctc 1389

                                                                        
Query: 360  cggcggccgacgccgaagggcacgaaccggaagtcgttgccgtgggcctcgacggacttc 419
            |||||||||||||||||||||||||| ||||||||||||||||| ||||| |||| ||||
Sbjct: 1388 cggcggccgacgccgaagggcacgaagcggaagtcgttgccgtgtgcctccacggtcttc 1329

                                                                        
Query: 420  tcctcctcgaggaagcgctcgggcctgaactcgtcggcgcgcacccaccgcttggggtcg 479
            |||||||| |||||||||||||||| |||||||||||  |||||||||| ||||||||||
Sbjct: 1328 tcctcctccaggaagcgctcgggccggaactcgtcgggccgcacccacctcttggggtcg 1269

                                                                        
Query: 480  ttggcgaggaaccaggcgttgacgaggatcttggattcggcggggatgtcgtaaccggcg 539
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 1268 ttggcgaggaaccaggcgttgacgaggatcttggactcggcggggatgtcgtagccggcg 1209

                                               
Query: 540  agcttggcatcgctgaggttcatgtgcggcaccag 574
            |||||| | ||| ||||||||||||| ||||||||
Sbjct: 1208 agcttgccgtcgttgaggttcatgtggggcaccag 1174
to top
>gb|AY104175.1| Zea mays PCO098406 mRNA sequence
          Length = 1755

 Score =  515 bits (260), Expect = e-143
 Identities = 363/396 (91%), Gaps = 1/396 (0%)
 Strand = Plus / Minus

                                                                        
Query: 180  gcctcgagtggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccct 239
            |||||||| |||||||| ||||||||||| ||||||  |||||||||||||||||| || 
Sbjct: 1566 gcctcgaggggcttgcaaacgatggtggcatgcttggcgatctggttgctgaactggccg 1507

                                                                        
Query: 240  ggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgc 299
            |||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||
Sbjct: 1506 ggcttctccgtggtgtcgatcttgtccagccccggcggcggcagcagctggaagttctgc 1447

                                                                        
Query: 300  accaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctc 359
            ||||| || || || |||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 1446 accagccggcccagggtgatgccgatgataggcagcgcgaggatgatcccagggcagctc 1387

                                                                        
Query: 360  cggcggccgacgccgaagggcacgaaccggaagtcgttgccgtgggcctcgacggacttc 419
            ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1386 cggcggccgaccccaaagggcacgaatcggaagtcgttgccgtgggcctccacggacttc 1327

                                                                        
Query: 420  tcctcct-cgaggaagcgctcgggcctgaactcgtcggcgcgcacccaccgcttggggtc 478
            ||||||| | |||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 1326 tcctcctccaaggaagcgctcgggccggaactcgtcggggcgcacccacctcttggggtc 1267

                                                                        
Query: 479  gttggcgaggaaccaggcgttgacgaggatcttggattcggcggggatgtcgtaaccggc 538
            |||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||
Sbjct: 1266 gttggcgaggaaccaggcattgacgaggatcttggactcggcggggatgtcgaaaccggc 1207

                                                
Query: 539  gagcttggcatcgctgaggttcatgtgcggcaccag 574
            ||||||| | ||| ||||||||||||| || |||||
Sbjct: 1206 gagcttgccgtcgttgaggttcatgtgggggaccag 1171
to top
>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22,
              complete sequence
          Length = 166052

 Score =  496 bits (250), Expect = e-137
 Identities = 352/386 (91%)
 Strand = Plus / Plus

                                                                          
Query: 189    ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 248
              ||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 102219 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 102278

                                                                          
Query: 249    gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 308
              |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 102279 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 102338

                                                                          
Query: 309    ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 368
              ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 102339 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 102398

                                                                          
Query: 369    acgccgaagggcacgaaccggaagtcgttgccgtgggcctcgacggacttctcctcctcg 428
              ||||||||||||||||| ||||||||||||||||| ||||| |||| |||||||||||| 
Sbjct: 102399 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcctcc 102458

                                                                          
Query: 429    aggaagcgctcgggcctgaactcgtcggcgcgcacccaccgcttggggtcgttggcgagg 488
              ||||| | ||| ||||| |||||||||| |||||||||||||||||||||||||||||||
Sbjct: 102459 aggaacctctccggcctaaactcgtcggggcgcacccaccgcttggggtcgttggcgagg 102518

                                                                          
Query: 489    aaccaggcgttgacgaggatcttggattcggcggggatgtcgtaaccggcgagcttggca 548
              ||||| ||||| || ||||||||||| ||||||||||||||||| |||||||||||| | 
Sbjct: 102519 aaccacgcgttcaccaggatcttggactcggcggggatgtcgtagccggcgagcttgccg 102578

                                        
Query: 549    tcgctgaggttcatgtgcggcaccag 574
              |||  |||||||||||||||||||||
Sbjct: 102579 tcggcgaggttcatgtgcggcaccag 102604
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  496 bits (250), Expect = e-137
 Identities = 352/386 (91%)
 Strand = Plus / Plus

                                                                            
Query: 189      ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 248
                ||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 14766805 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 14766864

                                                                            
Query: 249      gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 308
                |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 14766865 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 14766924

                                                                            
Query: 309      ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 368
                ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 14766925 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 14766984

                                                                            
Query: 369      acgccgaagggcacgaaccggaagtcgttgccgtgggcctcgacggacttctcctcctcg 428
                ||||||||||||||||| ||||||||||||||||| ||||| |||| |||||||||||| 
Sbjct: 14766985 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcctcc 14767044

                                                                            
Query: 429      aggaagcgctcgggcctgaactcgtcggcgcgcacccaccgcttggggtcgttggcgagg 488
                ||||| | ||| ||||| |||||||||| |||||||||||||||||||||||||||||||
Sbjct: 14767045 aggaacctctccggcctaaactcgtcggggcgcacccaccgcttggggtcgttggcgagg 14767104

                                                                            
Query: 489      aaccaggcgttgacgaggatcttggattcggcggggatgtcgtaaccggcgagcttggca 548
                ||||| ||||| || ||||||||||| ||||||||||||||||| |||||||||||| | 
Sbjct: 14767105 aaccacgcgttcaccaggatcttggactcggcggggatgtcgtagccggcgagcttgccg 14767164

                                          
Query: 549      tcgctgaggttcatgtgcggcaccag 574
                |||  |||||||||||||||||||||
Sbjct: 14767165 tcggcgaggttcatgtgcggcaccag 14767190



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 365      gccgacgccgaagggcacgaaccggaagtcg 395
                |||| ||||||| ||||||||||||||||||
Sbjct: 25344429 gccggcgccgaacggcacgaaccggaagtcg 25344399
to top
>dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H11, full
            insert sequence
          Length = 1796

 Score =  496 bits (250), Expect = e-137
 Identities = 352/386 (91%)
 Strand = Plus / Minus

                                                                        
Query: 189  ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 248
            ||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 1569 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 1510

                                                                        
Query: 249  gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 308
            |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 1509 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 1450

                                                                        
Query: 309  ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 368
            ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1449 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 1390

                                                                        
Query: 369  acgccgaagggcacgaaccggaagtcgttgccgtgggcctcgacggacttctcctcctcg 428
            ||||||||||||||||| ||||||||||||||||| ||||| |||| |||||||||||| 
Sbjct: 1389 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcctcc 1330

                                                                        
Query: 429  aggaagcgctcgggcctgaactcgtcggcgcgcacccaccgcttggggtcgttggcgagg 488
            ||||| | ||| ||||| |||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1329 aggaacctctccggcctaaactcgtcggggcgcacccaccgcttggggtcgttggcgagg 1270

                                                                        
Query: 489  aaccaggcgttgacgaggatcttggattcggcggggatgtcgtaaccggcgagcttggca 548
            ||||| ||||| || ||||||||||| ||||||||||||||||| |||||||||||| | 
Sbjct: 1269 aaccacgcgttcaccaggatcttggactcggcggggatgtcgtagccggcgagcttgccg 1210

                                      
Query: 549  tcgctgaggttcatgtgcggcaccag 574
            |||  |||||||||||||||||||||
Sbjct: 1209 tcggcgaggttcatgtgcggcaccag 1184
to top
>dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107C01, full
            insert sequence
          Length = 1838

 Score =  496 bits (250), Expect = e-137
 Identities = 352/386 (91%)
 Strand = Plus / Minus

                                                                        
Query: 189  ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 248
            ||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 1567 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 1508

                                                                        
Query: 249  gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 308
            |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 1507 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 1448

                                                                        
Query: 309  ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 368
            ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1447 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 1388

                                                                        
Query: 369  acgccgaagggcacgaaccggaagtcgttgccgtgggcctcgacggacttctcctcctcg 428
            ||||||||||||||||| ||||||||||||||||| ||||| |||| |||||||||||| 
Sbjct: 1387 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcctcc 1328

                                                                        
Query: 429  aggaagcgctcgggcctgaactcgtcggcgcgcacccaccgcttggggtcgttggcgagg 488
            ||||| | ||| ||||| |||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1327 aggaacctctccggcctaaactcgtcggggcgcacccaccgcttggggtcgttggcgagg 1268

                                                                        
Query: 489  aaccaggcgttgacgaggatcttggattcggcggggatgtcgtaaccggcgagcttggca 548
            ||||| ||||| || ||||||||||| ||||||||||||||||| |||||||||||| | 
Sbjct: 1267 aaccacgcgttcaccaggatcttggactcggcggggatgtcgtagccggcgagcttgccg 1208

                                      
Query: 549  tcgctgaggttcatgtgcggcaccag 574
            |||  |||||||||||||||||||||
Sbjct: 1207 tcggcgaggttcatgtgcggcaccag 1182
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  289 bits (146), Expect = 5e-75
 Identities = 317/374 (84%)
 Strand = Plus / Plus

                                                                            
Query: 201      atggtggcgtgcttgaggatctggttgctgaactgccctggcttctcggtggtgtcgatc 260
                ||||||| |||||| ||||| |||  ||||||||||||   ||||||||||||||||| |
Sbjct: 34955260 atggtggagtgcttcaggatgtggaggctgaactgcccacccttctcggtggtgtcgacc 34955319

                                                                            
Query: 261      ttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgatg 320
                 |||||| ||| |||||||||||||||||||||||||| || ||||| ||||  |||| |
Sbjct: 34955320 ctgtccttcccgggcggcggcagcagctcgaagttctggacgaggcggccgatggtgacg 34955379

                                                                            
Query: 321      ccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggc 380
                |||| ||||||||||||||||| ||| |||||||||||||| || ||| ||||| | |||
Sbjct: 34955380 ccgaggatgggcagcgcgaggacgatgccggggcagctccgccgcccggcgccggacggc 34955439

                                                                            
Query: 381      acgaaccggaagtcgttgccgtgggcctcgacggacttctcctcctcgaggaagcgctcg 440
                | | ||| |||||||||||||| ||||||||||  | |||||||||||||||| | ||| 
Sbjct: 34955440 aggtacctgaagtcgttgccgttggcctcgacgttcctctcctcctcgaggaacctctcc 34955499

                                                                            
Query: 441      ggcctgaactcgtcggcgcgcacccaccgcttggggtcgttggcgaggaaccaggcgttg 500
                |||| |||||| || |  |||  |||||||  |||||||||||||||| |||| ||||||
Sbjct: 34955500 ggccggaactcctccggccgccgccaccgcccggggtcgttggcgaggtaccacgcgttg 34955559

                                                                            
Query: 501      acgaggatcttggattcggcggggatgtcgtaaccggcgagcttggcatcgctgaggttc 560
                ||||| | ||||   |||||||||||| |||| |||||||||| ||| |||| |||||||
Sbjct: 34955560 acgagcaccttgctctcggcggggatgccgtacccggcgagctcggcgtcgcggaggttc 34955619

                              
Query: 561      atgtgcggcaccag 574
                ||||||||||||||
Sbjct: 34955620 atgtgcggcaccag 34955633
to top
>dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1529_G03
          Length = 100635

 Score =  289 bits (146), Expect = 5e-75
 Identities = 317/374 (84%)
 Strand = Plus / Plus

                                                                         
Query: 201   atggtggcgtgcttgaggatctggttgctgaactgccctggcttctcggtggtgtcgatc 260
             ||||||| |||||| ||||| |||  ||||||||||||   ||||||||||||||||| |
Sbjct: 84624 atggtggagtgcttcaggatgtggaggctgaactgcccacccttctcggtggtgtcgacc 84683

                                                                         
Query: 261   ttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgatg 320
              |||||| ||| |||||||||||||||||||||||||| || ||||| ||||  |||| |
Sbjct: 84684 ctgtccttcccgggcggcggcagcagctcgaagttctggacgaggcggccgatggtgacg 84743

                                                                         
Query: 321   ccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggc 380
             |||| ||||||||||||||||| ||| |||||||||||||| || ||| ||||| | |||
Sbjct: 84744 ccgaggatgggcagcgcgaggacgatgccggggcagctccgccgcccggcgccggacggc 84803

                                                                         
Query: 381   acgaaccggaagtcgttgccgtgggcctcgacggacttctcctcctcgaggaagcgctcg 440
             | | ||| |||||||||||||| ||||||||||  | |||||||||||||||| | ||| 
Sbjct: 84804 aggtacctgaagtcgttgccgttggcctcgacgttcctctcctcctcgaggaacctctcc 84863

                                                                         
Query: 441   ggcctgaactcgtcggcgcgcacccaccgcttggggtcgttggcgaggaaccaggcgttg 500
             |||| |||||| || |  |||  |||||||  |||||||||||||||| |||| ||||||
Sbjct: 84864 ggccggaactcctccggccgccgccaccgcccggggtcgttggcgaggtaccacgcgttg 84923

                                                                         
Query: 501   acgaggatcttggattcggcggggatgtcgtaaccggcgagcttggcatcgctgaggttc 560
             ||||| | ||||   |||||||||||| |||| |||||||||| ||| |||| |||||||
Sbjct: 84924 acgagcaccttgctctcggcggggatgccgtacccggcgagctcggcgtcgcggaggttc 84983

                           
Query: 561   atgtgcggcaccag 574
             ||||||||||||||
Sbjct: 84984 atgtgcggcaccag 84997
to top
>gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.~~
          Length = 1676

 Score =  123 bits (62), Expect = 7e-25
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 243  ttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcacc 302
            ||||| ||||||||||||||   || |||||| || ||||||||||| ||||||||||||
Sbjct: 1507 ttctctgtggtgtcgatcttcgacttccccggaggaggcagcagctcaaagttctgcacc 1448

                                                                        
Query: 303  aggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccgg 362
            |||||||| | ||||||||| |  || |||| |||||| |||||||||||||||||||  
Sbjct: 1447 aggcgtcccaacgtgatgccaagaataggcaacgcgagaatgatcccggggcagctcctc 1388

                                                              
Query: 363  cggccgacgccgaagggcacgaaccggaagtcgttgccgtgggcctcgac 412
            | ||| || ||||| |||| | ||| |||||||||||| | |||||||||
Sbjct: 1387 ctgccaacaccgaatggcaggtacctgaagtcgttgccattggcctcgac 1338
to top
>ref|XM_465542.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1910

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Minus

                                                                        
Query: 326  gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 385
            |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| |||
Sbjct: 1557 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 1498

                     
Query: 386  ccggaagtc 394
            || ||||||
Sbjct: 1497 cctgaagtc 1489



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 555  aggttcatgtgcggcaccag 574
            ||||||||||||||||||||
Sbjct: 1319 aggttcatgtgcggcaccag 1300
to top
>ref|XM_465538.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1602

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Minus

                                                                        
Query: 326  gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 385
            |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| |||
Sbjct: 1452 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 1393

                     
Query: 386  ccggaagtc 394
            || ||||||
Sbjct: 1392 cctgaagtc 1384



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 555  aggttcatgtgcggcaccag 574
            ||||||||||||||||||||
Sbjct: 1214 aggttcatgtgcggcaccag 1195
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Minus

                                                                            
Query: 326      gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 385
                |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| |||
Sbjct: 15836284 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 15836225

                         
Query: 386      ccggaagtc 394
                || ||||||
Sbjct: 15836224 cctgaagtc 15836216



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Plus

                                                                            
Query: 326      gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 385
                |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| |||
Sbjct: 15816982 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 15817041

                         
Query: 386      ccggaagtc 394
                || ||||||
Sbjct: 15817042 cctgaagtc 15817050



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 555      aggttcatgtgcggcaccag 574
                ||||||||||||||||||||
Sbjct: 15836046 aggttcatgtgcggcaccag 15836027



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 555      aggttcatgtgcggcaccag 574
                ||||||||||||||||||||
Sbjct: 15817220 aggttcatgtgcggcaccag 15817239
to top
>dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1342_D02
          Length = 125460

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Minus

                                                                         
Query: 326   gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 385
             |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| |||
Sbjct: 94224 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 94165

                      
Query: 386   ccggaagtc 394
             || ||||||
Sbjct: 94164 cctgaagtc 94156



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Plus

                                                                         
Query: 326   gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 385
             |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| |||
Sbjct: 74922 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 74981

                      
Query: 386   ccggaagtc 394
             || ||||||
Sbjct: 74982 cctgaagtc 74990



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 555   aggttcatgtgcggcaccag 574
             ||||||||||||||||||||
Sbjct: 93986 aggttcatgtgcggcaccag 93967



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 555   aggttcatgtgcggcaccag 574
             ||||||||||||||||||||
Sbjct: 75160 aggttcatgtgcggcaccag 75179
to top
>dbj|AK072588.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132G16, full
            insert sequence
          Length = 1910

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 63/69 (91%)
 Strand = Plus / Minus

                                                                        
Query: 326  gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 385
            |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| |||
Sbjct: 1558 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 1499

                     
Query: 386  ccggaagtc 394
            || ||||||
Sbjct: 1498 cctgaagtc 1490



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 555  aggttcatgtgcggcaccag 574
            ||||||||||||||||||||
Sbjct: 1320 aggttcatgtgcggcaccag 1301
to top
>gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase mRNA, complete cds
          Length = 1648

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 260  cttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgat 319
            ||||||||| || |||||||||| ||||||||| ||||||||||| || |||| ||||||
Sbjct: 1453 cttgtcctgtccgggcggcggcaacagctcgaaattctgcaccagccgcccgatcgtgat 1394
to top
>ref|XM_368073.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
           (MG07977.4) partial mRNA
          Length = 1020

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 433 agcgctcgggcctgaactcgtcggcg 458
           ||||||||||||||||||||||||||
Sbjct: 715 agcgctcgggcctgaactcgtcggcg 690
to top
>gb|AF097664.1|AF097664 Mesembryanthemum crystallinum cinnamate 4-hydroxylase mRNA, complete
            cds
          Length = 1750

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 419  ctcctcctcgaggaagcgctcgggcctgaactc 451
            ||||||||||||||| |||||||||| ||||||
Sbjct: 1444 ctcctcctcgaggaaccgctcgggccggaactc 1412
to top
>ref|NM_117451.2| Arabidopsis thaliana CYP83A1 (CYTOCHROME P450 83A1); oxygen binding
            AT4G13770 (CYP83A1) mRNA, complete cds
          Length = 1733

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1190 gcggggatgtcgtaaccggcgatcttgg 1163
to top
>emb|AL161537.2|ATCHRIV37 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 37
          Length = 199667

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 519   gcggggatgtcgtaaccggcgagcttgg 546
             |||||||||||||||||||||| |||||
Sbjct: 83136 gcggggatgtcgtaaccggcgatcttgg 83163
to top
>emb|AL035528.2|ATF18A5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18A5 (ESSA project)
          Length = 118718

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 519   gcggggatgtcgtaaccggcgagcttgg 546
             |||||||||||||||||||||| |||||
Sbjct: 62044 gcggggatgtcgtaaccggcgatcttgg 62071
to top
>gb|AY102146.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
          Length = 1509

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1163 gcggggatgtcgtaaccggcgatcttgg 1136
to top
>gb|AY091779.1| Arabidopsis thaliana AT5g65110/MQN23_4 mRNA sequence
          Length = 3816

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1187 gcggggatgtcgtaaccggcgatcttgg 1160
to top
>gb|AY075697.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
          Length = 1686

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1190 gcggggatgtcgtaaccggcgatcttgg 1163
to top
>gb|AY057637.1| Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
          Length = 1710

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1276 gcggggatgtcgtaaccggcgatcttgg 1249
to top
>gb|AF428469.1|AF428469 Arabidopsis thaliana AT4g13770/F18A5_160 mRNA, complete cds
          Length = 1681

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1184 gcggggatgtcgtaaccggcgatcttgg 1157
to top
>dbj|AK220835.1| Arabidopsis thaliana mRNA for cytochrome P450 monooxygenase,
           complete cds, clone: RAFL22-36-G17
          Length = 654

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 519 gcggggatgtcgtaaccggcgagcttgg 546
           |||||||||||||||||||||| |||||
Sbjct: 187 gcggggatgtcgtaaccggcgatcttgg 160
to top
>emb|BX827552.1|CNS0A3O7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS72ZE08 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1629

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1168 gcggggatgtcgtaaccggcgatcttgg 1141
to top
>dbj|D78599.1| Arabidopsis thaliana mRNA for cytochrome P450 monooxygenase, complete
            cds, clone P450-3
          Length = 1650

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1185 gcggggatgtcgtaaccggcgatcttgg 1158
to top
>gb|U69134.1|ATU69134 Arabidopsis thaliana cytochrome P450 monooxygenase (CYP83) gene,
            complete cds
          Length = 3319

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 2745 gcggggatgtcgtaaccggcgatcttgg 2718
to top
>gb|U18929.1|ATU18929 Arabidopsis thaliana cytochrome p450 dependent monooxygenase mRNA,
            complete cds
          Length = 1551

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 519  gcggggatgtcgtaaccggcgagcttgg 546
            |||||||||||||||||||||| |||||
Sbjct: 1170 gcggggatgtcgtaaccggcgatcttgg 1143
to top
>gb|AC132485.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0022D06,
             complete sequence
          Length = 142068

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 365   gccgacgccgaagggcacgaaccggaagtcg 395
             |||| ||||||| ||||||||||||||||||
Sbjct: 79033 gccggcgccgaacggcacgaaccggaagtcg 79003
to top
>gb|AC158158.6| Mus musculus chromosome 1, clone RP23-10D8, complete sequence
          Length = 193479

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 57    caacaccaaagaaaaattaaacttact 83
             |||||||||||||| ||||||||||||
Sbjct: 97110 caacaccaaagaaatattaaacttact 97136
to top
>gb|AC110266.15| Mus musculus chromosome 1, clone RP23-319C1, complete sequence
          Length = 177482

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 57   caacaccaaagaaaaattaaacttact 83
            |||||||||||||| ||||||||||||
Sbjct: 4472 caacaccaaagaaatattaaacttact 4498
to top
>dbj|AK062293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-F01, full
            insert sequence
          Length = 2395

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 365  gccgacgccgaagggcacgaaccggaagtcg 395
            |||| ||||||| ||||||||||||||||||
Sbjct: 1435 gccggcgccgaacggcacgaaccggaagtcg 1405
to top
>gb|AY670393.1| Pinus taeda isolate 27 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670388.1| Pinus taeda isolate 28 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670384.1| Pinus taeda isolate 10 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670382.1| Pinus taeda isolate 30 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670380.1| Pinus taeda isolate 25 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670377.1| Pinus taeda isolate 24 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670376.1| Pinus taeda isolate 20 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670375.1| Pinus taeda isolate 15 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670372.1| Pinus taeda isolate 21 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670371.1| Pinus taeda isolate 18 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670370.1| Pinus taeda isolate 12 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670367.1| Pinus taeda isolate 23 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670363.1| Pinus taeda isolate 6 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene,
           partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670362.1| Pinus taeda isolate 16 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 267 tgccccggcggcggcagcagctcgaagttctgcaccag 304
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>ref|XM_543150.2| PREDICTED: Canis familiaris similar to PABP1-dependent poly
           A-specific ribonuclease subunit PAN3 (LOC486024), mRNA
          Length = 5767

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 347 cccggggcagctccggcggccg 368
           ||||||||||||||||||||||
Sbjct: 533 cccggggcagctccggcggccg 512
to top
>gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) mRNA, complete cds
          Length = 1996

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 267  tgccccggcggcggcagcagctcgaagttctgcaccag 304
            ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 1504 tgcccaggcggaggcagcagctcaaagttctgaaccag 1467
to top
>dbj|AB232856.1| Lactuca sativa mRNA for cinnamate 4-hydroxylase, partial cds,
           clone: C4H1
          Length = 833

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 540 agcttggcatcgctgaggttcatgtgcggcaccaggag 577
           ||||||||||||  |||||||||||| || ||||||||
Sbjct: 795 agcttggcatcgtggaggttcatgtgtgggaccaggag 758
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 332     cagcgcgaggatgatcccgggg 353
               ||||||||||||||||||||||
Sbjct: 2623598 cagcgcgaggatgatcccgggg 2623619
to top
>dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complete sequence
          Length = 210614

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 265    cctgccccggcggcggcagcagctcg 290
              ||||| ||||||||||||||||||||
Sbjct: 187673 cctgcaccggcggcggcagcagctcg 187648
to top
>gb|U55006.1|PEU55006 Pinus elliottii PEC18 mRNA, partial sequence
          Length = 404

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 269 ccccggcggcggcagcagctcgaagttctg 298
           ||||||||| ||||| ||||||||||||||
Sbjct: 53  ccccggcggaggcagaagctcgaagttctg 24
to top
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 310    cgagcgtgatgccgatgatgggcag 334
              |||||||| ||||||||||||||||
Sbjct: 674771 cgagcgtgttgccgatgatgggcag 674747
to top
>gb|AC124764.3| Mus musculus BAC clone RP23-166K1 from chromosome 18, complete sequence
          Length = 209579

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 8     actatttggaaatttacaaca 28
             |||||||||||||||||||||
Sbjct: 60596 actatttggaaatttacaaca 60576
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 273    ggcggcggcagcagctcgaag 293
              |||||||||||||||||||||
Sbjct: 694404 ggcggcggcagcagctcgaag 694384



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 271     ccggcggcggcagcagctcg 290
               ||||||||||||||||||||
Sbjct: 5809939 ccggcggcggcagcagctcg 5809958
to top
>emb|BX294118.4| Zebrafish DNA sequence from clone DKEYP-38B6, complete sequence
          Length = 184616

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 84     actgtgaaacaccaaaatgca 104
              |||||||||||||||||||||
Sbjct: 165388 actgtgaaacaccaaaatgca 165408
to top
>emb|AJ583532.1| Triticum aestivum mRNA for cytochrome P450 (CYP98A12 gene)
          Length = 1774

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 428  gaggaagcgctcgggcctgaactcg 452
            ||||||||||||||||| |||||||
Sbjct: 1311 gaggaagcgctcgggccggaactcg 1287
to top
>ref|NM_128601.2| Arabidopsis thaliana ATC4H (CINNAMATE-4-HYDROXYLASE) AT2G30490
            (ATC4H) mRNA, complete cds
          Length = 1803

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1259 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1204
to top
>ref|NM_198321.2| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide
           N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
           (GALNT10), transcript variant 1, mRNA
          Length = 5222

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 270 cccggcggcggcagcagctc 289
           ||||||||||||||||||||
Sbjct: 59  cccggcggcggcagcagctc 40
to top
>gb|AY528720.1| Danio rerio activation-induced cytidine deaminase (aicda) mRNA,
           complete cds
          Length = 889

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 catgaccgagatctgaactc 173
           ||||||||||||||||||||
Sbjct: 500 catgaccgagatctgaactc 481
to top
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 422     ctcctcgaggaagcgctcgg 441
               ||||||||||||||||||||
Sbjct: 2648823 ctcctcgaggaagcgctcgg 2648804
to top
>gb|AE008947.1| Agrobacterium tumefaciens str. C58 AT plasmid section 22 of 49 of the
            complete sequence
          Length = 11182

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 502  cgaggatcttggattcggcg 521
            ||||||||||||||||||||
Sbjct: 4297 cgaggatcttggattcggcg 4316
to top
>gb|AE007894.1| Agrobacterium tumefaciens str. C58 plasmid AT, section 22 of 50 of
            the complete sequence
          Length = 10197

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 502  cgaggatcttggattcggcg 521
            ||||||||||||||||||||
Sbjct: 6988 cgaggatcttggattcggcg 7007
to top
>gb|BC050333.1| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide
           N-acetylgalactosaminyltransferase 10 (GalNAc-T10), mRNA
           (cDNA clone IMAGE:4838534), with apparent retained
           intron
          Length = 4359

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 270 cccggcggcggcagcagctc 289
           ||||||||||||||||||||
Sbjct: 59  cccggcggcggcagcagctc 40
to top
>ref|XM_976546.1| PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 9
           (March9), mRNA
          Length = 2563

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 267 tgccccggcggcggcagcag 286
           ||||||||||||||||||||
Sbjct: 798 tgccccggcggcggcagcag 817
to top
>ref|XM_804275.1| Trypanosoma cruzi strain CL Brener 40S ribosomal protein S9
           (Tc00.1047053504163.30) partial mRNA
          Length = 573

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 cttctcctcctcgaggaagc 435
           ||||||||||||||||||||
Sbjct: 267 cttctcctcctcgaggaagc 248
to top
>ref|XM_812245.1| Trypanosoma cruzi strain CL Brener 40S ribosomal protein S9
           (Tc00.1047053508543.30) partial mRNA
          Length = 573

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 cttctcctcctcgaggaagc 435
           ||||||||||||||||||||
Sbjct: 267 cttctcctcctcgaggaagc 248
to top
>ref|XM_816173.1| Trypanosoma cruzi strain CL Brener 40S ribosomal protein S9
           (Tc00.1047053506401.120) partial mRNA
          Length = 573

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 cttctcctcctcgaggaagc 435
           ||||||||||||||||||||
Sbjct: 267 cttctcctcctcgaggaagc 248
to top
>ref|XM_816528.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508461.290) partial mRNA
          Length = 1707

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 264 tcctgccccggcggcggcagcagc 287
           |||||||||||||||||| |||||
Sbjct: 864 tcctgccccggcggcggcggcagc 887
to top
>ref|XM_546283.2| PREDICTED: Canis familiaris similar to GalNAc transferase 10
           isoform a (LOC489165), mRNA
          Length = 2637

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 270 cccggcggcggcagcagctc 289
           ||||||||||||||||||||
Sbjct: 752 cccggcggcggcagcagctc 733
to top
>gb|AC079804.5| Homo sapiens BAC clone RP11-740N7 from 7, complete sequence
          Length = 184512

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    ccaacaccaaagaaaaatta 75
             ||||||||||||||||||||
Sbjct: 99068 ccaacaccaaagaaaaatta 99049
to top
>gb|AC010295.7| Homo sapiens chromosome 5 clone CTB-143H13, complete sequence
          Length = 108051

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 270  cccggcggcggcagcagctc 289
            ||||||||||||||||||||
Sbjct: 7435 cccggcggcggcagcagctc 7454
to top
>ref|NM_001008403.1| Danio rerio activation-induced cytidine deaminase (aicda), mRNA
          Length = 889

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 catgaccgagatctgaactc 173
           ||||||||||||||||||||
Sbjct: 500 catgaccgagatctgaactc 481
to top
>ref|XM_775811.1| PREDICTED: Strongylocentrotus purpuratus similar to CG5262-PA
           (LOC575408), mRNA
          Length = 1284

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 312 agcgtgatgccgatgatggg 331
           ||||||||||||||||||||
Sbjct: 917 agcgtgatgccgatgatggg 898
to top
>gb|BT008875.1| Arabidopsis thaliana At2g30490 mRNA, complete cds
          Length = 1518

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1172 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1117
to top
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene
          Length = 5894

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 404  ggcctcgacggacttctcct 423
            ||||||||||||||||||||
Sbjct: 5463 ggcctcgacggacttctcct 5444
to top
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 308    tccgagcgtgatgccgatga 327
              ||||||||||||||||||||
Sbjct: 407531 tccgagcgtgatgccgatga 407550
to top
>gb|AC148832.5| Pan troglodytes BAC clone CH251-48K6 from chromosome 7, complete
             sequence
          Length = 186606

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    ccaacaccaaagaaaaatta 75
             ||||||||||||||||||||
Sbjct: 46922 ccaacaccaaagaaaaatta 46941
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 553     tgaggttcatgtgcggcacc 572
               ||||||||||||||||||||
Sbjct: 4887799 tgaggttcatgtgcggcacc 4887780
to top
>dbj|AK127135.1| Homo sapiens cDNA FLJ45192 fis, clone BRAWH3049544, weakly  similar
           to Polypeptide N-acetylgalactosaminyltransferase (EC
           2.4.1.41)
          Length = 3938

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 270 cccggcggcggcagcagctc 289
           ||||||||||||||||||||
Sbjct: 20  cccggcggcggcagcagctc 1
to top
>dbj|AB234902.1| Verbena x hybrida mRNA for Cinnamic acid 4-hydroxylase, complete cds,
            cultivar: Tapien Pink
          Length = 1768

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 315  gtgatgccgatgatgggcagcgcgaggatgatcccggggcagct 358
            |||||||| | |||||||||||| || || || |||||||||||
Sbjct: 1434 gtgatgcccaggatgggcagcgcaagaataattccggggcagct 1391
to top
>gb|U93215.3| Arabidopsis thaliana chromosome 2 BAC T6B20 genomic sequence, complete
             sequence
          Length = 104861

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 522   gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
             ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 59169 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 59114
to top
>gb|AF368379.1| Nicotiana tabacum elicitor-inducible cytochrome P450 (CYP73A28) mRNA,
            complete cds
          Length = 1693

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 330  ggcagcgcgaggatgatcccggggcagctccg 361
            ||||| || |||||||| ||||||||||||||
Sbjct: 1470 ggcagtgcaaggatgattccggggcagctccg 1439
to top
>gb|AF368378.1| Nicotiana tabacum elicitor-inducible cytochrome P450 (CYP73A27) mRNA,
            complete cds
          Length = 1745

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 330  ggcagcgcgaggatgatcccggggcagctccg 361
            ||||| || |||||||| ||||||||||||||
Sbjct: 1470 ggcagtgcaaggatgattccggggcagctccg 1439
to top
>dbj|AK158026.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930017K03 product:LOC92979 protein
           (Fragment) homolog [Homo sapiens], full insert sequence
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 267 tgccccggcggcggcagcag 286
           ||||||||||||||||||||
Sbjct: 271 tgccccggcggcggcagcag 290
to top
>gb|AY065145.1| Arabidopsis thaliana cinnamate-4-hydroxylase (At2g30490; T6B20.16)
            mRNA, complete cds
          Length = 1794

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1259 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1204
to top
>gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex BAC MMU235E11, complete
             sequence
          Length = 159875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   gctgaactgccctggcttct 246
             ||||||||||||||||||||
Sbjct: 47514 gctgaactgccctggcttct 47495
to top
>gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex BAC MMU009PO6, complete
              sequence
          Length = 191271

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    gctgaactgccctggcttct 246
              ||||||||||||||||||||
Sbjct: 177899 gctgaactgccctggcttct 177880
to top
>gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex BAC MMU007F01,
            complete sequence
          Length = 176267

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 227  gctgaactgccctggcttct 246
            ||||||||||||||||||||
Sbjct: 2794 gctgaactgccctggcttct 2775
to top
>emb|BX819707.1|CNS0AA1Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS19ZE10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1751

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1246 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1191
to top
>emb|BX820902.1|CNS0A9NW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH7ZF08 of Hormone Treated Callus of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1679

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1223 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1168
to top
>gb|AC113052.10| Mus musculus chromosome 5, clone RP23-250D22, complete sequence
          Length = 193698

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 428   gaggaagcgctcgggcctga 447
             ||||||||||||||||||||
Sbjct: 73844 gaggaagcgctcgggcctga 73825
to top
>dbj|D78596.1| Arabidopsis thaliana mRNA for trans-cinnamate 4-hydroxylase, complete
            cds
          Length = 1711

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1228 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1173
to top
>gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1) mRNA, complete cds
          Length = 1946

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 251  ggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctg 298
            |||||||| ||||  ||| || ||||| ||||| ||||||||||||||
Sbjct: 1737 ggtgtcgagcttggactgtcctggcggaggcagaagctcgaagttctg 1690
to top
>gb|U37235.1|ATU37235 Arabidopsis thaliana cinnamate 4-hydroxylase (CYP73A5) mRNA, complete
            cds
          Length = 1735

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1220 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1165
to top
>ref|NM_001033262.1| Mus musculus membrane-associated ring finger (C3HC4) 9 (March9),
           mRNA
          Length = 2001

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 267 tgccccggcggcggcagcag 286
           ||||||||||||||||||||
Sbjct: 271 tgccccggcggcggcagcag 290
to top
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 268  gccccggcggcggcagcagc 287
            ||||||||||||||||||||
Sbjct: 2637 gccccggcggcggcagcagc 2656
to top
>gb|AC131760.4| Mus musculus BAC clone RP24-220M2 from 10, complete sequence
          Length = 173472

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 267    tgccccggcggcggcagcag 286
              ||||||||||||||||||||
Sbjct: 102945 tgccccggcggcggcagcag 102964
to top
>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence
          Length = 159173

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   tgccccggcggcggcagcag 286
             ||||||||||||||||||||
Sbjct: 25079 tgccccggcggcggcagcag 25098
to top
>emb|CR848818.10| Zebrafish DNA sequence from clone DKEY-38O19 in linkage group 16,
           complete sequence
          Length = 208738

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 catgaccgagatctgaactc 173
           ||||||||||||||||||||
Sbjct: 273 catgaccgagatctgaactc 254
to top
>gb|U71081.1|ATU71081 Arabidopsis thaliana cinnamate-4-hydroxylase (atC4H) mRNA, complete
            cds
          Length = 1727

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 1227 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 1172
to top
>gb|U71080.1|ATU71080 Arabidopsis thaliana cinnamate-4-hydroxylase (atC4H) gene, complete
            cds
          Length = 5432

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 522  gggatgtcgtaaccggcgagcttggcatcgctgaggttcatgtgcggcaccaggag 577
            ||||| ||||| || |||||||| |||||   |||||||||||| ||||| |||||
Sbjct: 4428 gggatatcgtagccagcgagcttcgcatcatggaggttcatgtgaggcacgaggag 4373
to top
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 313     gcgtgatgccgatgatgggc 332
               ||||||||||||||||||||
Sbjct: 2513672 gcgtgatgccgatgatgggc 2513653


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,594,365
Number of Sequences: 3902068
Number of extensions: 4594365
Number of successful extensions: 110153
Number of sequences better than 10.0: 106
Number of HSP's better than 10.0 without gapping: 108
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108884
Number of HSP's gapped (non-prelim): 1266
length of query: 577
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 554
effective length of database: 17,143,297,704
effective search space: 9497386928016
effective search space used: 9497386928016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top