ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags28a07 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B Length = 712 Score = 607 bits (306), Expect = e-170 Identities = 396/425 (93%), Gaps = 7/425 (1%) Strand = Plus / Minus Query: 32 tgaggcaagcaccgttactatttctcgagatccagaaacatggcgatgcgattcttgcac 91 ||||||| ||||||||||||||||||||||||||||||||| || |||||||||| ||| Sbjct: 643 tgaggcaggcaccgttactatttctcgagatccagaaacatcacggtgcgattcttacac 584 Query: 92 gatagcacggccacaaacacacacagacggggcacctaagactacggaacacaggagcag 151 ||| ||||||||||||||||| | ||| | |||| ||||| |||||||||||| Sbjct: 583 gattacacggccacaaacacacccggacag-----ctaa--ctacgagacacaggagcag 531 Query: 152 gaacagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgct 211 || || ||| || |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 530 gagcactctacgaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgct 471 Query: 212 tggcaagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatgg 271 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 470 tggcgagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatgg 411 Query: 272 tgggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgt 331 |||||||||||||||| || || ||||||||||||||||||||||||||||||||||||| Sbjct: 410 tgggcttcttgttgtaccgcgccagcttggcggcctcgccggcgagcttctcgaagatgt 351 Query: 332 cgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgca 391 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 350 cgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgaa 291 Query: 392 cctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttct 451 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 290 cctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttct 231 Query: 452 tcttg 456 ||||| Sbjct: 230 tcttg 226
>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds Length = 592 Score = 535 bits (270), Expect = e-149 Identities = 285/290 (98%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 472 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 413 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 412 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 353 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 352 tagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 293 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 292 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 233 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 232 ttgaagatgtagatcttgtacgtctccacgctcttcttcgacttcttctt 183
>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA sequence Length = 940 Score = 513 bits (259), Expect = e-142 Identities = 283/291 (97%) Strand = Plus / Minus Query: 156 agcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 215 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 782 agcctaggatgaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggc 723 Query: 216 aagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 275 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 722 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 663 Query: 276 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 335 ||||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||| Sbjct: 662 cttcttgttgtagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgtt 603 Query: 336 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 602 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 543 Query: 396 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggc 446 ||| ||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 542 cttgagcaccttgaagatgtagatcttgtacgtctccacgcccttcttggc 492
>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence Length = 574 Score = 511 bits (258), Expect = e-142 Identities = 285/294 (96%) Strand = Plus / Minus Query: 160 taggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 219 ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||| Sbjct: 525 taggacgaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttggcgagc 466 Query: 220 tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 279 |||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 465 tcgccgggtagaacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 406 Query: 280 ttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 339 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 405 ttgttgtagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtcgttgatg 346 Query: 340 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 399 || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 345 aatgagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttc 286 Query: 400 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 285 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 232
>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds Length = 564 Score = 502 bits (253), Expect = e-139 Identities = 286/297 (96%) Strand = Plus / Minus Query: 159 ctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaag 218 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 414 ctaggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 355 Query: 219 ctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggctt 278 ||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||| Sbjct: 354 ctcgccggggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggctt 295 Query: 279 cttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 338 |||||||||||| || |||||||| | ||||||||||||||||||||||||||||||||| Sbjct: 294 cttgttgtagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgat 235 Query: 339 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 234 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 175 Query: 399 cagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 174 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttctt 118
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 498 bits (251), Expect = e-138 Identities = 287/299 (95%) Strand = Plus / Plus Query: 155 cagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 214 ||||||| || || |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2856594 cagcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 2856653 Query: 215 caagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| Sbjct: 2856654 caagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgg 2856713 Query: 275 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 334 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 2856714 gcttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgt 2856773 Query: 335 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 394 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 2856774 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacct 2856833 Query: 395 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||| |||||||||||||||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 2856834 gcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttccccttcttc 2856892 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2871648 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 2871589 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 2871588 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2871529 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 2871528 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 2871469 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 2871468 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2871409 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 2871408 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2871361 Score = 476 bits (240), Expect = e-131 Identities = 276/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 2673933 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 2673874 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 2673873 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2673814 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 2673813 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2673754 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 2673753 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 2673694 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 2673693 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2673646 Score = 468 bits (236), Expect = e-129 Identities = 284/300 (94%) Strand = Plus / Plus Query: 154 acagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 213 ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 2837041 acagcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttg 2837100 Query: 214 gcaagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtg 273 || |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 2837101 gcgagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtg 2837160 Query: 274 ggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 333 ||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||| || Sbjct: 2837161 ggcttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatca 2837220 Query: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 2837221 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 2837280 Query: 394 tgcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||| |||||||||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 2837281 tgcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2837340 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Plus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 2819242 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 2819301 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| Sbjct: 2819302 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 2819361 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 2819362 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2819421 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 2819422 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2819481 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 2819482 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2819529 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||| || |||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 2686256 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 2686197 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 2686196 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 2686137 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||| Sbjct: 2686136 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 2686077 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 2686076 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 2686017 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 2686016 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2685969 Score = 464 bits (234), Expect = e-127 Identities = 270/282 (95%) Strand = Plus / Plus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 2843672 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 2843731 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgg 291 |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| Sbjct: 2843732 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 2843791 Query: 292 gcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 351 ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2843792 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 2843851 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaag 411 |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct: 2843852 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 2843911 Query: 412 atgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 2843912 atgtagatcttgtaggtctcgacgctcttcttccccttcttc 2843953 Score = 377 bits (190), Expect = e-101 Identities = 238/254 (93%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||||||||||||||||||||| |||||| ||||| ||| | |||||||||||||||| Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 ||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 17421914 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 17421973 Query: 408 gaagatgtagatct 421 |||||||||||||| Sbjct: 17421974 gaagatgtagatct 17421987 Score = 347 bits (175), Expect = 2e-92 Identities = 259/287 (90%) Strand = Plus / Plus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 36007442 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 36007501 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 ||||||||||| || |||||||||||||| ||||| |||||||| ||||||||||||||| Sbjct: 36007502 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 36007561 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 36007562 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 36007621 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 36007622 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 36007681 Query: 409 aagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 || ||||||||||| || || || ||||||||||||||||||||||| Sbjct: 36007682 aaaatgtagatcttataagtttcgacgctcttcttggccttcttctt 36007728 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Plus Query: 316 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggcct 364 ||||||||||| | ||||||||||||||| |||||||| |||||||||| Sbjct: 30942127 agcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 394 tgcttcagcaccttgaagatgtagatcttgtac 426 |||||| ||||||||||||||| |||||||||| Sbjct: 30476519 tgcttctgcaccttgaagatgttgatcttgtac 30476487 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Plus Query: 409 aagatgtagatcttgtacgtctccacgctc 438 |||||||||||||||||| | ||||||||| Sbjct: 19885823 aagatgtagatcttgtacatttccacgctc 19885852 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 400 agcaccttgaagatgtagatcttgta 425 |||||||||||||| ||||||||||| Sbjct: 12269803 agcaccttgaagatatagatcttgta 12269778 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 319 ttctcgaagatgtcgttgatgaaggagtt 347 |||| |||||||||||||||||| ||||| Sbjct: 80259 ttcttgaagatgtcgttgatgaatgagtt 80287 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 402 caccttgaagatgtagatct 421 |||||||||||||||||||| Sbjct: 20051339 caccttgaagatgtagatct 20051320
>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0030H07 Length = 168253 Score = 498 bits (251), Expect = e-138 Identities = 287/299 (95%) Strand = Plus / Plus Query: 155 cagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 214 ||||||| || || |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 63592 cagcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 63651 Query: 215 caagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| Sbjct: 63652 caagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgg 63711 Query: 275 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 334 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 63712 gcttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgt 63771 Query: 335 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 394 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 63772 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacct 63831 Query: 395 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||| |||||||||||||||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 63832 gcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttccccttcttc 63890 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 78646 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 78587 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 78586 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 78527 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 78526 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 78467 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 78466 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 78407 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 78406 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 78359 Score = 468 bits (236), Expect = e-129 Identities = 284/300 (94%) Strand = Plus / Plus Query: 154 acagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 213 ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 44039 acagcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttg 44098 Query: 214 gcaagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtg 273 || |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 44099 gcgagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtg 44158 Query: 274 ggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 333 ||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||| || Sbjct: 44159 ggcttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatca 44218 Query: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 44219 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 44278 Query: 394 tgcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||| |||||||||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 44279 tgcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 44338 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Plus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 26240 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 26299 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| Sbjct: 26300 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 26359 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 26360 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 26419 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 26420 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 26479 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 26480 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 26527 Score = 464 bits (234), Expect = e-127 Identities = 270/282 (95%) Strand = Plus / Plus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 50670 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 50729 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgg 291 |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| Sbjct: 50730 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 50789 Query: 292 gcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 351 ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 50790 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 50849 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaag 411 |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct: 50850 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 50909 Query: 412 atgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 50910 atgtagatcttgtaggtctcgacgctcttcttccccttcttc 50951
>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0009G03 Length = 163526 Score = 498 bits (251), Expect = e-138 Identities = 287/299 (95%) Strand = Plus / Plus Query: 155 cagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 214 ||||||| || || |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 162271 cagcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 162330 Query: 215 caagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| Sbjct: 162331 caagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgg 162390 Query: 275 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 334 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 162391 gcttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgt 162450 Query: 335 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 394 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 162451 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacct 162510 Query: 395 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||| |||||||||||||||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 162511 gcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttccccttcttc 162569 Score = 468 bits (236), Expect = e-129 Identities = 284/300 (94%) Strand = Plus / Plus Query: 154 acagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 213 ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 142718 acagcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttg 142777 Query: 214 gcaagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtg 273 || |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 142778 gcgagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtg 142837 Query: 274 ggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcg 333 ||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||| || Sbjct: 142838 ggcttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatca 142897 Query: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 142898 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacc 142957 Query: 394 tgcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||| |||||||||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 142958 tgcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 143017 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Plus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 124919 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 124978 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| Sbjct: 124979 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 125038 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 125039 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 125098 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 125099 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 125158 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 125159 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 125206 Score = 464 bits (234), Expect = e-127 Identities = 270/282 (95%) Strand = Plus / Plus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 149349 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 149408 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgg 291 |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| Sbjct: 149409 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 149468 Query: 292 gcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 351 ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 149469 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 149528 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaag 411 |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct: 149529 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 149588 Query: 412 atgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 149589 atgtagatcttgtaggtctcgacgctcttcttccccttcttc 149630
>ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 494 bits (249), Expect = e-136 Identities = 276/285 (96%) Strand = Plus / Minus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 452 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 393 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| Sbjct: 392 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 333 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 332 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 273 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| Sbjct: 272 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 213 Query: 409 aagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 212 aagatgtagatcttgtaggtctcgacgctcttcttccccttcttc 168
>ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA Length = 468 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct: 461 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 402 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 401 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 342 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 341 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 282 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 281 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 222 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 221 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 174
>ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 459 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 452 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 393 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 392 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 332 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 273 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||| Sbjct: 272 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 213 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 212 ttgaagatgtagatcttgtaggtctccacgctcttcttccccttcttc 165
>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10, complete sequence Length = 187034 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 176400 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 176341 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 176340 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 176281 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 176280 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 176221 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||| Sbjct: 176220 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 176161 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 176160 ttgaagatgtagatcttgtaggtctccacgctcttcttccccttcttc 176113
>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08, complete sequence Length = 119500 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 27082 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 27023 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 27022 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 26963 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 26962 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 26903 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||| Sbjct: 26902 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 26843 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 26842 ttgaagatgtagatcttgtaggtctccacgctcttcttccccttcttc 26795
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 28392158 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 28392099 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 28392098 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 28392039 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 28392038 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 28391979 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||| Sbjct: 28391978 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 28391919 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 28391918 ttgaagatgtagatcttgtaggtctccacgctcttcttccccttcttc 28391871 Score = 349 bits (176), Expect = 5e-93 Identities = 266/296 (89%) Strand = Plus / Minus Query: 160 taggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 219 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 22480470 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 22480411 Query: 220 tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 279 ||||||||||||||||| || || |||||||||||||| ||||| ||||| ||||||||| Sbjct: 22480410 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 22480351 Query: 280 ttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 339 |||||||| | ||| ||| | |||||||| ||||||||||||| |||||||||| | Sbjct: 22480350 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 22480291 Query: 340 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 399 ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||| Sbjct: 22480290 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 22480231 Query: 400 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||||||||||| || || ||||||||||| ||||| ||||||||||| Sbjct: 22480230 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttctt 22480175 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Plus Query: 392 cctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttg 444 |||||||| ||||||||||||||||||| ||||| ||||||| ||||||||| Sbjct: 6896155 cctgcttctgcaccttgaagatgtagatattgtaggtctccatactcttcttg 6896207 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 315 gagcttctcgaagatgtcgttgatgaa 341 ||||||||||||||||||||||||||| Sbjct: 3720743 gagcttctcgaagatgtcgttgatgaa 3720769 Score = 48.1 bits (24), Expect = 0.025 Identities = 27/28 (96%) Strand = Plus / Plus Query: 314 cgagcttctcgaagatgtcgttgatgaa 341 ||||||||||| |||||||||||||||| Sbjct: 29356934 cgagcttctcggagatgtcgttgatgaa 29356961 Score = 48.1 bits (24), Expect = 0.025 Identities = 27/28 (96%) Strand = Plus / Minus Query: 314 cgagcttctcgaagatgtcgttgatgaa 341 |||||||||||||||||||||| ||||| Sbjct: 18422090 cgagcttctcgaagatgtcgttaatgaa 18422063 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 402 caccttgaagatgtagatcttgt 424 ||||||||||||||||||||||| Sbjct: 25447111 caccttgaagatgtagatcttgt 25447133 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 316 agcttctcgaagatgtcgttgatgaa 341 ||||||||||||||||| |||||||| Sbjct: 6238958 agcttctcgaagatgtctttgatgaa 6238933 Score = 40.1 bits (20), Expect = 6.2 Identities = 35/40 (87%) Strand = Plus / Plus Query: 314 cgagcttctcgaagatgtcgttgatgaaggagttcatgat 353 ||||||||| |||||| ||| | | ||||||||||||||| Sbjct: 6889823 cgagcttcttgaagatatcgataaagaaggagttcatgat 6889862
>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence Length = 564 Score = 490 bits (247), Expect = e-135 Identities = 286/299 (95%) Strand = Plus / Minus Query: 155 cagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 214 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 408 cagcctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 349 Query: 215 caagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 | ||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||||| Sbjct: 348 cgagctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgg 289 Query: 275 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 334 ||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||| Sbjct: 288 gcttcttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgt 229 Query: 335 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 394 ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 228 tgatgaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacct 169 Query: 395 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| Sbjct: 168 gcttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttc 110
>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221) Length = 653 Score = 490 bits (247), Expect = e-135 Identities = 286/299 (95%) Strand = Plus / Minus Query: 155 cagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 214 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 474 cagcctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 415 Query: 215 caagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 | ||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||||| Sbjct: 414 cgagctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgg 355 Query: 275 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 334 ||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||| Sbjct: 354 gcttcttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgt 295 Query: 335 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 394 ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 294 tgatgaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacct 235 Query: 395 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| Sbjct: 234 gcttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttc 176
>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds Length = 3209 Score = 488 bits (246), Expect = e-135 Identities = 279/290 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 1698 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcct 1639 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1638 gggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttcttgttg 1579 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 || || || |||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1578 taccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 1519 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1518 ttcgtgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttcagcacc 1459 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||||||||||||||||||| ||||||||||| ||||||||| Sbjct: 1458 ttgaagatgtagatcttgtacgtctccatgctcttcttggacttcttctt 1409
>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA sequence Length = 764 Score = 484 bits (244), Expect = e-133 Identities = 277/288 (96%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||| Sbjct: 545 gaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcgccg 486 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 485 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 426 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 425 taccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggag 366 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 365 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacc 306 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 305 ttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttc 258
>ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 476 bits (240), Expect = e-131 Identities = 276/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 455 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 396 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 395 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 336 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 335 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 216 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168
>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0434B04 Length = 167029 Score = 476 bits (240), Expect = e-131 Identities = 276/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 123708 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 123649 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 123648 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 123589 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 123588 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 123529 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 123528 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 123469 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 123468 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 123421 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||| || |||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 136031 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 135972 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 135971 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 135912 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||| Sbjct: 135911 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 135852 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 135851 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 135792 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 135791 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 135744
>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds Length = 678 Score = 476 bits (240), Expect = e-131 Identities = 276/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||| Sbjct: 478 gaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcgccg 419 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 418 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 359 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 358 taccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggag 299 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct: 298 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcaggacc 239 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 238 ttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttc 191
>ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 455 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 396 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 336 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 335 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 216 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168
>ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||| || |||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 455 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 396 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 336 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||| Sbjct: 335 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 276 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 216 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168
>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence Length = 789 Score = 468 bits (236), Expect = e-129 Identities = 275/288 (95%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| || || Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 342 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacctt 283 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||| ||||| ||||||||||||||||||||||||||||| Sbjct: 282 gaagatgtagattttgtaggtctccacgctcttcttggccttcttctt 235
>ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 464 bits (234), Expect = e-127 Identities = 270/282 (95%) Strand = Plus / Minus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 449 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 390 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgg 291 |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| Sbjct: 389 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 330 Query: 292 gcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 351 ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 329 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 270 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaag 411 |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct: 269 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 210 Query: 412 atgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 209 atgtagatcttgtaggtctcgacgctcttcttccccttcttc 168
>ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA Length = 453 Score = 464 bits (234), Expect = e-127 Identities = 273/286 (95%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 444 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 385 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| Sbjct: 384 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 325 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 324 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 265 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 264 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 205 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||||||| |||||||| ||||| ||||||||||||||||||||| Sbjct: 204 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttc 159
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 464 bits (234), Expect = e-127 Identities = 273/286 (95%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 24254615 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 24254556 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| Sbjct: 24254555 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 24254496 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 24254495 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 24254436 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 24254435 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 24254376 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||||||| |||||||| ||||| ||||||||||||||||||||| Sbjct: 24254375 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttc 24254330 Score = 204 bits (103), Expect = 2e-49 Identities = 142/155 (91%) Strand = Plus / Minus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 |||||||||||||||||||| | |||||||||||||| |||||||| ||||||||| || Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 |||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||| Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctc 323 |||||||||||||||||||| ||| | |||||||| Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagcttctc 24250959 Score = 97.6 bits (49), Expect = 3e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 316 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 375 ||||||| ||||||| ||||||||||||||||||| |||||||||||||| ||||| ||| Sbjct: 21802131 agcttcttgaagatgccgttgatgaaggagttcataatggacatggccttagaggatatg 21802072 Query: 376 ccgatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacg 435 || |||| || | || |||||| |||||||| || ||||||||||| |||||||| Sbjct: 21802071 ccaatgttcatatgtatctacttcagtaccttgaacatatagatcttgtatgtctccaca 21802012 Query: 436 ctctt 440 ||||| Sbjct: 21802011 ctctt 21802007 Score = 83.8 bits (42), Expect = 5e-13 Identities = 105/126 (83%) Strand = Plus / Plus Query: 319 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 378 ||||||| ||| || ||||||||||||||||||||||||||| ||||||| || ||||| Sbjct: 11770130 ttctcgaggatttcattgatgaaggagttcatgatggacatgaccttggacgatatgcca 11770189 Query: 379 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 438 || || | |||| || || ||| |||||||| |||| ||||||||| ||||| | ||| Sbjct: 11770190 atatccagatgcatctactccagtaccttgaatatgtcgatcttgtatgtctcaatactc 11770249 Query: 439 ttcttg 444 |||||| Sbjct: 11770250 ttcttg 11770255 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 334 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 383 |||||||||||||||||||||||| | |||||| ||| |||| |||||| Sbjct: 17523219 ttgatgaaggagttcatgatggacgtaaccttgggggatatgctgatgtc 17523268 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 409 aagatgtagatcttgtacgtctccacgctc 438 ||||||||||||||||||||||||| |||| Sbjct: 13970925 aagatgtagatcttgtacgtctccatgctc 13970954 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Plus Query: 315 gagcttctcgaagatgtcgttgatgaaggagttcatg 351 ||||||||||||||||| | ||| ||||||||||||| Sbjct: 11729269 gagcttctcgaagatgttgatgaagaaggagttcatg 11729305 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 412 atgtagatcttgtacgtctccacgctc 438 ||||||||||||||||| ||||||||| Sbjct: 19095973 atgtagatcttgtacgtttccacgctc 19095999 Score = 46.1 bits (23), Expect = 0.10 Identities = 32/35 (91%) Strand = Plus / Plus Query: 404 ccttgaagatgtagatcttgtacgtctccacgctc 438 |||| ||||||||||||||||| ||||| |||||| Sbjct: 2876125 cctttaagatgtagatcttgtaggtctctacgctc 2876159 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Plus Query: 316 agcttctcgaagatgtcgttgatgaa 341 ||||||||||||||||| |||||||| Sbjct: 19095814 agcttctcgaagatgtctttgatgaa 19095839 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 319 ttctcgaagatgtcgttgatgaagga 344 |||||||||||||||||| ||||||| Sbjct: 15287651 ttctcgaagatgtcgttggtgaagga 15287626 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 312 ggcgagcttctcgaagatgtcgttgatga 340 ||||||||||| ||||||||| ||||||| Sbjct: 24608038 ggcgagcttcttgaagatgtctttgatga 24608066 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 318 cttctcgaagatgtcgttgatgaa 341 ||||||||||||||| |||||||| Sbjct: 13969661 cttctcgaagatgtcattgatgaa 13969684 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 438 cttcttggccttcttcttgg 457 |||||||||||||||||||| Sbjct: 13671170 cttcttggccttcttcttgg 13671151
>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0605H02 Length = 175547 Score = 464 bits (234), Expect = e-127 Identities = 273/286 (95%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 120954 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 120895 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| Sbjct: 120894 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 120835 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 120834 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 120775 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 120774 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 120715 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 ||||||||| |||||||| ||||| ||||||||||||||||||||| Sbjct: 120714 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttc 120669 Score = 204 bits (103), Expect = 2e-49 Identities = 142/155 (91%) Strand = Plus / Minus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 |||||||||||||||||||| | |||||||||||||| |||||||| ||||||||| || Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 |||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||| Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctc 323 |||||||||||||||||||| ||| | |||||||| Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagcttctc 117298
>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds Length = 552 Score = 464 bits (234), Expect = e-127 Identities = 270/282 (95%) Strand = Plus / Minus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 465 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 406 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgg 291 |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| Sbjct: 405 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 346 Query: 292 gcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 351 ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 345 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 286 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaag 411 |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct: 285 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 226 Query: 412 atgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 225 atgtagatcttgtaggtctcgacgctcttcttccccttcttc 184
>ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 458 bits (231), Expect = e-126 Identities = 279/295 (94%) Strand = Plus / Minus Query: 159 ctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaag 218 |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||| || Sbjct: 462 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 403 Query: 219 ctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggctt 278 |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| Sbjct: 402 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 343 Query: 279 cttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 338 |||||||||||| ||||||||||||| ||| |||||||||||||||||||| || ||||| Sbjct: 342 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 283 Query: 339 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 398 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 282 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 223 Query: 399 cagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 222 gagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168
>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence Length = 836 Score = 452 bits (228), Expect = e-124 Identities = 273/288 (94%) Strand = Plus / Minus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 |||||||||||||| ||||| ||||| || ||||||||||||||||| ||||||||||| Sbjct: 542 gtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggt 483 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| Sbjct: 482 aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 423 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| Sbjct: 422 cgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattc 363 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| Sbjct: 362 atgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttg 303 Query: 409 aagatgtagatcttgtacgtctccacgctcttcttggccttcttcttg 456 ||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 302 aagatgtagatcttgtaggtctccacgctcttcttggctttcttcttg 255
>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3) Length = 1728 Score = 440 bits (222), Expect = e-120 Identities = 273/290 (94%) Strand = Plus / Minus Query: 163 gaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 222 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 492 gaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 433 Query: 223 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 282 ||||||||||||||||| || |||||||||||||| ||||| |||| ||||||||||||| Sbjct: 432 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttcttg 373 Query: 283 ttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 342 || ||||| || |||||||||| |||| | |||||||||||||||||||||||||||||| Sbjct: 372 ttatagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaag 313 Query: 343 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagc 402 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 312 gagttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagc 253 Query: 403 accttgaagatgtagatcttgtacgtctccacgctcttcttggccttctt 452 ||||||||||||||||||||||| ||||||||| |||||| || ||||| Sbjct: 252 accttgaagatgtagatcttgtaggtctccacggacttcttcgctttctt 203
>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence Length = 706 Score = 432 bits (218), Expect = e-118 Identities = 281/302 (93%) Strand = Plus / Minus Query: 155 cagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 214 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 518 cagcctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 459 Query: 215 caagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 | ||||| ||||| ||||||||||| ||||||||||||||||| ||||| |||||||| | Sbjct: 458 cgagctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtag 399 Query: 275 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 334 |||||||||| ||||| ||||||||||||||||| | ||||||||||||||||| |||| Sbjct: 398 gcttcttgttatagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgt 339 Query: 335 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 394 | ||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||| Sbjct: 338 taatgaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacct 279 Query: 395 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttct 454 ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 278 gcttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttct 219 Query: 455 tg 456 || Sbjct: 218 tg 217
>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds Length = 427 Score = 432 bits (218), Expect = e-118 Identities = 269/286 (94%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 ||||||||||||||||||||| || ||||||||||||||||||||||| ||||||||||| Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||| || |||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 ||||||||| ||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 169 gcgggcgaggcgtgcggcttcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 110 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 109 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 50 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 49 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 4
>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence Length = 574 Score = 430 bits (217), Expect = e-117 Identities = 280/301 (93%) Strand = Plus / Minus Query: 155 cagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 214 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 310 cagcctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttgg 251 Query: 215 caagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 | ||||| ||||| ||||||||||| ||||||||||||||||| ||||| |||||||| | Sbjct: 250 cgagctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtag 191 Query: 275 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 334 |||||||||| ||||| || |||||||||||||| | ||||||||||||||||| |||| Sbjct: 190 gcttcttgttatagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgt 131 Query: 335 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 394 | ||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||| Sbjct: 130 taatgaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacct 71 Query: 395 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttct 454 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 70 gcttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttggccttcttct 11 Query: 455 t 455 | Sbjct: 10 t 10
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 424 bits (214), Expect = e-115 Identities = 268/286 (93%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||| Sbjct: 9465144 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9465085 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 9465084 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 9465039 Score = 89.7 bits (45), Expect = 7e-15 Identities = 99/117 (84%) Strand = Plus / Plus Query: 318 cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 377 ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| Sbjct: 11567062 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgcc 11567121 Query: 378 gatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccac 434 ||||| | | | || ||||| |||||||| ||||||||||| ||||||||||| Sbjct: 11567122 aatgtccagatttatctatttcagtaccttgaatatgtagatcttatacgtctccac 11567178 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 314 cgagcttctcgaagatgtcgttgatgaaggagttcatg 351 |||||||||||||||||||| |||||||||||||||| Sbjct: 25627557 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25627594 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 403 accttgaagatgtagatcttgtacgtct 430 |||||||||||||||||||||||||||| Sbjct: 25627644 accttgaagatgtagatcttgtacgtct 25627671 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 ggcgagcttctcgaagatgtcgttgatgaa 341 |||||||||||| |||||||| |||||||| Sbjct: 23486139 ggcgagcttctcaaagatgtctttgatgaa 23486110 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 402 caccttgaagatgtagatcttgtacgtct 430 ||||||||| |||||||||||||| |||| Sbjct: 28216459 caccttgaaaatgtagatcttgtaggtct 28216431 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 406 ttgaagatgtagatcttgtacgtct 430 |||||||||||||||||||| |||| Sbjct: 27003474 ttgaagatgtagatcttgtaggtct 27003450 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 405 cttgaagatgtagatcttgtacgtc 429 |||||||||||||||||| |||||| Sbjct: 24070005 cttgaagatgtagatcttatacgtc 24069981 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 402 caccttgaagatgtagatct 421 |||||||||||||||||||| Sbjct: 27003565 caccttgaagatgtagatct 27003546
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 424 bits (214), Expect = e-115 Identities = 268/286 (93%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||| Sbjct: 162544 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 162485 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 162484 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 162439
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 424 bits (214), Expect = e-115 Identities = 268/286 (93%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||| Sbjct: 9463265 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9463206 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 453 |||||||||||||||||| ||||| ||||||||||| ||||||||| Sbjct: 9463205 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 9463160 Score = 89.7 bits (45), Expect = 7e-15 Identities = 99/117 (84%) Strand = Plus / Plus Query: 318 cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 377 ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| Sbjct: 11563825 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgcc 11563884 Query: 378 gatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccac 434 ||||| | | | || ||||| |||||||| ||||||||||| ||||||||||| Sbjct: 11563885 aatgtccagatttatctatttcagtaccttgaatatgtagatcttatacgtctccac 11563941 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 314 cgagcttctcgaagatgtcgttgatgaaggagttcatg 351 |||||||||||||||||||| |||||||||||||||| Sbjct: 25718866 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25718903 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 403 accttgaagatgtagatcttgtacgtct 430 |||||||||||||||||||||||||||| Sbjct: 25718953 accttgaagatgtagatcttgtacgtct 25718980 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 ggcgagcttctcgaagatgtcgttgatgaa 341 |||||||||||| |||||||| |||||||| Sbjct: 23479167 ggcgagcttctcaaagatgtctttgatgaa 23479138 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 402 caccttgaagatgtagatcttgtacgtct 430 ||||||||| |||||||||||||| |||| Sbjct: 28307783 caccttgaaaatgtagatcttgtaggtct 28307755 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 406 ttgaagatgtagatcttgtacgtct 430 |||||||||||||||||||| |||| Sbjct: 27094797 ttgaagatgtagatcttgtaggtct 27094773 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 405 cttgaagatgtagatcttgtacgtc 429 |||||||||||||||||| |||||| Sbjct: 23987474 cttgaagatgtagatcttatacgtc 23987450 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 402 caccttgaagatgtagatct 421 |||||||||||||||||||| Sbjct: 27094888 caccttgaagatgtagatct 27094869
>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4) Length = 2361 Score = 420 bits (212), Expect = e-114 Identities = 266/284 (93%) Strand = Plus / Minus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 |||||||| ||||||||||||||||||||||||||||||||||| |||||||| || ||| Sbjct: 1365 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 1306 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgg 291 |||||||| || || ||||||||||||||||| || |||||||||||||||||||||||| Sbjct: 1305 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 1246 Query: 292 gcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 351 |||||||||||||||||| | || |||||||||||||||||||||||||||||||||||| Sbjct: 1245 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 1186 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaag 411 ||||||||||||||||| ||||| || ||||| |||||||||||||| |||||||||||| Sbjct: 1185 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 1126 Query: 412 atgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 1125 atgtagatcttgtacgtctcgacgctcttcttggccttcttctt 1082
>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214) Length = 580 Score = 418 bits (211), Expect = e-114 Identities = 268/287 (93%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 ||||||||||| || |||||||| |||||||||||||||||||||||||| ||||| ||| Sbjct: 452 gaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcgagctccccg 393 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 |||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 392 gggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||||| || |||||||||| |||| | ||||||||||||||||||||||||||||||||| Sbjct: 332 tagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaaggag 273 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 272 ttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcacc 213 Query: 406 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttctt 452 |||||||||||||||||||| ||||||||| |||||| |||||||| Sbjct: 212 ttgaagatgtagatcttgtaggtctccacggacttcttcgccttctt 166
>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence Length = 568 Score = 404 bits (204), Expect = e-109 Identities = 267/288 (92%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggg 267 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 |||||||||||| ||||||||||||||||| |||||||| ||||| |||||||||||||| Sbjct: 266 gaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggcttcttgttgta 207 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 || || |||||||| ||||| | || |||||||||||||||||||||||||||||||| Sbjct: 206 ccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttgatgaaggagtt 147 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| Sbjct: 146 catgatggacatggccttggacgagatgccaatgtccgggtgcacctgcttcagcacctt 87 Query: 408 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 ||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 86 gaagatgtagatcttgtacgtctccaccgacttctttgccttcttctt 39
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 377 bits (190), Expect = e-101 Identities = 238/254 (93%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||||||||||||||||||||| |||||| ||||| ||| | |||||||||||||||| Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 ||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 75306 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 75365 Query: 408 gaagatgtagatct 421 |||||||||||||| Sbjct: 75366 gaagatgtagatct 75379
>ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 375 Score = 349 bits (176), Expect = 5e-93 Identities = 266/296 (89%) Strand = Plus / Minus Query: 160 taggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 219 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 374 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 315 Query: 220 tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 279 ||||||||||||||||| || || |||||||||||||| ||||| ||||| ||||||||| Sbjct: 314 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 255 Query: 280 ttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 339 |||||||| | ||| ||| | |||||||| ||||||||||||| |||||||||| | Sbjct: 254 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 195 Query: 340 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 399 ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||| Sbjct: 194 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 135 Query: 400 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||||||||||| || || ||||||||||| ||||| ||||||||||| Sbjct: 134 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttctt 79
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 349 bits (176), Expect = 5e-93 Identities = 266/296 (89%) Strand = Plus / Minus Query: 160 taggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 219 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 69877 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 69818 Query: 220 tcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttc 279 ||||||||||||||||| || || |||||||||||||| ||||| ||||| ||||||||| Sbjct: 69817 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 69758 Query: 280 ttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 339 |||||||| | ||| ||| | |||||||| ||||||||||||| |||||||||| | Sbjct: 69757 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 69698 Query: 340 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 399 ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||| Sbjct: 69697 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 69638 Query: 400 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 |||||||||||||||||||| || || ||||||||||| ||||| ||||||||||| Sbjct: 69637 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttctt 69582
>ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 420 Score = 347 bits (175), Expect = 2e-92 Identities = 259/287 (90%) Strand = Plus / Minus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 410 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 351 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 ||||||||||| || |||||||||||||| ||||| |||||||| ||||||||||||||| Sbjct: 350 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 291 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 290 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 231 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 230 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 171 Query: 409 aagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 || ||||||||||| || || || ||||||||||||||||||||||| Sbjct: 170 aaaatgtagatcttataagtttcgacgctcttcttggccttcttctt 124
>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408C03 Length = 141273 Score = 347 bits (175), Expect = 2e-92 Identities = 259/287 (90%) Strand = Plus / Plus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 20167 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 20226 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 ||||||||||| || |||||||||||||| ||||| |||||||| ||||||||||||||| Sbjct: 20227 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 20286 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 20287 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 20346 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 20347 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 20406 Query: 409 aagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 || ||||||||||| || || || ||||||||||||||||||||||| Sbjct: 20407 aaaatgtagatcttataagtttcgacgctcttcttggccttcttctt 20453
>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0031D11 Length = 138108 Score = 347 bits (175), Expect = 2e-92 Identities = 259/287 (90%) Strand = Plus / Plus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Sbjct: 106120 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 106179 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 ||||||||||| || |||||||||||||| ||||| |||||||| ||||||||||||||| Sbjct: 106180 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 106239 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 106240 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 106299 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 106300 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 106359 Query: 409 aagatgtagatcttgtacgtctccacgctcttcttggccttcttctt 455 || ||||||||||| || || || ||||||||||||||||||||||| Sbjct: 106360 aaaatgtagatcttataagtttcgacgctcttcttggccttcttctt 106406
>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B Length = 492 Score = 329 bits (166), Expect = 5e-87 Identities = 247/274 (90%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||||||| | |||||||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 |||||| || || |||||| ||| |||||||||||||||||||||||||| ||||| Sbjct: 332 gcgggccaggcgggaggcctcctgggccagcttctcgaagatgtcgttgatgaacgagtt 273 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| ||| |||||| ||||| |||||||| ||||| ||||||||||| ||||| Sbjct: 272 catgatccccatcgccttgctcgagatcccgatgtccgggtggacctgcttcaggacctt 213 Query: 408 gaagatgtagatcttgtacgtctccacgctcttc 441 |||||||||||||||||||||||||||||||||| Sbjct: 212 gaagatgtagatcttgtacgtctccacgctcttc 179
>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds Length = 627 Score = 305 bits (154), Expect = 7e-80 Identities = 244/274 (89%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||| Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||| ||||| | |||||||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 |||||| || | || ||| |||||||||||||||||||||||||||||||||||| Sbjct: 399 gcgggccaggcgagaggactcctgggcgagcttctcgaagatgtcgttgatgaaggagtt 340 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||| ||||| || ||||| ||||| ||||||||||||||||| Sbjct: 339 catgatccccatggccttgctcgagatccctatgtccgggtggacctgcttcagcacctt 280 Query: 408 gaagatgtagatcttgtacgtctccacgctcttc 441 ||| ||||||||||||||||||||||||| |||| Sbjct: 279 gaatatgtagatcttgtacgtctccacgcccttc 246
>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds Length = 2901 Score = 303 bits (153), Expect = 3e-79 Identities = 249/281 (88%) Strand = Plus / Minus Query: 176 tggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacga 235 |||| ||||||||||| |||||||||||||||||||||||||||||||| || | ||| | Sbjct: 1985 tggtaacggccttggttccctcggagacggcgtgcttggcaagctcgcctggaaagacaa 1926 Query: 236 ggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcga 295 |||| |||| |||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 1925 ggcgcacggcagtctggatctcccgagaggtgatggtgggcttcttgttgtagcgtgcga 1866 Query: 296 gcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatgg 355 |||| || | ||| ||||||||||||||||||||||||||||||| |||||| ||||||| Sbjct: 1865 gctttgccgactctccggcgagcttctcgaagatgtcgttgatgatggagttgatgatgg 1806 Query: 356 acatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatgt 415 |||| | ||||||||||| || |||| |||| | |||||| |||||||||||||||| Sbjct: 1805 acattgatttggaggagatacccatgttcgggtcaatctgcttgagcaccttgaagatgt 1746 Query: 416 agatcttgtacgtctccacgctcttcttggccttcttcttg 456 |||||||||||||||| |||||||||||||||||||||| Sbjct: 1745 agatcttgtacgtctcgttgctcttcttggccttcttcttg 1705
>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds Length = 410 Score = 295 bits (149), Expect = 6e-77 Identities = 194/209 (92%) Strand = Plus / Minus Query: 163 gaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 222 ||||| ||||||||||||||||||||||||||||| || |||||||||||||| |||||| Sbjct: 209 gaagaagtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgagctcg 150 Query: 223 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 282 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 149 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 90 Query: 283 ttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 342 ||||| | |||||||||||||| ||| || || | ||||||||||||||| |||||||| Sbjct: 89 ttgtacctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgatgaag 30 Query: 343 gagttcatgatggacatggccttggagga 371 ||||||||||||||||||||| ||||||| Sbjct: 29 gagttcatgatggacatggccctggagga 1
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 258 bits (130), Expect = 1e-65 Identities = 235/270 (87%) Strand = Plus / Minus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||||||| Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 || || || ||||| |||| |||||||||||| ||||| || | |||||||||||||||| Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||||||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 4031 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3972 Query: 406 ttgaagatgtagatcttgtacgtctccacg 435 ||| ||||||| | |||||| ||||||||| Sbjct: 3971 ttgtagatgtacagcttgtaggtctccacg 3942
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 242 bits (122), Expect = 8e-61 Identities = 233/270 (86%) Strand = Plus / Plus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| ||||||||||||||||| || || ||||||||||| |||||||| Sbjct: 3040 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcca 3099 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 || || || ||||| |||| |||||||||||| ||||| || | |||||||||||||||| Sbjct: 3100 ggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgttg 3159 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 3160 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 3219 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 |||||||| |||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 3220 ttcatgatagacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3279 Query: 406 ttgaagatgtagatcttgtacgtctccacg 435 ||| ||||||| | |||||| ||||||||| Sbjct: 3280 ttgtagatgtacagcttgtaggtctccacg 3309
>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III), histone H2B (ch2b-III) and histone H2A (ch2a-III) genes, complete cds Length = 4582 Score = 242 bits (122), Expect = 8e-61 Identities = 233/270 (86%) Strand = Plus / Plus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| ||||||||||||||||| || || ||||||||||| ||||||||| Sbjct: 2338 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 2397 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 || || || ||||| || | |||||||||||| ||||| || | |||||||||||||||| Sbjct: 2398 ggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgttg 2457 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||| ||||||| |||||| ||| | |||||| |||||||||||||||||| | Sbjct: 2458 tagcggctcagcttggaggcctcagtggccaccttctcaaagatgtcgttgatgaagctg 2517 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||||||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 2518 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2577 Query: 406 ttgaagatgtagatcttgtacgtctccacg 435 ||| ||||||| | |||||| ||||||||| Sbjct: 2578 ttgtagatgtacagcttgtaggtctccacg 2607
>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds Length = 375 Score = 234 bits (118), Expect = 2e-58 Identities = 133/138 (96%) Strand = Plus / Minus Query: 319 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 378 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 359 ttctcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggagatgccg 300 Query: 379 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 438 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | Sbjct: 299 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacggac 240 Query: 439 ttcttggccttcttcttg 456 ||||| |||||||||||| Sbjct: 239 ttctttgccttcttcttg 222
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 226 bits (114), Expect = 5e-56 Identities = 231/270 (85%) Strand = Plus / Plus Query: 166 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 225 |||||||||||||| ||||||||||||||||| || || |||||||| || ||||| ||| Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515 Query: 226 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 285 || || || ||||| |||| |||||||||||| || || || | |||||||||||||||| Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 |||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||||||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 2636 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2695 Query: 406 ttgaagatgtagatcttgtacgtctccacg 435 ||| | ||||| | |||||| ||||||||| Sbjct: 2696 ttgtatatgtacagcttgtaggtctccacg 2725
>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds Length = 402 Score = 224 bits (113), Expect = 2e-55 Identities = 131/137 (95%) Strand = Plus / Minus Query: 319 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 386 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 327 Query: 379 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 438 |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| | Sbjct: 326 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacggac 267 Query: 439 ttcttggccttcttctt 455 |||||| ||||||||| Sbjct: 266 ttcttgttcttcttctt 250
>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds Length = 397 Score = 220 bits (111), Expect = 3e-54 Identities = 129/135 (95%) Strand = Plus / Minus Query: 319 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 381 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 322 Query: 379 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 438 ||||||||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||| Sbjct: 321 atgtcggggtggacctgcttgagcaccttgaaaatgtagatcttgtaggtctcgacgctc 262 Query: 439 ttcttggccttcttc 453 |||||| |||||||| Sbjct: 261 ttcttgcccttcttc 247
>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC483173), mRNA Length = 2193 Score = 216 bits (109), Expect = 5e-53 Identities = 208/241 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 266 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 265 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 206 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 205 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 146 Query: 408 g 408 | Sbjct: 145 g 145
>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC483164), mRNA Length = 659 Score = 216 bits (109), Expect = 5e-53 Identities = 208/241 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 333 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 332 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 273 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 272 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 213 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 212 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 153 Query: 408 g 408 | Sbjct: 152 g 152
>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 1 (LOC483169), mRNA Length = 432 Score = 216 bits (109), Expect = 5e-53 Identities = 208/241 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 320 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 319 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 260 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 259 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 200 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 199 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 140 Query: 408 g 408 | Sbjct: 139 g 139
>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 2 (LOC483169), mRNA Length = 516 Score = 216 bits (109), Expect = 5e-53 Identities = 208/241 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 237 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 178 Query: 408 g 408 | Sbjct: 177 g 177
>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 5 (LOC483170), mRNA Length = 415 Score = 216 bits (109), Expect = 5e-53 Identities = 208/241 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 4 (LOC483170), mRNA Length = 597 Score = 216 bits (109), Expect = 5e-53 Identities = 208/241 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 237 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 178 Query: 408 g 408 | Sbjct: 177 g 177
>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full insert sequence Length = 288 Score = 212 bits (107), Expect = 8e-52 Identities = 125/131 (95%) Strand = Plus / Minus Query: 154 acagcctaggaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 213 ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 139 acagcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttg 80 Query: 214 gcaagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtg 273 || |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 79 gcgagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtg 20 Query: 274 ggcttcttgtt 284 ||||||||||| Sbjct: 19 ggcttcttgtt 9
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 196 bits (99), Expect = 4e-47 Identities = 222/263 (84%) Strand = Plus / Minus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 |||||||||||||| ||||||||||||||||| |||||||||||||| |||||||| || Sbjct: 1583 gtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgcccgga 1524 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 || || ||||| || | ||||| || || || ||||| | ||||||||||||||||||| Sbjct: 1523 agaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggcttcttgttgtag 1464 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 ||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| |||| Sbjct: 1463 cggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgatgaagctgttc 1404 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 || || ||||||||||| ||| ||||||| | ||||||||||||||||||| ||||||| Sbjct: 1403 ataatcgacatggccttcgagctgatgccggtatcggggtgcacctgcttcaacaccttg 1344 Query: 409 aagatgtagatcttgtacgtctc 431 | ||||| | |||||| ||||| Sbjct: 1343 taaatgtaaagcttgtaggtctc 1321
>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds Length = 478 Score = 194 bits (98), Expect = 2e-46 Identities = 230/274 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 ||||||||| || ||||||||||| || || || || ||||||||||| ||||| || || Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||| ||||| | |||||||||||||| |||||||| ||||| || || ||||||||||| Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | |||||| ||| | ||| ||||||||||||||| ||||||||||||||| ||| Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||||||| |||||| |||||||| ||||| ||||||||||||||||| Sbjct: 94 catgattcccatggccttgctggagatcccgatgtcagggtggacctgcttcagcacctt 35 Query: 408 gaagatgtagatcttgtacgtctccacgctcttc 441 ||| ||||| |||||||| ||||| ||||||||| Sbjct: 34 gaaaatgtaaatcttgtaggtctcaacgctcttc 1
>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds Length = 1442 Score = 188 bits (95), Expect = 1e-44 Identities = 221/263 (84%) Strand = Plus / Minus Query: 169 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 228 |||||||||||||| |||||||| |||||||| || ||||||||||| |||||||| || Sbjct: 1264 gtgaacttggtgacagccttggttccctcggacacagcgtgcttggccagctcgcctggc 1205 Query: 229 aggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtag 288 ||||| ||||| |||| |||||||| || || ||||||| ||| |||||||||||||| Sbjct: 1204 aggacaaggcgcacggcagtctggatttcgcgagacgtgacggtcggcttcttgttgtaa 1145 Query: 289 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 348 ||| ||||| | |||||| ||||| |||||| || ||||||||||||||| |||| Sbjct: 1144 cggctaagctttgaagcctcggtggcgaccttctcaaatatgtcgttgatgaagctgttc 1085 Query: 349 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||| ||| ||||||||| ||||||| |||| ||||||||||||||||||||||| Sbjct: 1084 atgatgctcatcgccttggagctgatgccggtgtcagggtgcacctgcttcagcacctta 1025 Query: 409 aagatgtagatcttgtacgtctc 431 ||||||| | |||||| ||||| Sbjct: 1024 tagatgtacagcttgtaggtctc 1002
>ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA Length = 452 Score = 184 bits (93), Expect = 2e-43 Identities = 204/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | || |||||||||||||||| ||||||||| Sbjct: 332 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 273 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 272 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 213 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 212 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 153 Query: 408 g 408 | Sbjct: 152 g 152
>gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds Length = 435 Score = 184 bits (93), Expect = 2e-43 Identities = 204/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 391 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 332 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | || |||||||||||||||| ||||||||| Sbjct: 331 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 272 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 271 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 212 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 211 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 152 Query: 408 g 408 | Sbjct: 151 g 151
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 184 bits (93), Expect = 2e-43 Identities = 204/241 (84%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 99867 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 99926 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | || |||||||||||||||| ||||||||| Sbjct: 99927 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 99986 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 99987 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 100046 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 100047 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 100106 Query: 408 g 408 | Sbjct: 100107 g 100107 Score = 163 bits (82), Expect = 6e-37 Identities = 203/242 (83%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 94140 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 94081 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgtt-gt 286 || | ||||| |||| ||||| | || |||||||||||||||| |||||| || Sbjct: 94080 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgtttgt 94021 Query: 287 agcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 346 || | || || || |||||||| ||||| |||||||||||| |||| |||||||| Sbjct: 94020 agtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagt 93961 Query: 347 tcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacct 406 |||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||| Sbjct: 93960 tcatgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacct 93901 Query: 407 tg 408 || Sbjct: 93900 tg 93899
>dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG2008321, highly similar to HISTONE H2B F Length = 2359 Score = 184 bits (93), Expect = 2e-43 Identities = 204/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | || |||||||||||||||| ||||||||| Sbjct: 332 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 273 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 272 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 213 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 212 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 153 Query: 408 g 408 | Sbjct: 152 g 152
>gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, complete cds Length = 1137 Score = 184 bits (93), Expect = 2e-43 Identities = 204/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 748 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | || |||||||||||||||| ||||||||| Sbjct: 688 cagcagcaggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 629 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 628 gtgtgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 569 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 568 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 509 Query: 408 g 408 | Sbjct: 508 g 508
>ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H2B F (H2B 291A) (LOC469702), mRNA Length = 381 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||| |||| |||||| |||||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgacagccttagtgcgctcggacacggcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| || || |||||||||||||||| ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctgcatttcgcgggacgtgatggtggagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 249 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701), mRNA Length = 399 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || Sbjct: 387 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccagg 328 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | || |||||||||||||||| ||||||||| Sbjct: 327 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 268 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || |||||||| ||||| |||||||||||| |||| ||||||||| Sbjct: 267 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 208 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 207 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 148 Query: 408 g 408 | Sbjct: 147 g 147
>ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427894), mRNA Length = 381 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427888), mRNA Length = 381 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427883), mRNA Length = 381 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 267 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 326 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 327 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 386 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 387 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 446 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 447 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 506 Query: 408 g 408 | Sbjct: 507 g 507
>emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B sequence Length = 1113 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 990 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 931 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 930 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 871 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 870 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 811 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 810 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 751 Query: 408 g 408 | Sbjct: 750 g 750
>gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds Length = 1298 Score = 176 bits (89), Expect = 4e-41 Identities = 203/241 (84%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 791 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 732 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 731 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 672 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 671 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 612 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 611 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 552 Query: 408 g 408 | Sbjct: 551 g 551
>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA Length = 414 Score = 174 bits (88), Expect = 2e-40 Identities = 205/244 (84%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 ||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||| Sbjct: 394 acttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggagga 335 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 ||||||||| |||||||| ||||| ||||| | |||||||| ||||||||||||| || Sbjct: 334 tgaggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgtaggcgg 275 Query: 293 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 352 | ||||||| ||||| |||| |||||| |||||||||| ||| ||||||| || Sbjct: 274 caagcttggaagcctcagaagcgacacgctcgaaaatgtcgttgacgaaagagttcagga 215 Query: 353 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaaga 412 |||||||||| | |||||| || |||||||||| |||||||| || |||||| ||| Sbjct: 214 tggacatggcacggttggagataccagtgtcggggtggacctgcttgaggaccttgtaga 155 Query: 413 tgta 416 |||| Sbjct: 154 tgta 151
>emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0) Length = 374 Score = 174 bits (88), Expect = 2e-40 Identities = 199/236 (84%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 258 acttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagca 199 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 || || |||| |||||||||||||| ||||||||||| | |||||||||| | | Sbjct: 198 gcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcg 139 Query: 293 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 352 | || | ||||||||||||| ||||||||||||||||| ||| |||||||||| Sbjct: 138 ccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatga 79 Query: 353 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 || |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 78 tgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 23
>emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3) Length = 1467 Score = 170 bits (86), Expect = 3e-39 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 1188 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 1129 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| ||||||||||||| ||||||||||| | ||||||||| Sbjct: 1128 cagcagcagccgcacggccntctggatctcccgcgacgtgatggtcgagcgcttgttgta 1069 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 1068 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 1009 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 1008 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 949 Query: 408 g 408 | Sbjct: 948 g 948
>gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks Length = 766 Score = 170 bits (86), Expect = 3e-39 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 490 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 431 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| ||||||||||||| ||||||||||| | ||||||||| Sbjct: 430 cagcagcagccgcacggccntctggatctcccgcgacgtgatggtcgagcgcttgttgta 371 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 370 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 311 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 310 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 251 Query: 408 g 408 | Sbjct: 250 g 250
>ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC417957), mRNA Length = 833 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 576 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 517 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 516 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 457 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 456 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 397 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 396 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 337 Query: 408 g 408 | Sbjct: 336 g 336
>ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC417956), mRNA Length = 841 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 576 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 517 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 516 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 457 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| || ||||| Sbjct: 456 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacaaacgagtt 397 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 396 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 337 Query: 408 g 408 | Sbjct: 336 g 336
>ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone 3, H2ba (LOC482202), mRNA Length = 459 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| || ||||||||||| ||||||||||| Sbjct: 384 ggtgtacttggtgacggccttggtgccctcggacaccgcgtgcttggccagctcgccggg 325 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| Sbjct: 324 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 265 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||| ||||| ||| ||||||||||||| ||| ||||| Sbjct: 264 atgcgccaggcgggaggcctcgctggcgatgcgctcaaagatgtcgttgacgaacgagtt 205 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| Sbjct: 204 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 145 Query: 408 g 408 | Sbjct: 144 g 144
>ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA Length = 381 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcagagaccgcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b Length = 842 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||| ||||||||||| ||||||||||| ||||||||||| Sbjct: 563 ggtgtacttggtgaccgccttggtaccctcggagaccgcgtgcttggccagctcgccggg 504 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 503 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 444 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 443 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 384 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 383 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 324 Query: 408 g 408 | Sbjct: 323 g 323
>emb|X05098.1|GGH2B5 Chicken histone H2B gene (pBBA-3.0) Length = 705 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||| ||||||||||| ||||||||||| ||||||||||| Sbjct: 594 ggtgtacttggtgaccgccttggtaccctcggagaccgcgtgcttggccagctcgccggg 535 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 534 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 414 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 355 Query: 408 g 408 | Sbjct: 354 g 354
>emb|X05096.1|GGH2B3 Chicken histone H2B gene (pRR3c-3.5) Length = 705 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 594 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 535 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 534 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 414 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 355 Query: 408 g 408 | Sbjct: 354 g 354
>emb|X05095.1|GGH2B2 Chicken histone H2B gene (pRR2e-3.5) Length = 705 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 594 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 535 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 534 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 414 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 355 Query: 408 g 408 | Sbjct: 354 g 354
>dbj|D70896.1| Gallus gallus DNA for histone H2B, complete cds Length = 562 Score = 168 bits (85), Expect = 1e-38 Identities = 202/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 468 ggtgtacttggtgaccgccttggtgccctcagagaccgcgtgcttggccagctcgccggg 409 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 408 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 349 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 348 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 289 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 288 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 229 Query: 408 g 408 | Sbjct: 228 g 228
>ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudogene on chromosome 1 Length = 1140 Score = 163 bits (82), Expect = 6e-37 Identities = 203/242 (83%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 751 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 692 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgtt-gt 286 || | ||||| |||| ||||| | || |||||||||||||||| |||||| || Sbjct: 691 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgtttgt 632 Query: 287 agcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 346 || | || || || |||||||| ||||| |||||||||||| |||| |||||||| Sbjct: 631 agtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagt 572 Query: 347 tcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacct 406 |||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||| Sbjct: 571 tcatgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacct 512 Query: 407 tg 408 || Sbjct: 511 tg 510
>gb|AY131980.1| Homo sapiens histone H2B (HIST3H2BA) pseudogene, complete sequence Length = 1140 Score = 163 bits (82), Expect = 6e-37 Identities = 203/242 (83%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 751 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 692 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgtt-gt 286 || | ||||| |||| ||||| | || |||||||||||||||| |||||| || Sbjct: 691 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgtttgt 632 Query: 287 agcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 346 || | || || || |||||||| ||||| |||||||||||| |||| |||||||| Sbjct: 631 agtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagt 572 Query: 347 tcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacct 406 |||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||| Sbjct: 571 tcatgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacct 512 Query: 407 tg 408 || Sbjct: 511 tg 510
>emb|AJ343028.1|HSA343028 Homo sapiens genomic sequence surrounding NotI site, clone NR1-GO20C Length = 691 Score = 163 bits (82), Expect = 6e-37 Identities = 203/242 (83%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 276 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 217 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgtt-gt 286 || | ||||| |||| ||||| | || |||||||||||||||| |||||| || Sbjct: 216 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgtttgt 157 Query: 287 agcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagt 346 || | || || || |||||||| ||||| |||||||||||| |||| |||||||| Sbjct: 156 agtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagt 97 Query: 347 tcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacct 406 |||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||| Sbjct: 96 tcatgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacct 37 Query: 407 tg 408 || Sbjct: 36 tg 35
>ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H2B (LOC462508), mRNA Length = 1026 Score = 161 bits (81), Expect = 2e-36 Identities = 201/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 461 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 402 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||| | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 401 gagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 342 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 341 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 282 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 281 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 222 Query: 408 g 408 | Sbjct: 221 g 221
>emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4) Length = 705 Score = 161 bits (81), Expect = 2e-36 Identities = 201/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 594 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 535 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 534 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||| || || |||||||| |||||||||||||||||||||||||||| Sbjct: 414 catgatgctcatggctttagatgagatgcccgtgtcggggtgcacctgcttcagcacctt 355 Query: 408 g 408 | Sbjct: 354 g 354
>emb|X05097.1|GGH2B4 Chicken histone H2B gene (pPP2d-2.3) Length = 705 Score = 161 bits (81), Expect = 2e-36 Identities = 201/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||| ||||| ||||| ||||||||||| ||||||||||| Sbjct: 594 ggtgtacttggtgaccgccttggtaccctccgagaccgcgtgcttggccagctcgccggg 535 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 534 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 414 catgatgcccatggccttggatgagatgcccgtgtcggggtgcacctgcttcagcacctt 355 Query: 408 g 408 | Sbjct: 354 g 354
>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds Length = 2297 Score = 161 bits (81), Expect = 2e-36 Identities = 201/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 1435 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 1376 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 1375 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 1316 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 1315 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 1256 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||| || || |||||||| |||||||||||||||||||||||||||| Sbjct: 1255 catgatgctcatggctttagatgagatgcccgtgtcggggtgcacctgcttcagcacctt 1196 Query: 408 g 408 | Sbjct: 1195 g 1195
>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks Length = 1564 Score = 161 bits (81), Expect = 2e-36 Identities = 201/241 (83%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 1357 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 1298 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||||| ||||||||||| | ||||||||| Sbjct: 1297 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 1238 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || | ||||||||||||| ||||||||||||||||| ||| ||||| Sbjct: 1237 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 1178 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| |||||||| |||||||||||| ||||||||||||||| Sbjct: 1177 catgatgcccatggccttggacgagatgcccgtgtcggggtgcagctgcttcagcacctt 1118 Query: 408 g 408 | Sbjct: 1117 g 1117
>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific histone 2b (LOC589998), mRNA Length = 372 Score = 159 bits (80), Expect = 1e-35 Identities = 209/252 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||| ||| ||||| | |||||||||||| ||| ||||||||| |||||||||||| Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggccttcttgttgta 241 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 || || || || ||||| ||||||| |||||||| ||||||| |||| ||| Sbjct: 240 gcctgcaaggcgggaagcctcaccggcgatacgctcgaagacatcgttgacgaagctgtt 181 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||||||| |||||| || |||||||||| || |||||||| || || Sbjct: 180 catgatggacatggccttgctggagataccagtgtcggggtgaacttgcttcagaacttt 121 Query: 408 gaagatgtagat 419 | |||||||||| Sbjct: 120 gtagatgtagat 109
>emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B sequence Length = 1017 Score = 159 bits (80), Expect = 1e-35 Identities = 194/232 (83%) Strand = Plus / Minus Query: 177 ggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacgag 236 |||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | || Sbjct: 1017 ggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccgggcagcagcag 958 Query: 237 gcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcgag 296 || |||| |||||||||||||| ||||||||||| | |||||||||| | || || Sbjct: 957 ccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgccag 898 Query: 297 cttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatgga 356 | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 897 gcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgcc 838 Query: 357 catggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 837 catggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 786
>gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds Length = 375 Score = 159 bits (80), Expect = 1e-35 Identities = 209/252 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| ||||||||||||||||| || || ||||| Sbjct: 363 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggcgagttcaccggg 304 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||| || | ||| | |||||||| ||| ||| ||||||||| |||||||||||| Sbjct: 303 gaggagaagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | |||| || || ||||| ||||||| |||||||| ||||||| |||| ||| Sbjct: 243 gtgggcaagacgggaagcctcaccggcgatgcgctcgaagacatcgttgacgaagctgtt 184 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||| ||| ||||||||| |||||||||| ||||||||||| ||||| Sbjct: 183 catgatggacatggctttgctggagatgccagtgtcggggtggacctgcttcagaacctt 124 Query: 408 gaagatgtagat 419 | |||||||||| Sbjct: 123 gtagatgtagat 112
>ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal protein L24-like; homolog of yeast ribosomal like protein 24; 60S ribosomal protein L30 isolog; my024 protein (LOC471902), mRNA Length = 1131 Score = 153 bits (77), Expect = 6e-34 Identities = 200/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| |||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || ||||||| ||||| ||||||||||||||||| ||||||||| Sbjct: 249 gtgcgccaggcgggaagcctcgcttgcgaggcgctcgaagatgtcgttgacgaaggagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| ||||||||| || ||||||||| |||||||||| ||||||||||||||||| Sbjct: 189 catgattcccatggccttagaagagatgccggtgtcggggtggacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11, DP09G08, DP35C12 of chromosome 5 of Podospora anserina Length = 322194 Score = 153 bits (77), Expect = 6e-34 Identities = 116/129 (89%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||||||||||||||| || || |||||||||||||||||||||||||| |||| Sbjct: 23470 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 23411 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||| || Sbjct: 23410 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtaggcgg 23351 Query: 293 cgagcttgg 301 | ||||||| Sbjct: 23350 caagcttgg 23342
>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora anserina Length = 103568 Score = 153 bits (77), Expect = 6e-34 Identities = 116/129 (89%) Strand = Plus / Plus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||||||||||||||| || || |||||||||||||||||||||||||| |||| Sbjct: 81641 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 81700 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||| || Sbjct: 81701 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtaggcgg 81760 Query: 293 cgagcttgg 301 | ||||||| Sbjct: 81761 caagcttgg 81769
>dbj|AP006674.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT30L06, TM0369c, complete sequence Length = 68065 Score = 149 bits (75), Expect = 9e-33 Identities = 117/131 (89%) Strand = Plus / Minus Query: 313 gcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggag 372 |||||||||||||||||||| ||||||||| ||||||||| |||||||||| |||| Sbjct: 64320 gcgagcttctcgaagatgtcattgatgaagctgttcatgatccccatggccttgctggag 64261 Query: 373 atgccgatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctcc 432 || |||||||| ||||| ||||||||||||||||||||||||||||||||||| || ||| Sbjct: 64260 attccgatgtcagggtgaacctgcttcagcaccttgaagatgtagatcttgtaagtttcc 64201 Query: 433 acgctcttctt 443 ||| ||||||| Sbjct: 64200 acgttcttctt 64190 Score = 85.7 bits (43), Expect = 1e-13 Identities = 100/119 (84%) Strand = Plus / Minus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 |||||||| || ||||||||||| || || || |||||||||||||||||||||||||| Sbjct: 64461 aacttggtaaccgccttggtgccttcagacacagcgtgcttggcaagctcgccggggaga 64402 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcg 290 || | | |||| |||||| ||||||| ||| || || || ||||||||||||||||| Sbjct: 64401 accaatctcacggcggtctgaatctccctggaggtaatcgtcggcttcttgttgtagcg 64343
>gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:112234 IMAGE:7223605), complete cds Length = 1265 Score = 147 bits (74), Expect = 4e-32 Identities = 191/230 (83%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 ||||||||||||||||| |||||||| |||||||| ||||| ||||| ||||| || | Sbjct: 388 ttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagc 329 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 || || |||| |||||||||||| | ||| |||||||||| |||||||||| ||||| Sbjct: 328 agccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcg 269 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 268 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 209 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 404 |||||||||||||||||||||| |||| || || |||||||||||||| Sbjct: 208 cccatggccttggaggagatgccggtgtcaggatggacctgcttcagcac 159
>ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA Length = 1265 Score = 147 bits (74), Expect = 4e-32 Identities = 191/230 (83%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 ||||||||||||||||| |||||||| |||||||| ||||| ||||| ||||| || | Sbjct: 388 ttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagc 329 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 || || |||| |||||||||||| | ||| |||||||||| |||||||||| ||||| Sbjct: 328 agccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcg 269 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 268 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 209 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 404 |||||||||||||||||||||| |||| || || |||||||||||||| Sbjct: 208 cccatggccttggaggagatgccggtgtcaggatggacctgcttcagcac 159
>gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125414 IMAGE:40021691), complete cds Length = 432 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125416 IMAGE:40021695), complete cds Length = 431 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125415 IMAGE:40021693), complete cds Length = 431 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6 Length = 91567 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 55422 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 55481 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 55482 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 55541 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 55542 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 55601 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 55602 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 55661 Query: 408 g 408 | Sbjct: 55662 g 55662 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||||||||||||||| ||||||||| || ||||||||| | Sbjct: 86761 ctcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaagagatgccggt 86702 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 86701 gtcggggtggacctgcttcagcaccttg 86674 Score = 103 bits (52), Expect = 5e-19 Identities = 76/84 (90%) Strand = Plus / Plus Query: 325 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 384 ||||||||||||| ||||||||||||||| ||| |||||||| ||||||||| ||||| Sbjct: 79197 aagatgtcgttgacgaaggagttcatgattcccatagccttggaagagatgccggtgtcg 79256 Query: 385 gggtgcacctgcttcagcaccttg 408 ||||| |||||||||||||||||| Sbjct: 79257 gggtggacctgcttcagcaccttg 79280 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 621 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 680 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 681 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 725 Score = 95.6 bits (48), Expect = 1e-16 Identities = 75/84 (89%) Strand = Plus / Plus Query: 325 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 384 |||||||| |||| |||||||||||||||| ||||||||| || ||||||||| ||||| Sbjct: 778 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 837 Query: 385 gggtgcacctgcttcagcaccttg 408 ||||| || ||||||||||||||| Sbjct: 838 gggtggacttgcttcagcaccttg 861 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 86914 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 86855 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||| ||| |||||||| Sbjct: 86854 aagcagcaggcgcacggcggtctggatctccctggaggtgatggt 86810 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Plus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||||||||||||||||||||| |||||||||||||| | || ||||| || | Sbjct: 79045 acttggtgacggccttggtgccctcggacacggcgtgcttggccaattccccgggtagca 79104 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggt 272 ||||| |||| ||||||||||||| || |||||||| Sbjct: 79105 gtaggcgcacggccgtctggatctccctcgaagtgatggt 79144
>ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA Length = 449 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IMAGE:3871305), with apparent retained intron Length = 2200 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 430 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 371 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 370 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 311 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 310 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 251 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 250 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 191 Query: 408 g 408 | Sbjct: 190 g 190
>gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, complete cds Length = 1137 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 690 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 629 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 570 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 569 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 510 Query: 408 g 408 | Sbjct: 509 g 509
>gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:13513 IMAGE:4132165), complete cds Length = 744 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 491 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 432 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 431 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 372 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 371 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 312 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 311 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 252 Query: 408 g 408 | Sbjct: 251 g 251
>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3 Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ, H2AFN, and H2BFN histone genes, the OR2B2 gene for olfactory receptor 2B2, histone H2B family member I pseudogene H2BFIP, a hypothetical protein pseudogene, ESTs, STSs, GSSs and CpG islands, complete sequence Length = 100374 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 2771 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 2712 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 2711 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 2652 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 2651 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 2592 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 2591 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 2532 Query: 408 g 408 | Sbjct: 2531 g 2531 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 57572 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 57513 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 57512 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 57468 Score = 95.6 bits (48), Expect = 1e-16 Identities = 75/84 (89%) Strand = Plus / Minus Query: 325 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 384 |||||||| |||| |||||||||||||||| ||||||||| || ||||||||| ||||| Sbjct: 57415 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 57356 Query: 385 gggtgcacctgcttcagcaccttg 408 ||||| || ||||||||||||||| Sbjct: 57355 gggtggacttgcttcagcaccttg 57332
>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B (LOC587419), mRNA Length = 372 Score = 145 bits (73), Expect = 1e-31 Identities = 202/245 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 ||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||| | Sbjct: 353 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggggaggagg 294 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 || | ||| | |||||||| ||| ||| |||||||| | ||||||||||||| |||| Sbjct: 293 agtctgacagcggtctggacctcacggctggtgatggtagacttcttgttgtagtgggca 234 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||| |||||| |||||||| ||||||| |||| |||||||||| Sbjct: 233 agacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaagctgttcatgatg 174 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 414 |||||||| | |||||| || |||||||||| ||||||||||| |||||| ||||| Sbjct: 173 gacatggcacggctggagataccagtgtcggggtggacctgcttcagaaccttgtagatg 114 Query: 415 tagat 419 ||||| Sbjct: 113 tagat 109
>emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene Length = 701 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 599 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 540 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 539 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 480 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 479 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 420 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 419 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 360 Query: 408 g 408 | Sbjct: 359 g 359
>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 Length = 1723 Score = 145 bits (73), Expect = 1e-31 Identities = 199/241 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || || Sbjct: 1271 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 1212 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 1211 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 1152 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| |||||||||||| |||| ||||||||| Sbjct: 1151 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 1092 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||| ||| |||||||||| ||||||||||||||||| Sbjct: 1091 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 1032 Query: 408 g 408 | Sbjct: 1031 g 1031
>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b Length = 1497 Score = 143 bits (72), Expect = 6e-31 Identities = 207/252 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 1352 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 1293 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||| ||| | |||| |||||||| ||| || |||||||||| |||||||||||| Sbjct: 1292 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 1233 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | |||| || || |||||| |||||| |||||||| ||||||| ||| ||| Sbjct: 1232 gtgggcaagacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaaactgtt 1173 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||| | ||||||||| |||| ||||| ||||||||||||||||| Sbjct: 1172 catgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcagcacctt 1113 Query: 408 gaagatgtagat 419 | |||||||||| Sbjct: 1112 gtagatgtagat 1101
>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA Length = 372 Score = 143 bits (72), Expect = 6e-31 Identities = 207/252 (82%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||| ||| | |||| |||||||| ||| || |||||||||| |||||||||||| Sbjct: 300 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 241 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | |||| || || |||||| |||||| |||||||| ||||||| ||| ||| Sbjct: 240 gtgggcaagacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaaactgtt 181 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||| | ||||||||| |||| ||||| ||||||||||||||||| Sbjct: 180 catgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcagcacctt 121 Query: 408 gaagatgtagat 419 | |||||||||| Sbjct: 120 gtagatgtagat 109
>emb|AJ329611.1|HSA329611 Homo sapiens genomic sequence surrounding NotI site, clone NR1-RI11C Length = 652 Score = 143 bits (72), Expect = 6e-31 Identities = 202/243 (83%), Gaps = 2/243 (0%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgctt-ggcaagctcgccgg 226 |||| |||||||||| ||||| ||||||||| | ||||||||||| ||| |||||||||| Sbjct: 497 ggtgtacttggtgacagccttagtgccctcgnacacggcgtgctttggccagctcgccgg 438 Query: 227 ggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgtt-g 285 | || | ||||| |||| ||||| | || |||||||||||||||| |||||| | Sbjct: 437 gcagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgtttg 378 Query: 286 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 345 ||| | || || || |||||||| ||||| |||||||||||| |||| ||||||| Sbjct: 377 tagtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggag 318 Query: 346 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 405 ||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||| Sbjct: 317 ttcatgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacc 258 Query: 406 ttg 408 ||| Sbjct: 257 ttg 255
>ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573293), mRNA Length = 501 Score = 141 bits (71), Expect = 2e-30 Identities = 191/231 (82%) Strand = Plus / Minus Query: 178 gtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacgagg 237 |||||||||||||| |||||||| |||||||| ||||| ||||| ||||| || | || Sbjct: 353 gtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagcagcagc 294 Query: 238 cggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcgagc 297 || |||| |||||||||||| | ||| |||||||||| |||||||||| ||||||| Sbjct: 293 cgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcgaga 234 Query: 298 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 357 | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 233 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 174 Query: 358 atggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||||||||||||||||||| |||| || || ||||||||||| |||||| Sbjct: 173 atggccttggaggagatgccggtgtcaggatgaacctgcttcagaaccttg 123
>ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573776), mRNA Length = 405 Score = 141 bits (71), Expect = 2e-30 Identities = 188/227 (82%) Strand = Plus / Minus Query: 178 gtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacgagg 237 ||||||||||| ||||||||||| |||||||| ||||| ||||| ||||| || | || Sbjct: 353 gtgacggccttagtgccctcggacacggcgtgtttggccagctctccgggcagcagcagc 294 Query: 238 cggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcgagc 297 || |||| |||||||||||| | ||| |||||||||| |||||||||| ||||||| Sbjct: 293 cgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtgggcgaga 234 Query: 298 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 357 | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 233 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 174 Query: 358 atggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 404 ||||||||||||||||||||| |||| || || |||||||||||||| Sbjct: 173 atggccttggaggagatgccggtgtcaggatggacctgcttcagcac 127
>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds Length = 425 Score = 133 bits (67), Expect = 6e-28 Identities = 97/107 (90%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | |||||||||| |||||||||||||||||| |||||||||| Sbjct: 309 cagcagcaggcggacggcggtctggatctcccgggaggtgatggtgg 263 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgctcatggccttggaggagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||| ||||||||| Sbjct: 156 gtcggggtggacctgcttgagcaccttg 129
>gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MGC:130255 IMAGE:40053183), complete cds Length = 465 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || | Sbjct: 445 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 386 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 385 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 326 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 325 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 266 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||| |||| || ||||||||||||||||||||| Sbjct: 265 cccatggccttggacgagatgccggtgtccggatgcacctgcttcagcaccttg 212
>gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MGC:130256 IMAGE:40053184), complete cds Length = 466 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || | Sbjct: 446 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 387 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 386 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 327 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 326 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 267 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||| |||| || ||||||||||||||||||||| Sbjct: 266 cccatggccttggacgagatgccggtgtccggatgcacctgcttcagcaccttg 213
>gb|BC051921.1| Mus musculus histone 3, H2ba, mRNA (cDNA clone MGC:62161 IMAGE:5684450), complete cds Length = 632 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || | Sbjct: 382 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 323 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 322 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 263 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 262 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 203 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||| |||| || ||||||||||||||||||||| Sbjct: 202 cccatggccttggacgagatgccggtgtccggatgcacctgcttcagcaccttg 149
>dbj|AK018765.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500011O09 product:HISTONE H2B, full insert sequence Length = 623 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || | Sbjct: 392 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 333 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 332 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 273 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 272 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 213 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||| |||| || ||||||||||||||||||||| Sbjct: 212 cccatggccttggacgagatgccggtgtccggatgcacctgcttcagcaccttg 159
>ref|NM_030082.1| Mus musculus histone 3, H2ba (Hist3h2ba), mRNA Length = 623 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || | Sbjct: 392 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 333 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 332 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 273 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 272 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 213 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||| |||| || ||||||||||||||||||||| Sbjct: 212 cccatggccttggacgagatgccggtgtccggatgcacctgcttcagcaccttg 159
>gb|AY158942.1| Mus musculus histone protein Hist3h2ba gene, complete cds Length = 1620 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || | Sbjct: 891 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 832 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 831 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 772 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 771 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 712 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||| |||| || ||||||||||||||||||||| Sbjct: 711 cccatggccttggacgagatgccggtgtccggatgcacctgcttcagcaccttg 658
>emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chromosome 11, complete sequence Length = 103129 Score = 131 bits (66), Expect = 2e-27 Identities = 192/234 (82%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| || | Sbjct: 33773 ttggtgactgccttggtgccctcggacacggcatgcttggccagctccccgggcagcagc 33714 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 33713 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 33654 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 33653 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 33594 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||| |||| || ||||||||||||||||||||| Sbjct: 33593 cccatggccttggacgagatgccggtgtccggatgcacctgcttcagcaccttg 33540 Score = 115 bits (58), Expect = 1e-22 Identities = 190/234 (81%) Strand = Plus / Plus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 |||||||| ||||||||||||||||| || || |||||||| ||||| ||||| || | Sbjct: 38539 ttggtgactgccttggtgccctcggacacagcatgcttggccagctccccgggcagcagc 38598 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| | || Sbjct: 38599 aggcgcacggctgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 38658 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || || |||||||| ||||| |||||||||||| |||| ||| |||||||||||| Sbjct: 38659 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagttcatgatg 38718 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||||||| || ||||||||| |||| || ||||||||||||||||||||| Sbjct: 38719 cccatggccttagacgagatgccggtgtccggatgcacctgcttcagcaccttg 38772
>emb|X14731.1|CMHIST2B Duck H2B histone gene Length = 1179 Score = 129 bits (65), Expect = 9e-27 Identities = 95/105 (90%) Strand = Plus / Minus Query: 304 gcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggcc 363 ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||| Sbjct: 906 gcctcgccggcgatgcgctcgaagatgtcgttgacgaaggagttcatgatgcccatggcc 847 Query: 364 ttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 846 ttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 802 Score = 95.6 bits (48), Expect = 1e-16 Identities = 57/60 (95%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1042 ggtgtacttggtgaccgccttggtgccctcggagacggcgtgcttggccagctcgccggg 983
>emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone genes L3 H2b - H2a Length = 1980 Score = 129 bits (65), Expect = 9e-27 Identities = 205/252 (81%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||| Sbjct: 286 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggn 345 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||| ||| | ||| | |||||||| ||| || |||||||||| |||||||||||| Sbjct: 346 gaggaggagtctgacagcggtctggacctcacgactggtgatggtggacttcttgttgta 405 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | |||| || || |||||| |||||| |||||||| ||||||| |||| ||| Sbjct: 406 gtgggcaaggcgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaagctgtt 465 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||| | |||||| || |||||||||| ||||||||||| ||||| Sbjct: 466 catgatggacatggcacggctggagataccagtgtcggggtgaacctgcttcagaacctt 525 Query: 408 gaagatgtagat 419 | |||||||||| Sbjct: 526 gtagatgtagat 537
>ref|XM_683203.1| PREDICTED: Danio rerio similar to histone 1, H2bg (LOC559827), mRNA Length = 516 Score = 129 bits (65), Expect = 9e-27 Identities = 194/237 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 504 ggtgtacttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccggg 445 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 444 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 385 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 384 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 325 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 404 ||||||| ||| |||||||||||||| || ||||||| || |||||||||||||| Sbjct: 324 catgatgcccatcgccttggaggagataccagtgtcgggatggacctgcttcagcac 268
>ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (predicted) (Hist3h2ba_predicted), mRNA Length = 585 Score = 129 bits (65), Expect = 9e-27 Identities = 197/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||| || || ||||| |||||||| ||||| || || Sbjct: 369 ggtgtacttggtgactgccttggtgccttccgacacggcatgcttggccagctccccagg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||| | ||| |||||||||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || |||||||| ||||| ||||||||||||||||| ||| ||||| Sbjct: 249 atgagccaggcgggaggcctcgctggcgatgcgctcgaagatgtcgttgacgaacgagtt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| |||||||||||| ||||||||| |||| ||||||||||||||||||||||| Sbjct: 189 catgatgcccatggccttggacgagatgccggtgtccgggtgcacctgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|NM_214554.1| Strongylocentrotus purpuratus late histone L3 H2b (LOC373349), mRNA Length = 372 Score = 129 bits (65), Expect = 9e-27 Identities = 205/252 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||| Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggn 301 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 ||||| ||| | ||| | |||||||| ||| || |||||||||| |||||||||||| Sbjct: 300 gaggaggagtctgacagcggtctggacctcacgactggtgatggtggacttcttgttgta 241 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | |||| || || |||||| |||||| |||||||| ||||||| |||| ||| Sbjct: 240 gtgggcaaggcgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaagctgtt 181 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||||||||||| | |||||| || |||||||||| ||||||||||| ||||| Sbjct: 180 catgatggacatggcacggctggagataccagtgtcggggtgaacctgcttcagaacctt 121 Query: 408 gaagatgtagat 419 | |||||||||| Sbjct: 120 gtagatgtagat 109
>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25, complete sequence Length = 167326 Score = 129 bits (65), Expect = 9e-27 Identities = 194/237 (81%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 107388 ggtgtacttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccggg 107447 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 107448 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 107507 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 107508 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 107567 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 404 ||||||| ||| |||||||||||||| || ||||||| || |||||||||||||| Sbjct: 107568 catgatgcccatcgccttggaggagataccagtgtcgggatggacctgcttcagcac 107624 Score = 123 bits (62), Expect = 5e-25 Identities = 197/242 (81%) Strand = Plus / Minus Query: 178 gtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacgagg 237 ||||| |||||||||||||| || |||||||| ||||| ||||| ||||| || | || Sbjct: 67908 gtgacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagcaga 67849 Query: 238 cggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcgagc 297 || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||||| Sbjct: 67848 cgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcgaga 67789 Query: 298 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 357 | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 67788 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 67729 Query: 358 atggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatgtag 417 || |||||||||||||| ||| ||||||| || |||||||||| ||||||| ||| |||| Sbjct: 67728 atcgccttggaggagataccggtgtcgggatgaacctgcttcaacaccttgtagacgtag 67669 Query: 418 at 419 || Sbjct: 67668 at 67667 Score = 119 bits (60), Expect = 8e-24 Identities = 204/252 (80%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| || |||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 81765 ggtgtacttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 81824 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 81825 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 81884 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 81885 gtgagcgagacgtgaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 81944 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| ||| |||||||||||||| || ||||||| || |||||||||| |||||| Sbjct: 81945 catgatgcccatcgccttggaggagataccagtgtcgggatgaacctgcttcaacacctt 82004 Query: 408 gaagatgtagat 419 | ||| |||||| Sbjct: 82005 gtagacgtagat 82016 Score = 113 bits (57), Expect = 5e-22 Identities = 189/233 (81%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| |||||||| || |||||||| ||||| ||||| ||||| Sbjct: 94898 ggtgtacttggtgacggcctttgtgccctcagacacggcgtgtttggccagctcaccggg 94957 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 94958 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 95017 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 95018 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 95077 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttca 400 ||||||| ||| |||||||||||||| || ||||||| || |||||||||| Sbjct: 95078 catgatgcccatcgccttggaggagataccagtgtcgggatggacctgcttca 95130 Score = 69.9 bits (35), Expect = 7e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 |||||||||||| |||| ||| |||||||||||| ||| || ||||||||||| ||| | Sbjct: 59170 ctcgaagatgtcattgacgaacgagttcatgatgcccatcgctttggaggagatcccggt 59111 Query: 381 gtcggggtgcacctgcttcagcaccttgaagatgtagat 419 ||| ||||| || ||||||| ||| ||| ||| |||||| Sbjct: 59110 gtctgggtgaacttgcttcaacactttgtagacgtagat 59072 Score = 63.9 bits (32), Expect = 4e-07 Identities = 83/100 (83%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 ||||| || |||||||||||||| || |||||||| ||||| ||||| ||||| || | Sbjct: 59316 ttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 59257 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgg 274 || || |||| |||||||||||| | ||| |||||||||| Sbjct: 59256 agacgcacggcggtctggatctctctggaagtgatggtgg 59217
>gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 H2be -like mRNA, complete sequence Length = 838 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| |||||||| | Sbjct: 263 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgcccgt 204 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 203 gtcggggtgcacctgcttcagcaccttg 176 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 416 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 357 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| |||||||||||||| || |||||||||| Sbjct: 356 cagcagcaggcgcacggccgtctggatctcccgcgaggtgatggtgg 310
>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733 IMAGE:40014260), complete cds Length = 459 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 217 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 158 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 157 gtcggggtggacctgcttcagcaccttg 130 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264
>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734 IMAGE:40014264), complete cds Length = 459 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 217 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 158 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 157 gtcggggtggacctgcttcagcaccttg 130 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264
>ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477), mRNA Length = 1068 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 103 bits (52), Expect = 5e-19 Identities = 95/108 (87%), Gaps = 1/108 (0%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacg-gccttggtgccctcggagacggcgtgcttggcaagctcgccgg 226 |||| ||||||||||| ||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 370 ggtgtacttggtgacgcgccttggtgccctcggacacggcgtgcttggccagctcgccgg 311 Query: 227 ggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 | || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 310 gcagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA Length = 753 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 231 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 172 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 171 gtcggggtggacctgcttcagcaccttg 144 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 325 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 324 cagcagcaggcgcacggccgtctggatctcgcgggaggtgatggtgg 278
>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419 IMAGE:3936695), complete cds Length = 2224 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 181 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 180 gtcggggtggacctgcttcagcaccttg 153 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 393 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 334 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 333 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 287
>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with apparent retained intron Length = 2210 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 228 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 169 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 168 gtcggggtggacctgcttcagcaccttg 141 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 381 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 322 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 321 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 275
>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA Length = 2223 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305
>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of IgG, high affinity Ia, receptor for (CD64), a novel gene similar to histone 2, H2be (HIST2H2BE), a novel gene similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for histone 2, H4, the HIST2H3C gene for histone 2, H3c, the HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene (HIST2H2BC), a novel gene similar to histone 2, H2aa (HIST2H2AA), a novel gene similar to histone 2, H3c (HIST2H3C), a novel gene similar to histone 1, H4 (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for histone 2, H2ab, a novel protein similar to histone 2, a novel gene, the SV2A gene for synaptic vesicle glycoprotein 2A, the 3' end of the SF3B4 gene for splicing factor 3b, subunit 4, 49kDa and five CpG islands, complete sequence Length = 188956 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 148135 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 148194 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 148195 gtcggggtggacctgcttcagcaccttg 148222 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 73823 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 73882 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 73883 gtcggggtggacctgcttcagcaccttg 73910 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 148041 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 148042 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 148088 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 73729 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 73730 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 73776 Score = 107 bits (54), Expect = 3e-20 Identities = 91/102 (89%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 112197 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 ||||| |||| |||||||||| ||||||||||||||||| Sbjct: 112198 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 112238 Score = 107 bits (54), Expect = 3e-20 Identities = 91/102 (89%), Gaps = 1/102 (0%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 105069 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 ||||| |||| |||||||||| ||||||||||||||||| Sbjct: 105068 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 105028 Score = 103 bits (52), Expect = 5e-19 Identities = 79/88 (89%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||| | |||||||| | Sbjct: 112285 ctcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggt 112344 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| ||| |||||||||||||| Sbjct: 112345 gtcggggtggacccgcttcagcaccttg 112372 Score = 103 bits (52), Expect = 5e-19 Identities = 79/88 (89%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||| | |||||||| | Sbjct: 104981 ctcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggt 104922 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| ||| |||||||||||||| Sbjct: 104921 gtcggggtggacccgcttcagcaccttg 104894
>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A Length = 2964 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 716 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 657 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 656 gtcggggtggacctgcttcagcaccttg 629 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 869 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 810 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 809 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 763
>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for gene HIST2H2BE, histone 2, H2be; complete cds, incl. stopcodon Length = 381 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767 IMAGE:40002353), complete cds Length = 430 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528) Length = 2237 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305
>dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU2011564, highly similar to HISTONE H2B GL105 Length = 2181 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggc 206 |||| |||||||||| ||||||||||||||||| ||||| Sbjct: 372 ggtgtacttggtgaccgccttggtgccctcggacacggc 334 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 247 gtctggatctcccgggacgtgatggtgg 274 ||||||||||| ||||| |||||||||| Sbjct: 332 gtctggatctcgcgggatgtgatggtgg 305
>ref|XM_685927.1| PREDICTED: Danio rerio similar to histone 1, H2bg (LOC562547), mRNA Length = 474 Score = 127 bits (64), Expect = 3e-26 Identities = 205/252 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| |||||||| || |||||||| ||||| ||||| ||||| Sbjct: 462 ggtgtacttggtgacggcctttgtgccctcagacacggcgtgtttggccagctctccggg 403 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || || | |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 402 cagcagcagacgcacagcggtctggatctctctggaagtgatggtggagcgcttgttgta 343 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 342 gtgagcgagacgagacgcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 283 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| ||| |||||||||||||| ||| ||||||| || |||||||||| |||||| Sbjct: 282 catgatgcccatcgccttggaggagatcccggtgtcgggatggacctgcttcaacacctt 223 Query: 408 gaagatgtagat 419 | ||| |||||| Sbjct: 222 gtagacgtagat 211
>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds Length = 1137 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 596 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 537 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 536 gtcggggtggacctgcttcagcaccttg 509 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 749 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 690 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 689 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 643
>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be (HIST2H2BE) mRNA, complete cds Length = 381 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804 IMAGE:40014249), complete cds Length = 456 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119802 IMAGE:40014245), complete cds Length = 458 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA Length = 1858 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 249 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 190 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 189 gtcggggtggacctgcttcagcaccttg 162 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296
>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639 IMAGE:5224812), complete cds Length = 1858 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 249 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 190 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 189 gtcggggtggacctgcttcagcaccttg 162 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296
>gb|AF025667.1|AF025667 Gossypium hirsutum histone H2B1 mRNA, complete cds Length = 670 Score = 127 bits (64), Expect = 3e-26 Identities = 220/272 (80%) Strand = Plus / Minus Query: 172 aacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagg 231 |||||||| ||||||||||| || || || |||||||||||||||||||| || || || Sbjct: 436 aacttggtcacggccttggtaccttcagaaacggcgtgcttggcaagctcaccaggaagt 377 Query: 232 acgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgg 291 || || | || | |||||| || |||| ||| ||||||||||| ||||||||||| | Sbjct: 376 acaagcctaacagcggtctgaatttccctggaagtgatggtgggtttcttgttgtacctc 317 Query: 292 gcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 351 |||||| | | ||| || || |||||||||||||| || |||||||| ||||||| Sbjct: 316 gcgagcctagaggcttcttgagcaagcttctcgaagatatcattgatgaaactgttcatg 257 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaag 411 || ||| || ||| ||||| |||||||| ||||| || |||||||| ||||||||| Sbjct: 256 atccccatagctttgctagagatcccgatgtcagggtgaacttgcttcaggaccttgaag 197 Query: 412 atgtagatcttgtacgtctccacgctcttctt 443 |||||||||||||| ||||| ||||||||||| Sbjct: 196 atgtagatcttgtaggtctcgacgctcttctt 165
>gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end Length = 2100 Score = 127 bits (64), Expect = 3e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 141 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 82 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 81 gtcggggtggacctgcttcagcaccttg 54 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 294 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 235 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 234 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 188
>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429558), mRNA Length = 381 Score = 125 bits (63), Expect = 1e-25 Identities = 87/95 (91%) Strand = Plus / Minus Query: 325 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 384 ||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||| Sbjct: 212 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 153 Query: 385 gggtgcacctgcttcagcaccttgaagatgtagat 419 ||||| |||||||| ||||||||| ||| |||||| Sbjct: 152 gggtggacctgctttagcaccttgtagacgtagat 118 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| |||||||||||||| || |||||||||| Sbjct: 309 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 263
>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429457), partial mRNA Length = 628 Score = 125 bits (63), Expect = 1e-25 Identities = 87/95 (91%) Strand = Plus / Minus Query: 325 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 384 ||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||| Sbjct: 459 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 400 Query: 385 gggtgcacctgcttcagcaccttgaagatgtagat 419 ||||| |||||||| ||||||||| ||| |||||| Sbjct: 399 gggtggacctgctttagcaccttgtagacgtagat 365 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 557 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| |||||||||||||| || |||||||||| Sbjct: 556 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 510
>ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-specific histone 2b (LOC488253), mRNA Length = 384 Score = 125 bits (63), Expect = 1e-25 Identities = 90/99 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160 Query: 381 gtcggggtgcacctgcttcagcaccttgaagatgtagat 419 ||||||||||||||||||||||||||| |||||||||| Sbjct: 159 gtcggggtgcacctgcttcagcaccttatagatgtagat 121 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268
>dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-13175, similar to human histone 1, H2bd (HIST1H2BD), transcript variant 2,mRNA, RefSeq: NM_138720.1 Length = 760 Score = 125 bits (63), Expect = 1e-25 Identities = 196/239 (82%), Gaps = 1/239 (0%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || || Sbjct: 415 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 356 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 355 aagcagcaggcgcacggccgtctggatctccctggaagtgatggtcgagcgcttgttgta 296 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | || || || ||||||||||||| ||||||||||||||||| |||||| || Sbjct: 295 gtgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacgaaggaatt 236 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacct 406 |||||| ||| | ||| || ||||||||| |||||||||| |||||||||||||||| Sbjct: 235 catgatccccatag-cttagaagagatgccggtgtcggggtggacctgcttcagcacct 178
>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four novel genes, a novel gene (MGC57827), a ribosomal protein L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C) pseudogene, the HIST2H2BB gene for histone 2 H2bb, the FCGR1B gene for Fc fragment of IgG high affinity Ib receptor for (CD64) and three CpG islands, complete sequence Length = 189539 Score = 123 bits (62), Expect = 5e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 159102 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 159043 Query: 381 gtcggggtgcacctgcttcagcacct 406 ||||||||| |||||||||||||||| Sbjct: 159042 gtcggggtggacctgcttcagcacct 159017 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 159196 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 159195 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 159149
>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1 Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 381 gtcggggtgcacctgcttcagcacct 406 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>ref|XM_684372.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC560974), mRNA Length = 414 Score = 123 bits (62), Expect = 5e-25 Identities = 197/242 (81%) Strand = Plus / Minus Query: 178 gtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacgagg 237 ||||| |||||||||||||| || |||||||| ||||| ||||| ||||| || | || Sbjct: 392 gtgacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagcaga 333 Query: 238 cggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcgagc 297 || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||||| Sbjct: 332 cgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcgaga 273 Query: 298 ttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatggac 357 | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| | Sbjct: 272 cgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgccc 213 Query: 358 atggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatgtag 417 || |||||||||||||| ||| ||||||| || |||||||||| ||||||| ||| |||| Sbjct: 212 atcgccttggaggagataccggtgtcgggatgaacctgcttcaacaccttgtagacgtag 153 Query: 418 at 419 || Sbjct: 152 at 151
>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1 Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 381 gtcggggtgcacctgcttcagcacct 406 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 381 gtcggggtgcacctgcttcagcacct 406 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence Length = 1137 Score = 123 bits (62), Expect = 5e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 381 gtcggggtgcacctgcttcagcacct 406 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA clone MGC:126031 IMAGE:40032208), complete cds Length = 520 Score = 123 bits (62), Expect = 5e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 225 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 166 Query: 381 gtcggggtgcacctgcttcagcacct 406 ||||||||| |||||||||||||||| Sbjct: 165 gtcggggtggacctgcttcagcacct 140 Score = 109 bits (55), Expect = 8e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 378 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 319 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 318 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 272
>ref|XM_518288.1| PREDICTED: Pan troglodytes similar to Histone H2B 291B (LOC462492), mRNA Length = 597 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 570 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 511 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 510 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 451 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 450 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 391 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 390 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 331 Query: 408 g 408 | Sbjct: 330 g 330
>ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial mRNA Length = 414 Score = 121 bits (61), Expect = 2e-24 Identities = 199/245 (81%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 ||||||| |||||||| ||||| || || || |||||||||||||||||||||||||||| Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 |||||| || |||||||||||||| || || | |||||||| ||||||||||||| | Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtaggcag 275 Query: 293 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 352 | ||||||| |||||| ||| | ||||||||| ||||||| || ||||||| || Sbjct: 274 caagcttggaagcctcggtggcaacgcgctcgaagatatcgttgacaaacgagttcagga 215 Query: 353 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaaga 412 | |||||||| | |||||| ||| | || ||||| |||||||| || |||||| ||| Sbjct: 214 tagacatggcgcggttggagataccggtatcagggtggacctgcttgaggaccttgtaga 155 Query: 413 tgtag 417 ||||| Sbjct: 154 tgtag 150
>ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial mRNA Length = 414 Score = 121 bits (61), Expect = 2e-24 Identities = 199/245 (81%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 ||||||| |||||||| ||||| || || || |||||||||||||||||||||||||||| Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 |||||| || |||||||||||||| || || | |||||||| ||||||||||||| | Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtaggcag 275 Query: 293 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 352 | ||||||| |||||| ||| | ||||||||| ||||||| || ||||||| || Sbjct: 274 caagcttggaagcctcggtggcaacgcgctcgaagatatcgttgacaaacgagttcagga 215 Query: 353 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaaga 412 | |||||||| | |||||| ||| | || ||||| |||||||| || |||||| ||| Sbjct: 214 tagacatggcgcggttggagataccggtatcagggtggacctgcttgaggaccttgtaga 155 Query: 413 tgtag 417 ||||| Sbjct: 154 tgtag 150
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 236019 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 235960 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 235959 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 235900 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 235899 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 235840 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 235839 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 235780 Query: 408 g 408 | Sbjct: 235779 g 235779 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 168164 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 168105 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 168104 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 168045 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 168044 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 167985 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 167984 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 167925 Query: 408 g 408 | Sbjct: 167924 g 167924 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||| ||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 183774 ctcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggt 183715 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||| ||||||||| Sbjct: 183714 gtcggggtggacctgctttagcaccttg 183687 Score = 103 bits (52), Expect = 5e-19 Identities = 79/88 (89%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||| |||||||| |||||||||||| ||||||||| | Sbjct: 27384 ctcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgagatgccggt 27443 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| ||||||||||| |||||| Sbjct: 27444 gtcggggtggacctgcttcagaaccttg 27471 Score = 97.6 bits (49), Expect = 3e-17 Identities = 192/237 (81%), Gaps = 2/237 (0%) Strand = Plus / Plus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||| |||||||| || ||||| || ||||||||||| ||||| ||||| || | Sbjct: 200280 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 200339 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 || || |||| |||||||||||||| ||| || ||||| | |||||||||| ||| Sbjct: 200340 gcagacgcacggcggtctggatctccctggaggtaatggtcgagcgcttgttgtagtggg 200399 Query: 293 cgagcttggcggcctcgccggcga-gcttctcgaagatgtcgttgatgaaggagttcatg 351 | || || |||||||| |||| || | |||||||||||||| | |||||| |||||| Sbjct: 200400 ccagacgggaagcctcgcctgcgatgcgt-tcgaagatgtcgttaacgaaggaattcatg 200458 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||| |||||||||||| |||||||| | |||||||| ||||| || ||||||||| Sbjct: 200459 atgcccatggccttggatgagatgccagtatcggggtgaacctgttttagcaccttg 200515 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 107478 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 107537 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 107538 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 107582 Score = 95.6 bits (48), Expect = 1e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 |||||| |||||||||| |||||||||||| || ||| |||||||| ||||||||| | Sbjct: 257191 ctcgaaaatgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggt 257132 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 257131 gtcggggtggacctgcttcagcaccttg 257104 Score = 95.6 bits (48), Expect = 1e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||| |||||||| ||| |||||||| ||||||||| | Sbjct: 142385 ctcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggt 142326 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||| || |||||||||||||||||| Sbjct: 142325 gtcgggatggacctgcttcagcaccttg 142298 Score = 93.7 bits (47), Expect = 5e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| ||||| Sbjct: 183927 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 183868 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||||| ||| |||||||||| Sbjct: 183867 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 183821 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || || Sbjct: 142538 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 142479 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 142478 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 142434 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Plus Query: 328 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcgggg 387 |||||||| | ||| || ||||||||| |||||||||||| |||||||| ||||||| Sbjct: 107638 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 107697 Query: 388 tgcacctgcttcagcaccttg 408 || ||||| |||||||||||| Sbjct: 107698 tggacctgtttcagcaccttg 107718 Score = 58.0 bits (29), Expect = 3e-05 Identities = 86/105 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||| ||||| Sbjct: 257344 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccggg 257285 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| || | || |||||||||| ||| |||||||| Sbjct: 257284 tagcagcaggcgcacagccgtttggatctccctggaagtgatggt 257240
>ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA Length = 425 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, complete cds Length = 1137 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 749 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 690 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 689 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 630 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 629 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 570 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 569 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 510 Query: 408 g 408 | Sbjct: 509 g 509
>gb|AF531288.1| Homo sapiens histone H2B (HIST1H2BE) gene, complete cds Length = 1137 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 749 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 690 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 689 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 629 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 570 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 569 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 510 Query: 408 g 408 | Sbjct: 509 g 509
>ref|XM_504425.1| Yarrowia lipolytica CLIB122, YALI0E26455g predicted mRNA Length = 420 Score = 121 bits (61), Expect = 2e-24 Identities = 175/213 (82%) Strand = Plus / Minus Query: 204 ggcgtgcttggcaagctcgccggggaggacgaggcggacggaggtctggatctcccggga 263 |||||||||||| ||||| |||||||| | ||| ||||| | |||||||||||| || || Sbjct: 369 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 310 Query: 264 cgtgatggtgggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctc 323 |||||||||| ||||||| ||||| ||| ||||||| ||||||| ||||| ||| Sbjct: 309 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 250 Query: 324 gaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 383 ||||||||||||| |||||||||||||| |||||||| || |||||| || |||| Sbjct: 249 aaagatgtcgttgacaaaggagttcatgatagacatggctcgggtggagataccagtgtc 190 Query: 384 ggggtgcacctgcttcagcaccttgaagatgta 416 ||||| |||||||||||||||| ||||||| Sbjct: 189 agggtgggtctgcttcagcaccttgtagatgta 157
>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the 3' part of the HFE gene for haemochromatosis protein, two genes for novel histone 4 family members, two genes for novel histone 1 family members, three genes for novel histone 2B family members, a gene for a novel histone 2A family member, a novel pseudogene, STSs, GSSs, ESTs and CpG islands, complete sequence Length = 101099 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 90545 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 90486 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 90485 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 90426 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 90425 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 90366 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 90365 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 90306 Query: 408 g 408 | Sbjct: 90305 g 90305 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 29859 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 29918 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 29919 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 29963 Score = 95.6 bits (48), Expect = 1e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||| |||||||| ||| |||||||| ||||||||| | Sbjct: 64766 ctcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggt 64707 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||| || |||||||||||||||||| Sbjct: 64706 gtcgggatggacctgcttcagcaccttg 64679 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || || Sbjct: 64919 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 64860 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 64859 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 64815 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Plus Query: 328 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcgggg 387 |||||||| | ||| || ||||||||| |||||||||||| |||||||| ||||||| Sbjct: 30019 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 30078 Query: 388 tgcacctgcttcagcaccttg 408 || ||||| |||||||||||| Sbjct: 30079 tggacctgtttcagcaccttg 30099
>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2 Contains seventeen histone (pseudo)genes and gene RPS10P1 (40S Ribosomal protein S10 pseudogene 1), three CpG islands, ESTs, STSs and GSSs, complete sequence Length = 89301 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 57401 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 57342 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 57341 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 57282 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 57281 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 57222 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 57221 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 57162 Query: 408 g 408 | Sbjct: 57161 g 57161 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||| ||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 5156 ctcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggt 5097 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||| ||||||||| Sbjct: 5096 gtcggggtggacctgctttagcaccttg 5069 Score = 97.6 bits (49), Expect = 3e-17 Identities = 192/237 (81%), Gaps = 2/237 (0%) Strand = Plus / Plus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||| |||||||| || ||||| || ||||||||||| ||||| ||||| || | Sbjct: 21662 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 21721 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 || || |||| |||||||||||||| ||| || ||||| | |||||||||| ||| Sbjct: 21722 gcagacgcacggcggtctggatctccctggaggtaatggtcgagcgcttgttgtagtggg 21781 Query: 293 cgagcttggcggcctcgccggcga-gcttctcgaagatgtcgttgatgaaggagttcatg 351 | || || |||||||| |||| || | |||||||||||||| | |||||| |||||| Sbjct: 21782 ccagacgggaagcctcgcctgcgatgcgt-tcgaagatgtcgttaacgaaggaattcatg 21840 Query: 352 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 ||| |||||||||||| |||||||| | |||||||| ||||| || ||||||||| Sbjct: 21841 atgcccatggccttggatgagatgccagtatcggggtgaacctgttttagcaccttg 21897 Score = 95.6 bits (48), Expect = 1e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 |||||| |||||||||| |||||||||||| || ||| |||||||| ||||||||| | Sbjct: 78573 ctcgaaaatgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggt 78514 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||||||||| |||||||||||||||||| Sbjct: 78513 gtcggggtggacctgcttcagcaccttg 78486 Score = 93.7 bits (47), Expect = 5e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| ||||| Sbjct: 5309 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 5250 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgg 274 || | ||||| |||| ||||||||||||| ||| |||||||||| Sbjct: 5249 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 5203 Score = 58.0 bits (29), Expect = 3e-05 Identities = 86/105 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||| ||||| Sbjct: 78726 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccggg 78667 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| || | || |||||||||| ||| |||||||| Sbjct: 78666 tagcagcaggcgcacagccgtttggatctccctggaagtgatggt 78622
>emb|Z80780.1|HSH2BH H.sapiens H2B/h gene Length = 990 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 771 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 712 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 711 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 652 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 651 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 592 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 591 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 532 Query: 408 g 408 | Sbjct: 531 g 531
>gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116762 IMAGE:40002316), complete cds Length = 425 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116765 IMAGE:40002319), complete cds Length = 425 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116763 IMAGE:40002317), complete cds Length = 425 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116764 IMAGE:40002318), complete cds Length = 425 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || || Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||| ||||||| ||||| || Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| ||||||||||||||| |||||||||| || |||||||||||||| Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|XM_686687.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC563318), mRNA Length = 423 Score = 121 bits (61), Expect = 2e-24 Identities = 199/245 (81%) Strand = Plus / Minus Query: 175 ttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggacg 234 ||||| || |||||||||||||| || |||||||| ||||| ||||| ||||| || | Sbjct: 404 ttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 345 Query: 235 aggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcgggcg 294 || || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||| Sbjct: 344 agacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcg 285 Query: 295 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 354 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 284 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 225 Query: 355 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 414 ||| |||||||||||||| ||| ||||||| || |||||||||| ||||||| ||| | Sbjct: 224 cccatcgccttggaggagatcccggtgtcgggatgaacctgcttcaacaccttgtagacg 165 Query: 415 tagat 419 ||||| Sbjct: 164 tagat 160
>gb|BC101750.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MGC:126799 IMAGE:8069256), complete cds Length = 497 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 435 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 376 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 375 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 316 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 315 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 256 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 255 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 196 Query: 408 g 408 | Sbjct: 195 g 195
>gb|BC101748.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MGC:126797 IMAGE:8069254), complete cds Length = 498 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 436 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 377 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 376 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 317 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 316 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 257 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 256 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 197 Query: 408 g 408 | Sbjct: 196 g 196
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 121 bits (61), Expect = 2e-24 Identities = 175/213 (82%) Strand = Plus / Plus Query: 204 ggcgtgcttggcaagctcgccggggaggacgaggcggacggaggtctggatctcccggga 263 |||||||||||| ||||| |||||||| | ||| ||||| | |||||||||||| || || Sbjct: 3141902 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 3141961 Query: 264 cgtgatggtgggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctc 323 |||||||||| ||||||| ||||| ||| ||||||| ||||||| ||||| ||| Sbjct: 3141962 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 3142021 Query: 324 gaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 383 ||||||||||||| |||||||||||||| |||||||| || |||||| || |||| Sbjct: 3142022 aaagatgtcgttgacaaaggagttcatgatagacatggctcgggtggagataccagtgtc 3142081 Query: 384 ggggtgcacctgcttcagcaccttgaagatgta 416 ||||| |||||||||||||||| ||||||| Sbjct: 3142082 agggtgggtctgcttcagcaccttgtagatgta 3142114
>ref|NM_003523.2| Homo sapiens histone 1, H2be (HIST1H2BE), mRNA Length = 435 Score = 121 bits (61), Expect = 2e-24 Identities = 196/241 (81%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | ||||| |||| ||||||||||||| ||| |||||||| | ||||||||| Sbjct: 309 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | || || || ||||||||||||| ||||||||||||||||| ||||| || Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 190 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 |||||| |||||| || |||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 189 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 130 Query: 408 g 408 | Sbjct: 129 g 129
>ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA Length = 730 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 251 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 192 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 191 gtcggggtgcacttgcttcagcaccttg 164 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 300
>ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA Length = 2436 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 437 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 378 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 377 gtcggggtgcacttgcttcagcaccttg 350 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 486
>gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MGC:70229 IMAGE:4217587), complete cds Length = 661 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 276 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 217 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 216 gtcggggtgcacttgcttcagcaccttg 189 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 325
>ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC529278), mRNA Length = 381 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 ||| ||||| |||||||||||||||||| Sbjct: 156 gtccgggtggacctgcttcagcaccttg 129 Score = 87.7 bits (44), Expect = 3e-14 Identities = 86/100 (86%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 ||||||||||||||||||||||||| || |||||||||||||| || || ||||| || | Sbjct: 364 acttggtgacggccttggtgccctcagacacggcgtgcttggccagttctccgggaagca 305 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggt 272 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 304 gcaggcgcacggccgtctggatctccctggatgtgatggt 265
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 63730 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 63789 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 63790 gtcggggtgcacttgcttcagcaccttg 63817 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 49637 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 49578 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 49577 gtcggggtgcacttgcttcagcaccttg 49550 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||| ||||||||||||||| | Sbjct: 92241 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggt 92182 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 92181 gtcggggtgcacttgcttcagcaccttg 92154 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | || |||||||||||| |||||||||||||||||||||| | Sbjct: 61403 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggagatgccggt 61344 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 61343 gtcggggtgcacttgcttcagcaccttg 61316 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 92394 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 92335 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 92334 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 92290 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 61556 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 61497 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 61496 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 61452 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 63577 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 63636 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 63637 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 63681 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 49790 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 49731 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 49730 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 49686 Score = 40.1 bits (20), Expect = 6.2 Identities = 41/48 (85%) Strand = Plus / Minus Query: 357 catggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 404 |||||||||||| |||||| |||| |||| ||||||||||||||| Sbjct: 14498 catggccttggataagatgctcatgttggggctcacctgcttcagcac 14451
>ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488309), partial mRNA Length = 705 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 174 cttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggaggac 233 ||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 363 cttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcag 304 Query: 234 gaggcggacggaggtctggatctcccgggacgtgatggt 272 ||||| |||| ||||||||||||| |||||||||||| Sbjct: 303 caggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC478743), mRNA Length = 1047 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289
>ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC478743), mRNA Length = 487 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289
>ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611482), mRNA Length = 386 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 221 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 162 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 161 gtcggggtgcacctgcttcagcaccttg 134 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 374 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 315 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 314 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 270
>ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611465), mRNA Length = 388 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272
>ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B histone family, member T (LOC488290), mRNA Length = 421 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272
>ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B histone family, member R (LOC488288), mRNA Length = 384 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 159 gtcggggtgcacctgcttcagcaccttg 132 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268
>ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC488279), mRNA Length = 513 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 285 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 226 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 225 gtcggggtgcacctgcttcagcaccttg 198 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 438 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 379 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 378 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 334
>ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488276), mRNA Length = 438 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272
>ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B histone family, member T (LOC611158), mRNA Length = 883 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 210 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 151 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 150 gtcggggtgcacctgcttcagcaccttg 123 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 304 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 303 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 259
>ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611126), mRNA Length = 751 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 242 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 183 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 182 gtcggggtgcacctgcttcagcaccttg 155 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 395 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccggg 336 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 335 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 291
>ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488296), mRNA Length = 381 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC611089), mRNA Length = 381 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-specific histone 2b (LOC488252), mRNA Length = 384 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 159 gtcggggtgcacctgcttcagcaccttg 132 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268
>ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC608682), mRNA Length = 342 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 177 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 118 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 117 gtcggggtgcacctgcttcagcaccttg 90 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 330 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 271 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 270 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 226
>ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC608682), mRNA Length = 383 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 218 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 159 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 158 gtcggggtgcacctgcttcagcaccttg 131 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 371 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 312 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 311 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 267
>ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B histone family, member T, transcript variant 3 (LOC488303), mRNA Length = 651 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 232 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 173 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 172 gtcggggtgcacctgcttcagcaccttg 145 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 326 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 325 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 281
>ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B histone family, member T, transcript variant 2 (LOC488303), mRNA Length = 442 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC488267), mRNA Length = 440 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 224 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 165 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 164 gtcggggtgcacctgcttcagcaccttg 137 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273
>ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC488267), mRNA Length = 1108 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 224 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 165 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 164 gtcggggtgcacctgcttcagcaccttg 137 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273
>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 3 (LOC480760), mRNA Length = 862 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 615 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 556 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 555 gtcggggtgcacctgcttcagcaccttg 528 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664
>ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 2 (LOC480760), mRNA Length = 487 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289
>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 1 (LOC480760), mRNA Length = 1422 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 615 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 556 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 555 gtcggggtgcacctgcttcagcaccttg 528 Score = 113 bits (57), Expect = 5e-22 Identities = 93/105 (88%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||| |||||||||||| Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664
>ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A) (LOC665622), mRNA Length = 2266 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 297 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 238 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 237 gtcggggtgcacttgcttcagcaccttg 210 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 346
>ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A) (LOC665596), mRNA Length = 2266 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 297 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 238 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 237 gtcggggtgcacttgcttcagcaccttg 210 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 346
>gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MGC:74154 IMAGE:6742370), complete cds Length = 624 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 243 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 184 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 183 gtcggggtgcacttgcttcagcaccttg 156 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 396 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 337 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 336 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 292
>emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA Length = 724 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 220 ctcgaagatgtcgttgacgaacgagttcatgatgctcatggccttggacgagatgcccgt 161 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 160 gtcggggtgcacctgcttcagcaccttg 133 Score = 97.6 bits (49), Expect = 3e-17 Identities = 103/121 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| Sbjct: 373 ggtgtacttggtcacggccttggtgccctcggacacggcgtgcttggccagctccccggg 314 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || | |||| ||||||||||||| ||||||||||||||| ||||||||| Sbjct: 313 cagcagcagcctcacggccgtctggatctccctggacgtgatggtggggcgcttgttgta 254 Query: 288 g 288 | Sbjct: 253 g 253
>gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:19269 IMAGE:3989862), complete cds Length = 2236 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 229 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 170 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 169 gtcggggtgcacttgcttcagcaccttg 142 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 382 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 323 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 322 cagcagcaggcgcacggcagtctggatctcccgggacgtgatggt 278
>gb|AC092896.9| Homo sapiens 3 BAC RP11-274J15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 170330 Score = 119 bits (60), Expect = 8e-24 Identities = 192/236 (81%) Strand = Plus / Plus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 ||||||||| |||||||||||||||||| |||||||||||||| | ||| |||| || | Sbjct: 98707 acttggtgatggccttggtgccctcggacacggcgtgcttggccacctcctcgggcagca 98766 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtagcggg 292 ||||| ||| ||||||||||||| ||| |||||||| | ||||||||| | | Sbjct: 98767 gcaggcgctcggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcg 98826 Query: 293 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 352 | || || |||||||| |||| | ||| ||||||||||||| |||||||||||||| Sbjct: 98827 ccaggcgggaagcctcgcccgcgacgtgctcaaagatgtcgttgacgaaggagttcatga 98886 Query: 353 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 408 | ||||||||| |||||||||||| |||| | ||| |||||||||||||||||| Sbjct: 98887 tccccatggccttagaggagatgccggtgtcagagtggacctgcttcagcaccttg 98942
>emb|X07762.1|GGH2AB7 Chicken DNA for pCH22.0B histone H2A/H2B sequence Length = 751 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 751 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 692 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||||||||||||||||||| Sbjct: 691 gtcggggtgcacctgcttcagcaccttg 664
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 443 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 502 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 503 gtcggggtgcacttgcttcagcaccttg 530 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 290 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 349 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 350 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 394
>emb|X02621.1|MMHISH2B Mouse gene for histone H2b Length = 688 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 386 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 327 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 326 gtcggggtgcacttgcttcagcaccttg 299 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 539 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 480 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 479 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 435
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 164862 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 164803 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 164802 gtcggggtgcacttgcttcagcaccttg 164775 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 66156 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 66215 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 66216 gtcggggtgcacttgcttcagcaccttg 66243 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 52254 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 52195 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 52194 gtcggggtgcacttgcttcagcaccttg 52167 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | || |||||||||||| |||||||||||||||||||||| | Sbjct: 54581 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggagatgccggt 54640 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 54641 gtcggggtgcacttgcttcagcaccttg 54668 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||| ||||||||||||||| | Sbjct: 23739 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggt 23798 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 23799 gtcggggtgcacttgcttcagcaccttg 23826 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 165015 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 164956 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 164955 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 164911 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 54428 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 54487 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 54488 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 54532 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 23586 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 23645 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 23646 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 23690 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 52407 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 52348 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 52347 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 52303 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 66003 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 66062 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 66063 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 66107 Score = 40.1 bits (20), Expect = 6.2 Identities = 41/48 (85%) Strand = Plus / Plus Query: 357 catggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 404 |||||||||||| |||||| |||| |||| ||||||||||||||| Sbjct: 101295 catggccttggataagatgctcatgttggggctcacctgcttcagcac 101342
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 34153 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 34094 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 34093 gtcggggtgcacttgcttcagcaccttg 34066 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 10123 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 10182 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 10183 gtcggggtgcacttgcttcagcaccttg 10210 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 34306 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 34247 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 34246 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 34202 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 9970 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 10029 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 10030 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 10074
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 53458 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 53399 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 53398 gtcggggtgcacttgcttcagcaccttg 53371 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||| ||| | Sbjct: 60801 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagataccggt 60742 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 60741 gtcggggtgcacttgcttcagcaccttg 60714 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 60954 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 60895 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 60894 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 60850 Score = 103 bits (52), Expect = 5e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 173 acttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggggagga 232 |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 53606 acttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagca 53547 Query: 233 cgaggcggacggaggtctggatctcccgggacgtgatggt 272 ||||| |||| |||||||||||||||||||||||||| Sbjct: 53546 gcaggcgcacggccgtctggatctcccgggacgtgatggt 53507
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 208720 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 208661 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 208660 gtcggggtgcacttgcttcagcaccttg 208633 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 175328 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 175269 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 175268 gtcggggtgcacttgcttcagcaccttg 175241 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 136918 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 136977 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 136978 gtcggggtgcacttgcttcagcaccttg 137005 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 143303 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 143244 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||| ||||||||| Sbjct: 143243 gtcggggtgcacttgctttagcaccttg 143216 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 208873 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 208814 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 208813 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 208769 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 175481 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 175422 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 175421 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 175377 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 143456 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 143397 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 143396 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 143352 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 136765 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 136824 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 136825 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 136869
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Plus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 141368 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 141427 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 141428 gtcggggtgcacttgcttcagcaccttg 141455 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||||||||| |||||||| || |||||||||||||| ||||| ||||| Sbjct: 141215 ggtgtacttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccggg 141274 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 141275 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 141319
>gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MGC:78105 IMAGE:4217814), complete cds Length = 657 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 223 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 164 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 163 gtcggggtgcacttgcttcagcaccttg 136 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 317 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 272
>gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:30336 IMAGE:3993954), complete cds Length = 740 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 232 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 173 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 172 gtcggggtgcacttgcttcagcaccttg 145 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 385 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 326 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 281
>ref|XM_684153.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC560748), mRNA Length = 423 Score = 119 bits (60), Expect = 8e-24 Identities = 204/252 (80%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||| || |||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 411 ggtgtacttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 352 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 287 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 351 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 292 Query: 288 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 347 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 291 gtgagcgagacgtgaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 232 Query: 348 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 407 ||||||| ||| |||||||||||||| || ||||||| || |||||||||| |||||| Sbjct: 231 catgatgcccatcgccttggaggagataccagtgtcgggatgaacctgcttcaacacctt 172 Query: 408 gaagatgtagat 419 | ||| |||||| Sbjct: 171 gtagacgtagat 160
>dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched library, clone:9830004G03 product:H2B histone family, member S, full insert sequence Length = 1257 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 245 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 186 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 185 gtcggggtgcacttgcttcagcaccttg 158 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 294
>dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630013P15 product:H2B histone family, member S, full insert sequence Length = 2410 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 410 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 351 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 350 gtcggggtgcacttgcttcagcaccttg 323 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 563 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 504 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 503 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 459
>dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500010J12 product:histone 1, H2bc, full insert sequence Length = 724 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 245 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 186 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 185 gtcggggtgcacttgcttcagcaccttg 158 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 294
>dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched library, clone:1600009N02 product:H2B histone family, member S, full insert sequence Length = 723 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 244 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 185 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 184 gtcggggtgcacttgcttcagcaccttg 157 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 338 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 337 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 293
>dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330429M17 product:H2B histone family, member S, full insert sequence Length = 2436 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 437 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 378 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 377 gtcggggtgcacttgcttcagcaccttg 350 Score = 89.7 bits (45), Expect = 7e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 486
>dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610022J01 product:H2B histone family, member S, full insert sequence Length = 730 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 251 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 192 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 191 gtcggggtgcacttgcttcagcaccttg 164 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 300
>ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA Length = 661 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 276 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 217 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 216 gtcggggtgcacttgcttcagcaccttg 189 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 325
>ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA Length = 381 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 216 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 156 gtcggggtgcacttgcttcagcaccttg 129 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| |||||||||||||||||||||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 265
>ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA Length = 381 Score = 119 bits (60), Expect = 8e-24 Identities = 81/88 (92%) Strand = Plus / Minus Query: 321 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 380 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 216 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 157 Query: 381 gtcggggtgcacctgcttcagcaccttg 408 |||||||||||| ||||||||||||||| Sbjct: 156 gtcggggtgcacttgcttcagcaccttg 129 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 168 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccggg 227 |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| ||||| Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 310 Query: 228 gaggacgaggcggacggaggtctggatctcccgggacgtgatggt 272 || | ||||| |||| ||||||||||||||||| |||||||| Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggt 265 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,997,836 Number of Sequences: 3902068 Number of extensions: 3997836 Number of successful extensions: 162745 Number of sequences better than 10.0: 1058 Number of HSP's better than 10.0 without gapping: 1101 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 156154 Number of HSP's gapped (non-prelim): 6369 length of query: 460 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 438 effective length of database: 17,147,199,772 effective search space: 7510473500136 effective search space used: 7510473500136 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
