ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags27j03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC132837.11| Mus musculus chromosome 18, clone RP24-490M12, c... 42 1.6
2emb|AL589741.11| Human DNA sequence from clone RP11-372M18 on ch... 42 1.6
3emb|AL356219.12| Human DNA sequence from clone RP11-430C15 on ch... 42 1.6
4gb|AC092810.2| Homo sapiens chromosome 1 clone RP11-385M4, compl... 42 1.6
5gb|AC005500.2| Homo sapiens 22q11 PAC Clone Clone p52f6 In DGCR ... 42 1.6
6gb|AC007731.16| Homo sapiens chromosome 22 clone b562f10 map 22q... 42 1.6
7gb|AC005719.2|AC005719 Drosophila melanogaster, chromosome 2L, r... 42 1.6
8gb|AF348119.2| Homo sapiens L-glutaminase gene, complete cds; nu... 42 1.6
9gb|AC097104.18| Homo sapiens 12 BAC RP11-153M3 (Roswell Park Can... 42 1.6
10gb|AE003664.3| Drosophila melanogaster chromosome 2L, section 73... 42 1.6
11gb|AC099795.2| Homo sapiens chromosome 1 clone RP5-848E13, compl... 42 1.6
12gb|AE001423.1| Plasmodium falciparum 3D7 chromosome 2 section 60... 40 6.4
13emb|BX908387.8| Zebrafish DNA sequence from clone DKEY-45B6 in l... 40 6.4
14gb|AC158393.2| Mus musculus BAC clone RP23-368G21 from chromosom... 40 6.4
15emb|AL591435.10| Human DNA sequence from clone RP11-712I22 on ch... 40 6.4
16gb|AC113398.3| Homo sapiens chromosome 5 clone RP11-436H11, comp... 40 6.4
17gb|DP000062.1| Sus scrofa target 117 genomic scaffold 40 6.4
18gb|AC036114.7| Homo sapiens chromosome 11, clone RP11-283H3, com... 40 6.4
19gb|DQ103595.1| Arabidopsis arenosa clone BAC 28N14, complete seq... 40 6.4
20gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, co... 40 6.4
21gb|AC152932.2| Xenopus tropicalis clone ISB1-31M3, complete sequ... 40 6.4
22gb|AC020602.6| Homo sapiens BAC clone RP11-461M18 from 2, comple... 40 6.4
23gb|AC021752.5|AC021752 Homo sapiens chromosome 15 clone CTD-2378... 40 6.4
24gb|AC109327.10| Homo sapiens chromosome 17, clone RP11-93C20, co... 40 6.4
25gb|AC022407.6|AC022407 Homo sapiens chromosome 15 clone RP11-105... 40 6.4
26gb|AY103550.1| Zea mays PCO151000 mRNA sequence 40 6.4
27emb|CT009495.13| Mouse DNA sequence from clone RP23-127E21 on ch... 40 6.4
28emb|AL831778.8| Mouse DNA sequence from clone RP23-261L23 on chr... 40 6.4

>gb|AC132837.11| Mus musculus chromosome 18, clone RP24-490M12, complete sequence
          Length = 139563

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 257   acttgttacatgaatgctaat 277
             |||||||||||||||||||||
Sbjct: 79034 acttgttacatgaatgctaat 79054



to top

>emb|AL589741.11| Human DNA sequence from clone RP11-372M18 on chromosome 1 Contains a
             novel gene and the 5' end of a novel gene, complete
             sequence
          Length = 159331

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 109   tcttaaatcttcacccaggct 129
             |||||||||||||||||||||
Sbjct: 32849 tcttaaatcttcacccaggct 32829



to top

>emb|AL356219.12| Human DNA sequence from clone RP11-430C15 on chromosome 9 Contains part
             of the PIP5K1B gene for phosphatidylinositol-4-phosphate
             5-kinase, type I, beta (MSS4, STM7) and the 5' end of a
             novel gene, complete sequence
          Length = 115469

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 138   aaaatatttcaacactgagcaatta 162
             |||||||||||| ||||||||||||
Sbjct: 52842 aaaatatttcaatactgagcaatta 52866



to top

>gb|AC092810.2| Homo sapiens chromosome 1 clone RP11-385M4, complete sequence
          Length = 173917

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 109    tcttaaatcttcacccaggct 129
              |||||||||||||||||||||
Sbjct: 152045 tcttaaatcttcacccaggct 152025



to top

>gb|AC005500.2| Homo sapiens 22q11 PAC Clone Clone p52f6 In DGCR Region, complete
              sequence
          Length = 192592

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    catcttaaatcttcacccagg 127
              |||||||||||||||||||||
Sbjct: 107177 catcttaaatcttcacccagg 107157



to top

>gb|AC007731.16| Homo sapiens chromosome 22 clone b562f10 map 22q11, complete sequence
          Length = 182617

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    catcttaaatcttcacccagg 127
              |||||||||||||||||||||
Sbjct: 112231 catcttaaatcttcacccagg 112211



to top

>gb|AC005719.2|AC005719 Drosophila melanogaster, chromosome 2L, region 38A5-38B4, BAC clone
             BACR48M05, complete sequence
          Length = 188341

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 139   aaatatttcaacactgagcaa 159
             |||||||||||||||||||||
Sbjct: 61078 aaatatttcaacactgagcaa 61058



to top

>gb|AF348119.2| Homo sapiens L-glutaminase gene, complete cds; nuclear gene for
            mitochondrial product
          Length = 18084

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 353  ctgcacttgtcataccctcct 373
            |||||||||||||||||||||
Sbjct: 7326 ctgcacttgtcataccctcct 7306



to top

>gb|AC097104.18| Homo sapiens 12 BAC RP11-153M3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 106340

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 353   ctgcacttgtcataccctcct 373
             |||||||||||||||||||||
Sbjct: 14959 ctgcacttgtcataccctcct 14979



to top

>gb|AE003664.3| Drosophila melanogaster chromosome 2L, section 73 of 83 of the complete
              sequence
          Length = 266287

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 139    aaatatttcaacactgagcaa 159
              |||||||||||||||||||||
Sbjct: 149429 aaatatttcaacactgagcaa 149449



to top

>gb|AC099795.2| Homo sapiens chromosome 1 clone RP5-848E13, complete sequence
          Length = 120556

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 36    aaacattcatgggcaaacaat 56
             |||||||||||||||||||||
Sbjct: 70255 aaacattcatgggcaaacaat 70275



to top

>gb|AE001423.1| Plasmodium falciparum 3D7 chromosome 2 section 60 of 73 of the complete
             sequence
          Length = 14635

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   taaccaaaaatatttcaaca 151
             ||||||||||||||||||||
Sbjct: 10142 taaccaaaaatatttcaaca 10123



to top

>emb|BX908387.8| Zebrafish DNA sequence from clone DKEY-45B6 in linkage group 3,
             complete sequence
          Length = 212624

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 9     atatgaactatagattaattcatt 32
             ||||||||||| ||||||||||||
Sbjct: 64510 atatgaactattgattaattcatt 64487



to top

>gb|AC158393.2| Mus musculus BAC clone RP23-368G21 from chromosome 14, complete sequence
          Length = 200173

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    caggctcctaaccaaaaata 143
              ||||||||||||||||||||
Sbjct: 197006 caggctcctaaccaaaaata 197025



to top

>emb|AL591435.10| Human DNA sequence from clone RP11-712I22 on chromosome X, complete
              sequence
          Length = 138038

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 107    catcttaaatcttcacccag 126
              ||||||||||||||||||||
Sbjct: 131566 catcttaaatcttcacccag 131585



to top

>gb|AC113398.3| Homo sapiens chromosome 5 clone RP11-436H11, complete sequence
          Length = 172613

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   aaaaatatttcaacactgag 156
             ||||||||||||||||||||
Sbjct: 95588 aaaaatatttcaacactgag 95569



to top

>gb|DP000062.1| Sus scrofa target 117 genomic scaffold
          Length = 605739

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   catttcattctacaacagat 300
             ||||||||||||||||||||
Sbjct: 27097 catttcattctacaacagat 27116



to top

>gb|AC036114.7| Homo sapiens chromosome 11, clone RP11-283H3, complete sequence
          Length = 159851

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 158   aattaccaagtctagaataa 177
             ||||||||||||||||||||
Sbjct: 66936 aattaccaagtctagaataa 66955



to top

>gb|DQ103595.1| Arabidopsis arenosa clone BAC 28N14, complete sequence
          Length = 132056

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  tgtcactttggacgaaacta 254
            ||||||||||||||||||||
Sbjct: 9262 tgtcactttggacgaaacta 9243



to top

>gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, complete sequence
          Length = 164009

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 158    aattaccaagtctagaataa 177
              ||||||||||||||||||||
Sbjct: 137919 aattaccaagtctagaataa 137938



to top

>gb|AC152932.2| Xenopus tropicalis clone ISB1-31M3, complete sequence
          Length = 78419

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 76   ttgttctttgctgcagtgct 95
            ||||||||||||||||||||
Sbjct: 8475 ttgttctttgctgcagtgct 8494



to top

>gb|AC020602.6| Homo sapiens BAC clone RP11-461M18 from 2, complete sequence
          Length = 167227

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   cctggccatcttaaatcttc 120
             ||||||||||||||||||||
Sbjct: 94573 cctggccatcttaaatcttc 94592



to top

>gb|AC021752.5|AC021752 Homo sapiens chromosome 15 clone CTD-2378E12 map 15q21, complete
             sequence
          Length = 100139

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   atcttaaatcttcacccagg 127
             ||||||||||||||||||||
Sbjct: 85661 atcttaaatcttcacccagg 85680



to top

>gb|AC109327.10| Homo sapiens chromosome 17, clone RP11-93C20, complete sequence
          Length = 113000

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 278   gcacatttcattctacaaca 297
             ||||||||||||||||||||
Sbjct: 58038 gcacatttcattctacaaca 58057



to top

>gb|AC022407.6|AC022407 Homo sapiens chromosome 15 clone RP11-105D1 map 15q21.2, complete
             sequence
          Length = 143210

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   atcttaaatcttcacccagg 127
             ||||||||||||||||||||
Sbjct: 44646 atcttaaatcttcacccagg 44665



to top

>gb|AY103550.1| Zea mays PCO151000 mRNA sequence
          Length = 1722

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 9   atatgaactatagattaattcattacaa 36
           ||||| |||||| |||||||||||||||
Sbjct: 150 atatggactatacattaattcattacaa 177



to top

>emb|CT009495.13| Mouse DNA sequence from clone RP23-127E21 on chromosome 14, complete
              sequence
          Length = 192786

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    caggctcctaaccaaaaata 143
              ||||||||||||||||||||
Sbjct: 128721 caggctcctaaccaaaaata 128740



to top

>emb|AL831778.8| Mouse DNA sequence from clone RP23-261L23 on chromosome 4, complete
            sequence
          Length = 213495

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 127  gctcctaaccaaaaatattt 146
            ||||||||||||||||||||
Sbjct: 2517 gctcctaaccaaaaatattt 2498


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,702,797
Number of Sequences: 3902068
Number of extensions: 4702797
Number of successful extensions: 79028
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78977
Number of HSP's gapped (non-prelim): 51
length of query: 472
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 450
effective length of database: 17,147,199,772
effective search space: 7716239897400
effective search space used: 7716239897400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top