Clone Name	rbags27h12
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co...	359	5e-96
2	emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)	327	2e-86
3	gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet...	327	2e-86
4	dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co...	319	4e-84
5	dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co...	311	1e-81
6	gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence	214	2e-52
7	gb|BT016569.1| Zea mays clone Contig402 mRNA sequence	174	2e-40
8	gb|AY103710.1| Zea mays PCO123562 mRNA sequence	174	2e-40
9	gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence	167	4e-38
10	gb|AY103585.1| Zea mays PCO123564 mRNA sequence	159	9e-36
11	ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic...	151	2e-33
12	gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence	151	2e-33
13	dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon...	151	2e-33
14	dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon...	151	2e-33
15	gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence	145	1e-31
16	gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome...	143	5e-31
17	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	143	5e-31
18	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	143	5e-31
19	dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon...	135	1e-28
20	ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic...	127	3e-26
21	ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic...	127	3e-26
22	gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome...	127	3e-26
23	gb|BT016301.1| Zea mays clone Contig134 mRNA sequence	125	1e-25
24	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	119	8e-24
25	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	119	8e-24
26	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	119	8e-24
27	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	119	8e-24
28	dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D...	119	8e-24
29	dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon...	119	8e-24
30	gb|AY104486.1| Zea mays PCO109435 mRNA sequence	117	3e-23
31	ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA	111	2e-21
32	dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clon...	111	2e-21
33	dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clon...	111	2e-21
34	ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H...	105	1e-19
35	gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	105	1e-19
36	gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	105	1e-19
37	gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (...	105	1e-19
38	ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA	105	1e-19
39	gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom...	105	1e-19
40	ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af...	105	1e-19
41	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	105	1e-19
42	emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X	105	1e-19
43	gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (...	105	1e-19
44	dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ...	105	1e-19
45	dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI...	105	1e-19
46	ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p...	105	1e-19
47	gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet...	105	1e-19
48	dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	5e-19
49	dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	5e-19
50	gb|AY109370.1| Zea mays CL2029_4 mRNA sequence	103	5e-19
51	gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds	103	5e-19
52	ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone...	100	7e-18
53	ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	98	3e-17
54	ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA	98	3e-17
55	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	98	3e-17
56	ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo...	98	3e-17
57	ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
58	ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
59	ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
60	ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
61	ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
62	ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
63	ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
64	ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
65	ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
66	ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
67	ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
68	ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ...	98	3e-17
69	ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
70	ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
71	ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ...	98	3e-17
72	ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ...	98	3e-17
73	ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ...	98	3e-17
74	ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ...	98	3e-17
75	gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar...	98	3e-17
76	emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X	98	3e-17
77	emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	98	3e-17
78	emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)	98	3e-17
79	gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG...	98	3e-17
80	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	98	3e-17
81	ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA	98	3e-17
82	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	98	3e-17
83	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	98	3e-17
84	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	98	3e-17
85	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	98	3e-17
86	gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG...	98	3e-17
87	gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG...	98	3e-17
88	dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	98	3e-17
89	dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	98	3e-17
90	dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	98	3e-17
91	ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA	98	3e-17
92	gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,...	98	3e-17
93	gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ...	98	3e-17
94	gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016	98	3e-17
95	gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108	98	3e-17
96	ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA	98	3e-17
97	ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA	98	3e-17
98	ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA	98	3e-17
99	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	98	3e-17
100	dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	98	3e-17
101	dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l...	98	3e-17
102	ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA	98	3e-17
103	ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone...	98	3e-17
104	gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp...	98	3e-17
105	gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp...	98	3e-17
106	gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp...	98	3e-17
107	gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp...	98	3e-17
108	gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp...	98	3e-17
109	gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp...	98	3e-17
110	gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp...	98	3e-17
111	gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene...	98	3e-17
112	gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp...	98	3e-17
113	ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA	98	3e-17
114	gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (...	98	3e-17
115	gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ...	98	3e-17
116	emb|BX063165.1|CNS09KWH Single read from an extremity of a full-...	96	1e-16
117	emb|BX063164.1|CNS09KWG Single read from an extremity of a full-...	96	1e-16
118	emb|BX040864.1|CNS093P0 Single read from an extremity of a full-...	96	1e-16
119	emb|BX019683.1|CNS08NCN Single read from an extremity of a full-...	96	1e-16
120	emb|BX016451.1|CNS08KUV Single read from an extremity of a full-...	96	1e-16
121	emb|BX009846.1|CNS08FRE Single read from an extremity of a full-...	96	1e-16
122	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	96	1e-16
123	emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	96	1e-16
124	gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen...	96	1e-16
125	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-16
126	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-16
127	ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H...	96	1e-16
128	dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-16
129	dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co...	96	1e-16
130	dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co...	96	1e-16
131	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	96	1e-16
132	emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112...	96	1e-16
133	gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp...	96	1e-16
134	gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds	96	1e-16
135	gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c...	94	5e-16
136	ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA	92	2e-15
137	dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clon...	92	2e-15
138	gb|AY108339.1| Zea mays PCO070432 mRNA sequence	92	2e-15
139	ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af...	90	7e-15
140	ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ...	90	7e-15
141	ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ...	90	7e-15
142	gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple...	90	7e-15
143	dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	90	7e-15
144	ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA	90	7e-15
145	ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone...	90	7e-15
146	ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone...	90	7e-15
147	gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp...	90	7e-15
148	gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp...	90	7e-15
149	ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA	90	7e-15
150	gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (...	90	7e-15
151	gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet...	90	7e-15
152	emb|BX016452.1|CNS08KUW Single read from an extremity of a full-...	88	3e-14
153	emb|X14730.1|CMHIST2A Duck H2A histone gene	88	3e-14
154	ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p...	88	3e-14
155	ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ...	88	3e-14
156	ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ...	88	3e-14
157	ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	86	1e-13
158	emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	86	1e-13
159	ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (p...	86	1e-13
160	ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2...	86	1e-13
161	ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone...	86	1e-13
162	gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds	84	4e-13
163	gb|AY104826.1| Zea mays PCO099353 mRNA sequence	84	4e-13
164	gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ...	82	2e-12
165	gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ...	82	2e-12
166	ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H...	82	2e-12
167	gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	82	2e-12
168	ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	82	2e-12
169	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	82	2e-12
170	ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA	82	2e-12
171	ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ...	82	2e-12
172	emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro...	82	2e-12
173	gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter se...	82	2e-12
174	emb|BX008487.1|CNS08EPN Single read from an extremity of a full-...	82	2e-12
175	emb|Z80778.1|HSH2AL H.sapiens H2A/l gene	82	2e-12
176	emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones	82	2e-12
177	emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cell...	82	2e-12
178	emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta ...	82	2e-12
179	emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta ...	82	2e-12
180	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	82	2e-12
181	gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA,...	82	2e-12
182	ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA	82	2e-12
183	gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp...	82	2e-12
184	gb|BC085010.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	82	2e-12
185	gb|AY894000.1| Synthetic construct Homo sapiens clone FLH130938....	82	2e-12
186	gb|AY893556.1| Synthetic construct Homo sapiens clone FLH130901....	82	2e-12
187	gb|AY893555.1| Synthetic construct Homo sapiens clone FLH130900....	82	2e-12
188	gb|BC050602.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	82	2e-12
189	gb|AY131984.1| Homo sapiens histone H2A (HIST1H2AC) gene, comple...	82	2e-12
190	ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H...	80	7e-12
191	gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (...	80	7e-12
192	ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ...	80	7e-12
193	ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist...	80	7e-12
194	ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF...	80	7e-12
195	emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chr...	80	7e-12
196	emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-...	80	7e-12
197	emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X	80	7e-12
198	gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (...	80	7e-12
199	emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas...	80	7e-12
200	ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R...	80	7e-12
201	gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ...	80	7e-12
202	gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)...	80	7e-12
203	dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minu...	80	7e-12
204	gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (...	80	7e-12
205	dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C...	80	7e-12
206	gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet...	80	7e-12
207	ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	78	3e-11
208	gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	78	3e-11
209	ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone p...	76	1e-10
210	ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA	76	1e-10
211	ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA	76	1e-10
212	gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339	76	1e-10
213	gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I...	76	1e-10
214	ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA	76	1e-10
215	ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone ...	76	1e-10
216	ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone ...	76	1e-10
217	ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone ...	76	1e-10
218	ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	76	1e-10
219	gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds	76	1e-10
220	emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA	76	1e-10
221	emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA	76	1e-10
222	gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, comp...	76	1e-10
223	emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ...	76	1e-10
224	emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23	76	1e-10
225	emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes	76	1e-10
226	dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-le...	76	1e-10
227	dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409...	76	1e-10
228	dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-...	76	1e-10
229	dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-...	76	1e-10
230	dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-...	76	1e-10
231	dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-...	76	1e-10
232	gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	76	1e-10
233	gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2...	76	1e-10
234	dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full...	76	1e-10
235	ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA	76	1e-10
236	gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, comp...	76	1e-10
237	gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, com...	76	1e-10
238	gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, com...	76	1e-10
239	gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, comp...	76	1e-10
240	gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	76	1e-10
241	gb|AY110108.1| Zea mays CL14299_1 mRNA sequence	76	1e-10
242	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	76	1e-10
243	gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome...	76	1e-10
244	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	76	1e-10
245	gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I...	76	1e-10
246	ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB3...	76	1e-10
247	gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	76	1e-10
248	gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome...	76	1e-10
249	ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H...	74	4e-10
250	gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG...	74	4e-10
251	gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG...	74	4e-10
252	gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone...	74	4e-10
253	ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ...	74	4e-10
254	ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ...	74	4e-10
255	ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ...	74	4e-10
256	ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ...	74	4e-10
257	ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ...	74	4e-10
258	ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi...	74	4e-10
259	ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	74	4e-10
260	gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IM...	74	4e-10
261	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	74	4e-10
262	ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA	74	4e-10
263	gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds	74	4e-10
264	emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o...	74	4e-10
265	emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene	74	4e-10
266	emb|X00089.1|HSHISH2A Human histone H2a gene	74	4e-10
267	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	74	4e-10
268	emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r...	74	4e-10
269	gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, comple...	74	4e-10
270	dbj|AK207984.1| Mus musculus cDNA, clone:Y2G0109L23, strand:minu...	74	4e-10
271	dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501	74	4e-10
272	gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895....	74	4e-10
273	dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple...	74	4e-10
274	gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ...	74	4e-10
275	gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co...	74	4e-10
276	gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com...	74	4e-10
277	gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	74	4e-10
278	ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	72	2e-09
279	ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA	72	2e-09
280	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	72	2e-09
281	emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ...	72	2e-09
282	gb|BC093862.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	72	2e-09
283	gb|BC093836.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	72	2e-09
284	dbj|AK216150.1| Mus musculus cDNA, clone:Y2G0137G02, strand:minu...	72	2e-09
285	gb|M60752.1|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds	72	2e-09
286	gb|AY131986.1| Homo sapiens histone H2A (HIST1H2AE) gene, comple...	72	2e-09
287	gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG...	70	7e-09
288	ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H...	70	7e-09
289	ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ...	70	7e-09
290	ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261...	70	7e-09
291	ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA	70	7e-09
292	gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds	70	7e-09
293	gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	70	7e-09
294	gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	70	7e-09
295	ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g ...	70	7e-09
296	ref|NM_003513.2| Homo sapiens histone 1, H2ab (HIST1H2AB), mRNA	70	7e-09
297	ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA	70	7e-09
298	ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA	70	7e-09
299	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	70	7e-09
300	emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o...	70	7e-09
301	emb|Z83741.1|HSZ83741 H.sapiens hH2A/m gene	70	7e-09
302	ref|XM_928387.1| PREDICTED: Homo sapiens similar to Histone H2A....	70	7e-09
303	emb|CR541872.1| Homo sapiens full open reading frame cDNA clone ...	70	7e-09
304	emb|CR536525.1| Homo sapiens full open reading frame cDNA clone ...	70	7e-09
305	gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	70	7e-09
306	gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	70	7e-09
307	gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, comple...	70	7e-09
308	gb|AY131983.1| Homo sapiens histone H2A (HIST1H2AB) gene, comple...	70	7e-09
309	gb|AY894055.1| Synthetic construct Homo sapiens clone FLH131281....	70	7e-09
310	gb|AY894054.1| Synthetic construct Homo sapiens clone FLH130836....	70	7e-09
311	gb|BC098171.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	70	7e-09
312	gb|BC096739.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	70	7e-09
313	gb|L19779.1|HUMH2A2A Homo sapiens histone H2A.2 mRNA, complete cds	70	7e-09
314	ref|NG_000827.2| Homo sapiens genomic histone family microcluste...	70	7e-09
315	gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple...	70	7e-09
316	gb|AY131971.1| Homo sapiens histone H2A (HIST2H2AA) gene, comple...	70	7e-09
317	ref|XM_870473.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	68	3e-08
318	ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ...	68	3e-08
319	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	68	3e-08
320	ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	68	3e-08
321	ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	68	3e-08
322	ref|XM_602557.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	68	3e-08
323	ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA	68	3e-08
324	emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq...	68	3e-08
325	gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family me...	68	3e-08
326	gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co...	68	3e-08
327	gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c...	68	3e-08
328	gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ...	68	3e-08
329	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	68	3e-08
330	ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H...	66	1e-07
331	ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa...	66	1e-07
332	ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H...	66	1e-07
333	gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558...	66	1e-07
334	ref|XM_583411.2| PREDICTED: Bos taurus similar to Histone H2A.l ...	66	1e-07
335	ref|XM_869647.1| PREDICTED: Bos taurus similar to Histone H2A.l ...	66	1e-07
336	gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MG...	66	1e-07
337	gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MG...	66	1e-07
338	gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IM...	66	1e-07
339	ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA	66	1e-07
340	ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA	66	1e-07
341	ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA	66	1e-07
342	emb|X94693.1|TAH2A254 T.aestivum histone H2A gene	66	1e-07
343	emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A	66	1e-07
344	emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2...	66	1e-07
345	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	66	1e-07
346	gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA	66	1e-07
347	ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (...	66	1e-07
348	gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, comple...	66	1e-07
349	emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4	66	1e-07
350	gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, comple...	66	1e-07
351	gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, comple...	66	1e-07
352	gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, comple...	66	1e-07
353	ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ...	66	1e-07
354	gb|BC112072.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	66	1e-07
355	gb|BC071668.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG...	66	1e-07
356	gb|BC105129.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	66	1e-07
357	gb|BC032756.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG...	66	1e-07
358	gb|AY104828.1| Zea mays PCO072413 mRNA sequence	66	1e-07
359	gb|AY104637.1| Zea mays PCO070433 mRNA sequence	66	1e-07
360	dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple...	66	1e-07
361	gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds	66	1e-07
362	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	66	1e-07
363	ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA	64	4e-07
364	ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2a...	64	4e-07
365	ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX ...	64	4e-07
366	gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC...	64	4e-07
367	gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA...	64	4e-07
368	ref|XM_789760.1| PREDICTED: Strongylocentrotus purpuratus simila...	64	4e-07
369	dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	64	4e-07
370	dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA...	64	4e-07
371	dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	64	4e-07
372	dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-...	64	4e-07
373	dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	64	4e-07
374	dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE...	64	4e-07
375	gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp...	64	4e-07
376	gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl...	64	4e-07
377	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	64	4e-07
378	gb|AY131972.1| Homo sapiens histone H2A (HIST2H2AB) gene, comple...	64	4e-07
379	gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds	64	4e-07
380	gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds	64	4e-07
381	emb|BX019514.1|CNS08N7Y Single read from an extremity of a full-...	62	2e-06
382	emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq...	62	2e-06
383	gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp...	62	2e-06
384	ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 ...	62	2e-06
385	ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo...	60	6e-06
386	ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H...	60	6e-06
387	ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H...	60	6e-06
388	gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462	60	6e-06
389	ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA	60	6e-06
390	ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA	60	6e-06
391	ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA	60	6e-06
392	ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA	60	6e-06
393	gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	6e-06
394	gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	6e-06
395	gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	6e-06
396	gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	6e-06
397	gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	6e-06
398	gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	6e-06
399	ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ...	60	6e-06
400	ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ...	60	6e-06
401	ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ...	60	6e-06
402	emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA	60	6e-06
403	emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A...	60	6e-06
404	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	60	6e-06
405	emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene	60	6e-06
406	emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene	60	6e-06
407	emb|Z80776.1|HSH2AG H.sapiens H2A/g gene	60	6e-06
408	ref|XM_781115.1| PREDICTED: Strongylocentrotus purpuratus simila...	60	6e-06
409	emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A	60	6e-06
410	gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	60	6e-06
411	ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (...	60	6e-06
412	emb|CR541999.1| Homo sapiens full open reading frame cDNA clone ...	60	6e-06
413	emb|CR541970.1| Homo sapiens full open reading frame cDNA clone ...	60	6e-06
414	gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	60	6e-06
415	gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, comple...	60	6e-06
416	gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, comple...	60	6e-06
417	gb|BC112256.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	6e-06
418	gb|BC112254.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	6e-06
419	gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, comple...	60	6e-06
420	ref|NM_118857.2| Arabidopsis thaliana DNA binding AT4G27230 mRNA...	58	3e-05
421	ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA	58	3e-05
422	ref|XM_655980.1| Aspergillus nidulans FGSC A4 histone H2A (AN346...	58	3e-05
423	ref|XM_906200.1| PREDICTED: Mus musculus similar to histone H2A ...	58	3e-05
424	ref|XM_886305.1| PREDICTED: Mus musculus similar to histone H2A ...	58	3e-05
425	gb|BT006076.1| Arabidopsis thaliana clone U20287 putative histon...	58	3e-05
426	gb|BC093343.1| Danio rerio MID1 interacting protein 1, mRNA (cDN...	58	3e-05
427	gb|BT005779.1| Arabidopsis thaliana clone RAFL14-92-E07 (R20287)...	58	3e-05
428	gb|AY088714.1| Arabidopsis thaliana clone 927 mRNA, complete seq...	58	3e-05
429	dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon...	58	3e-05
430	gb|M18258.1|EMEH2A A.niidulans histone H2A gene, complete cds	58	3e-05
431	gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	56	1e-04
432	gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	56	1e-04
433	ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA	56	1e-04
434	ref|XM_870822.1| PREDICTED: Bos taurus similar to H2A histone fa...	56	1e-04
435	ref|XM_866661.1| PREDICTED: Bos taurus similar to Histone H2A.o ...	56	1e-04
436	ref|NM_175065.2| Homo sapiens histone 2, H2ab (HIST2H2AB), mRNA	56	1e-04
437	gb|BC098891.1| Danio rerio zgc:114037, mRNA (cDNA clone MGC:1140...	56	1e-04
438	ref|NM_001031826.1| Danio rerio zgc:114037 (zgc:114037), mRNA	56	1e-04
439	ref|XM_785689.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	1e-04
440	emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes	56	1e-04
441	emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr...	56	1e-04
442	gb|BC103043.1| Bos taurus cDNA clone MGC:128401 IMAGE:7983967, c...	56	1e-04
443	ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (...	56	1e-04
444	ref|XM_683419.1| PREDICTED: Danio rerio similar to replication-d...	56	1e-04
445	ref|XM_687955.1| PREDICTED: Danio rerio similar to histone H2A (...	56	1e-04
446	ref|XM_686987.1| PREDICTED: Danio rerio similar to replication-d...	56	1e-04
447	gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRN...	56	1e-04
448	gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp...	56	1e-04
449	dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon...	56	1e-04
450	ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 ...	56	1e-04
451	ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 ...	56	1e-04
452	emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ...	56	1e-04
453	gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2...	56	1e-04
454	gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1...	56	1e-04
455	ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p...	54	4e-04
456	ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o ...	54	4e-04
457	ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o ...	54	4e-04
458	ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa...	54	4e-04
459	ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o ...	54	4e-04
460	emb|AL138726.12| Human DNA sequence from clone RP1-139G21 on chr...	54	4e-04
461	gb|BC054677.1| Danio rerio cDNA clone IMAGE:5600370, partial cds	54	4e-04
462	gb|AF098457.1|AF098457 Homo sapiens H2A/t pseudogene, complete s...	54	4e-04
463	gb|U90545.1|HSU90545 Human sodium phosphate transporter (NPT4) m...	54	4e-04
464	ref|NG_002685.1| Homo sapiens histone 1, H2a, pseudogene 2 (HIST...	54	4e-04
465	gb|J00950.1|NVIHIS2A Newt histone H2a gene, partial	54	4e-04
466	gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	52	0.002
467	ref|XR_003029.1| PREDICTED: Mus musculus similar to H2A histone ...	52	0.002
468	ref|XR_001920.1| PREDICTED: Mus musculus similar to H2A histone ...	52	0.002
469	gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, com...	52	0.002
470	emb|Y15320.1|ANHTTA Aspergillus niger mRNA for histone H2A	52	0.002
471	emb|Z65161.1|HS21G2F H.sapiens CpG island DNA genomic Mse1 fragm...	52	0.002
472	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	52	0.002
473	ref|XM_520760.1| PREDICTED: Pan troglodytes similar to H2A histo...	50	0.006
474	gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome...	50	0.006
475	gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome...	50	0.006
476	ref|XM_866523.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	50	0.006
477	gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque...	50	0.006
478	gb|BC003602.1| Homo sapiens H2A histone family, member J, transc...	50	0.006
479	ref|NM_177925.1| Homo sapiens H2A histone family, member J (H2AF...	50	0.006
480	emb|AJ494851.1|ODI494851 Oikopleura dioica partial H2A.2 gene fo...	50	0.006
481	emb|CR625218.1| full-length cDNA clone CS0DI023YM11 of Placenta ...	50	0.006
482	gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rose...	50	0.006
483	ref|XM_684224.1| PREDICTED: Danio rerio similar to replication-d...	50	0.006
484	ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
485	ref|XM_683060.1| PREDICTED: Danio rerio similar to replication-d...	50	0.006
486	ref|XM_694133.1| PREDICTED: Danio rerio similar to replication-d...	50	0.006
487	dbj|AB179140.1| Macaca fascicularis testis cDNA clone: QtsA-1353...	50	0.006
488	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	50	0.006
489	dbj|AB154525.1| Cucumis melo 6A06 mRNA for hypothetical protein,...	50	0.006
490	dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D...	50	0.006
491	dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D...	50	0.006
492	gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete...	50	0.006
493	emb|AL133626.1|HSM801493 Homo sapiens mRNA; cDNA DKFZp434K0522 (...	50	0.006
494	gb|M13637.1|SULHIS2A Sea urchin (L.pictus) testis histone H2a mRNA	50	0.006
495	ref|XM_954349.1| Neurospora crassa OR74A hypothetical protein (N...	48	0.024
496	ref|XM_583595.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	48	0.024
497	ref|XM_331212.1| Neurospora crassa OR74A hypothetical protein (N...	48	0.024
498	ref|XM_866640.1| PREDICTED: Bos taurus similar to histone H2A (L...	48	0.024
499	gb|AY812081.1| Schistosoma japonicum SJCHGC05779 protein mRNA, p...	48	0.024
500	gb|AY223124.1| Schistosoma japonicum clone ZZD1425 mRNA sequence	48	0.024

---

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  359 bits (181), Expect = 5e-96
 Identities = 241/261 (92%)
 Strand = Plus / Minus

                                                                       
Query: 179 ccttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcgg 238
           ||||||||||||| |||||||||  || |||||||||||||||||| |||||||||||||
Sbjct: 486 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttggcctccttctcgg 427

                                                                       
Query: 239 ccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgt 298
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 426 cggcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccaccgt 367

                                                                       
Query: 299 gagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaa 358
           | || ||||||||||| ||||||||| ||||||| ||||||||||||||||| ||||| |
Sbjct: 366 gggcgatggtgacgccagcgagcagcctgccgagctcctggtcgttgcggacagcgagca 307

                                                                       
Query: 359 gaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagct 418
           | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 306 gcaggtggcgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcaagct 247

                                
Query: 419 ctaggagctcagcggcgaggt 439
           | || | ||| ||||||||||
Sbjct: 246 ccagcacctcggcggcgaggt 226



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 63/68 (92%), Gaps = 1/68 (1%)
 Strand = Plus / Minus

                                                                       
Query: 48  ggcttgttcatcgaactaatgaaacagccactacagac-tatgcaattacacaaaggacc 106
           ||||||||||||||||||||| |||||||||||||||| || ||||||||||| |||| |
Sbjct: 636 ggcttgttcatcgaactaatgtaacagccactacagacttaggcaattacacacaggatc 577

                   
Query: 107 caaccaac 114
           ||||||||
Sbjct: 576 caaccaac 569

---

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score =  327 bits (165), Expect = 2e-86
 Identities = 222/241 (92%)
 Strand = Plus / Minus

                                                                        
Query: 179  ccttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcgg 238
            ||||||||||||| |||||||||  || |||||||||||||||||| |||||||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttggcctccttctcgg 2249

                                                                        
Query: 239  ccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgt 298
            | |||||||||||||||||||| |||||||||||||||||  ||||||| ||||||||||
Sbjct: 2248 cggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgccgt 2189

                                                                        
Query: 299  gagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaa 358
            | || |||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 2188 gggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcgagca 2129

                                                                        
Query: 359  gaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagct 418
            | |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 2128 gcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaagct 2069

             
Query: 419  c 419
            |
Sbjct: 2068 c 2068

---

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score =  327 bits (165), Expect = 2e-86
 Identities = 222/241 (92%)
 Strand = Plus / Minus

                                                                        
Query: 179  ccttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcgg 238
            ||||||||||||| |||||||||  || |||||||||||||||||| |||||||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttggcctccttctcgg 2249

                                                                        
Query: 239  ccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgt 298
            | |||||||||||||||||||| |||||||||||||||||  ||||||| ||||||||||
Sbjct: 2248 cggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgccgt 2189

                                                                        
Query: 299  gagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaa 358
            | || |||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 2188 gggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcgagca 2129

                                                                        
Query: 359  gaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagct 418
            | |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 2128 gcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaagct 2069

             
Query: 419  c 419
            |
Sbjct: 2068 c 2068

---

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  319 bits (161), Expect = 4e-84
 Identities = 235/260 (90%), Gaps = 6/260 (2%)
 Strand = Plus / Minus

                                                                       
Query: 180 cttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcggc 239
           |||||||||||| ||||||| | |||||||||      ||||||| ||||||||||||||
Sbjct: 502 cttcttcttgggggacttggcggcggccttct------gcgacttggcctccttctcggc 449

                                                                       
Query: 240 cgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtg 299
            || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 448 ggctgcgggggacttcttggggagcagcacggagttgatgttggggatgacgccgccgtg 389

                                                                       
Query: 300 agcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaag 359
            || ||||||||||||||||||||| ||||||| |||||||||||||||||||| || ||
Sbjct: 388 ggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggccagcag 329

                                                                       
Query: 360 aaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
            |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 328 caggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgttgccggcaagctc 269

                               
Query: 420 taggagctcagcggcgaggt 439
            |||| ||| ||||||||||
Sbjct: 268 caggacctcggcggcgaggt 249

---

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  311 bits (157), Expect = 1e-81
 Identities = 237/263 (90%), Gaps = 3/263 (1%)
 Strand = Plus / Minus

                                                                       
Query: 180 cttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgc---ctccttctc 236
           |||||||||||| ||||||||| |||||||||||||||||||||| |    |||||||||
Sbjct: 509 cttcttcttgggggacttggtggcggccttcttcttgggcgacttggtggactccttctc 450

                                                                       
Query: 237 ggccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgcc 296
           ||| ||| ||| || |||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 449 ggcggcgccggcggccttcttggggagcagcacggagttgatgttggggatgacgccgcc 390

                                                                       
Query: 297 gtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgag 356
           ||| || ||||||||||||||||||||| |||| || |||||||||||||||||||| ||
Sbjct: 389 gtgggcgatggtgacgccggcgagcagcctgcccagctcctggtcgttgcggacggccag 330

                                                                       
Query: 357 aagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaag 416
            || |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||
Sbjct: 329 cagcaggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgttgccggcgag 270

                                  
Query: 417 ctctaggagctcagcggcgaggt 439
           ||| |||| ||| ||||||||||
Sbjct: 269 ctccaggacctcggcggcgaggt 247



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 177 ggccttcttcttgggagacttggtg 201
           ||||||||||||||| |||||||||
Sbjct: 485 ggccttcttcttgggcgacttggtg 461

---

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score =  214 bits (108), Expect = 2e-52
 Identities = 141/152 (92%)
 Strand = Plus / Plus

                                                                       
Query: 180 cttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcggc 239
           |||||||||||| ||||||| | | | |||||||||||||||||| ||||||||||||||
Sbjct: 192 cttcttcttgggggacttggcggccgtcttcttcttgggcgacttggcctccttctcggc 251

                                                                       
Query: 240 cgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtg 299
            ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 252 ggcggcaggggacttcttggggagcagcacggagttgatgttggggatcacaccgccgtg 311

                                           
Query: 300 agcaatggtgacgccggcgagcagcttgccga 331
            || ||||||||||||||||||||||||||||
Sbjct: 312 ggcgatggtgacgccggcgagcagcttgccga 343

---

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  174 bits (88), Expect = 2e-40
 Identities = 148/168 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| || ||||| | ||||||||||||||  ||||||||||| || ||||||||
Sbjct: 492 cttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatggtgac 433

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||  |||||||||||||| |||| ||||||||||| ||| || || | |||||||||
Sbjct: 432 gccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtggcgcgg 373

                                                           
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
           ||||||||||||||||||||||||||| || ||||||||||| |||||
Sbjct: 372 gatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctc 325

---

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  174 bits (88), Expect = 2e-40
 Identities = 148/168 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| || ||||| | ||||||||||||||  ||||||||||| || ||||||||
Sbjct: 492 cttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatggtgac 433

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||  |||||||||||||| |||| ||||||||||| ||| || || | |||||||||
Sbjct: 432 gccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtggcgcgg 373

                                                           
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
           ||||||||||||||||||||||||||| || ||||||||||| |||||
Sbjct: 372 gatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctc 325

---

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score =  167 bits (84), Expect = 4e-38
 Identities = 162/188 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||||||||| || |||| ||| |||||||| | ||| |||||||| || ||||||||
Sbjct: 449 cttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgac 390

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||  | |||||||||||||| |||| ||||||||||| |||||| || |||||||||||
Sbjct: 389 cccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtggcgcgg 330

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||||||||| |||||||||||   |||||||||||| || ||||| |||| ||||||
Sbjct: 329 gatgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccaggacctcagc 270

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 269 ggcgaggt 262

---

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  159 bits (80), Expect = 9e-36
 Identities = 137/156 (87%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| || |||||||||| |||||||||||  ||||||||||| || ||||||||
Sbjct: 610 cttcttgggcaggagcacggagtggatgttggggaggacgccgccgtgcgcgatggtgac 551

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||| |||||||| ||||| |||| |||||||||||  || || || | |||||||||
Sbjct: 550 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 491

                                               
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgtt 407
           ||||||||| |||||||||||||| |||||||||||
Sbjct: 490 gatgatgcgcgtcttcttgttgtctttcgccgcgtt 455

---

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  151 bits (76), Expect = 2e-33
 Identities = 160/188 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||||||||||||||| | |||||||||||| | ||| |||||||| || ||||||||
Sbjct: 393 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 334

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||| |||||||| ||||| |||| |||||||||||  || || || | ||| |||||
Sbjct: 333 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 274

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| ||| ||||||||||||||  ||||||||| || |||||||| || | ||| ||
Sbjct: 273 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 214

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 213 ggcgaggt 206

---

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  151 bits (76), Expect = 2e-33
 Identities = 136/156 (87%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| || |||||||||| |||||||||||  ||||| ||||| || ||||||||
Sbjct: 461 cttcttgggcaggagcacggagtggatgttggggaggacgccaccgtgcgcgatggtgac 402

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||| |||||||| ||||| |||| |||||||||||  || || || | |||||||||
Sbjct: 401 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 342

                                               
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgtt 407
           ||||||||| |||||||||||||| |||||||||||
Sbjct: 341 gatgatgcgcgtcttcttgttgtctttcgccgcgtt 306

---

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  151 bits (76), Expect = 2e-33
 Identities = 160/188 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||||||||||||||| | |||||||||||| | ||| |||||||| || ||||||||
Sbjct: 463 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 404

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||| |||||||| ||||| |||| |||||||||||  || || || | ||| |||||
Sbjct: 403 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 344

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| ||| ||||||||||||||  ||||||||| || |||||||| || | ||| ||
Sbjct: 343 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 284

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 283 ggcgaggt 276

---

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  151 bits (76), Expect = 2e-33
 Identities = 160/188 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||||||||||||||| | |||||||||||| | ||| |||||||| || ||||||||
Sbjct: 464 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 405

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||| |||||||| ||||| |||| |||||||||||  || || || | ||| |||||
Sbjct: 404 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 345

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| ||| ||||||||||||||  ||||||||| || |||||||| || | ||| ||
Sbjct: 344 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 285

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 284 ggcgaggt 277

---

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  145 bits (73), Expect = 1e-31
 Identities = 161/189 (85%), Gaps = 1/189 (0%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| || | |||||||||||| | |||||||||||| || ||||| ||
Sbjct: 450 cttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgtgggcgatggtcac 391

                                                                       
Query: 312 gccggcgagcagc-ttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcg 370
           |||||  |||||| || ||||| |||| |||||||||||  || || || | ||||||||
Sbjct: 390 gccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagcagcacgtggcgcg 331

                                                                       
Query: 371 ggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcag 430
           ||| |||||| ||||||||||||||||| || ||||||||||| ||||| |||| |||||
Sbjct: 330 ggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagctccaggacctcag 271

                    
Query: 431 cggcgaggt 439
           |||||||||
Sbjct: 270 cggcgaggt 262



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 210 cttcttgggcgacttcgcctcctt 233
           ||||||||||||||| ||||||||
Sbjct: 504 cttcttgggcgacttggcctcctt 481

---

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  143 bits (72), Expect = 5e-31
 Identities = 144/168 (85%)
 Strand = Plus / Plus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            |||||||||||||||||| | |||||||||||| | ||| |||||||| || ||||||||
Sbjct: 7377 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 7436

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            |||||| |||||||| ||||| |||| |||||||||||  || || || | ||| |||||
Sbjct: 7437 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 7496

                                                            
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
            |||||| ||| ||||||||||||||  ||||||||| || ||||||||
Sbjct: 7497 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctc 7544

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  143 bits (72), Expect = 5e-31
 Identities = 144/168 (85%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              |||||||||||||||||| | |||||||||||| | ||| |||||||| || ||||||||
Sbjct: 101734 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 101793

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              |||||| |||||||| ||||| |||| |||||||||||  || || || | ||| |||||
Sbjct: 101794 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 101853

                                                              
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
              |||||| ||| ||||||||||||||  ||||||||| || ||||||||
Sbjct: 101854 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctc 101901

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  143 bits (72), Expect = 5e-31
 Identities = 144/168 (85%)
 Strand = Plus / Plus

                                                                            
Query: 252      cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
                |||||||||||||||||| | |||||||||||| | ||| |||||||| || ||||||||
Sbjct: 22512327 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 22512386

                                                                            
Query: 312      gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
                |||||| |||||||| ||||| |||| |||||||||||  || || || | ||| |||||
Sbjct: 22512387 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 22512446

                                                                
Query: 372      gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
                |||||| ||| ||||||||||||||  ||||||||| || ||||||||
Sbjct: 22512447 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctc 22512494



 Score =  127 bits (64), Expect = 3e-26
 Identities = 142/168 (84%)
 Strand = Plus / Minus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              |||||| ||||||||||| | ||||||||| || | |||||||||||| || ||||||||
Sbjct: 707404 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 707345

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
               |||||||||||||| ||||| |||| |||||||||||  || || || | ||| | |||
Sbjct: 707344 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 707285

                                                              
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
              |||||| ||| ||||||||||||||  ||||||||| ||||| |||||
Sbjct: 707284 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctc 707237



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 206      ccttcttcttgggcgacttcgcctccttctcggccg 241
                ||||||||||||  ||||||||| |||||| |||||
Sbjct: 25633578 ccttcttcttggcggacttcgccgccttcttggccg 25633543

---

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  135 bits (68), Expect = 1e-28
 Identities = 158/188 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||| ||||||||||| | ||||||||| || | |||||||||||| || ||||||||
Sbjct: 467 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 408

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            |||||||||||||| ||||| |||| |||||||||||  || || || | ||| | |||
Sbjct: 407 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 348

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| ||| ||||||||||||||  ||||||||| ||||| ||||| || | ||| ||
Sbjct: 347 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacctctgc 288

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 287 ggcgaggt 280

---

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  127 bits (64), Expect = 3e-26
 Identities = 157/188 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| ||
Sbjct: 399 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 340

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||| |||||||||||||| |||| |||||| | ||  || || || | |||||||||
Sbjct: 339 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 280

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| | | |||||||||||||| | |||||||| ||||| ||||| || | ||| ||
Sbjct: 279 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 220

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 219 ggcgaggt 212



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 210 cttcttgggcgacttcgcctccttctcggccgcggcgg 247
           ||||||||||||||| ||||||||  |||| |||||||
Sbjct: 450 cttcttgggcgacttggcctccttgccggcggcggcgg 413

---

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  127 bits (64), Expect = 3e-26
 Identities = 142/168 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||| ||||||||||| | ||||||||| || | |||||||||||| || ||||||||
Sbjct: 441 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 382

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            |||||||||||||| ||||| |||| |||||||||||  || || || | ||| | |||
Sbjct: 381 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 322

                                                           
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
           |||||| ||| ||||||||||||||  ||||||||| ||||| |||||
Sbjct: 321 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctc 274

---

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  127 bits (64), Expect = 3e-26
 Identities = 142/168 (84%)
 Strand = Plus / Minus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             |||||| ||||||||||| | ||||||||| || | |||||||||||| || ||||||||
Sbjct: 52603 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 52544

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              |||||||||||||| ||||| |||| |||||||||||  || || || | ||| | |||
Sbjct: 52543 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 52484

                                                             
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
             |||||| ||| ||||||||||||||  ||||||||| ||||| |||||
Sbjct: 52483 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctc 52436

---

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  125 bits (63), Expect = 1e-25
 Identities = 156/187 (83%)
 Strand = Plus / Minus

                                                                       
Query: 253 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 312
           ||||||||||||||||| | |||||||||||| |  || |||||||| || |||||||||
Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337

                                                                       
Query: 313 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 372
           ||||| || ||||| ||||| |||| |||||||||||  || || || | ||| ||||||
Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277

                                                                       
Query: 373 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 432
           ||||| ||| ||||||||||||||  ||| ||||| || || | ||| |||||||| |||
Sbjct: 276 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 217

                  
Query: 433 gcgaggt 439
           |||||||
Sbjct: 216 gcgaggt 210

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  119 bits (60), Expect = 8e-24
 Identities = 141/168 (83%)
 Strand = Plus / Plus

                                                                           
Query: 252     cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
               ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| ||
Sbjct: 9471223 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9471282

                                                                           
Query: 312     gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
               |||||| |||||||||||||| |||| |||||| | ||  || || || | |||||||||
Sbjct: 9471283 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9471342

                                                               
Query: 372     gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
               |||||| | | |||||||||||||| | |||||||| ||||| |||||
Sbjct: 9471343 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 9471390



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                     
Query: 383      tcttcttgttgtccttcgccgcgttgccggcaagctc 419
                |||||||||||||| |||||||||| ||||| |||||
Sbjct: 28998212 tcttcttgttgtccctcgccgcgttcccggccagctc 28998176



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 210     cttcttgggcgacttcgcctccttctcggccgcggcgg 247
               ||||||||||||||| ||||||||  |||| |||||||
Sbjct: 9471172 cttcttgggcgacttggcctccttgccggcggcggcgg 9471209



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 222     cttcgcctccttctcggccgcggc 245
               ||||||||||||||| ||||||||
Sbjct: 9599696 cttcgcctccttctccgccgcggc 9599719

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  119 bits (60), Expect = 8e-24
 Identities = 141/168 (83%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| ||
Sbjct: 168623 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 168682

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              |||||| |||||||||||||| |||| |||||| | ||  || || || | |||||||||
Sbjct: 168683 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 168742

                                                              
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
              |||||| | | |||||||||||||| | |||||||| ||||| |||||
Sbjct: 168743 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 168790



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 210    cttcttgggcgacttcgcctccttctcggccgcggcgg 247
              ||||||||||||||| ||||||||  |||| |||||||
Sbjct: 168572 cttcttgggcgacttggcctccttgccggcggcggcgg 168609

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  119 bits (60), Expect = 8e-24
 Identities = 141/168 (83%)
 Strand = Plus / Plus

                                                                           
Query: 252     cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
               ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| ||
Sbjct: 9469344 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9469403

                                                                           
Query: 312     gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
               |||||| |||||||||||||| |||| |||||| | ||  || || || | |||||||||
Sbjct: 9469404 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9469463

                                                               
Query: 372     gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
               |||||| | | |||||||||||||| | |||||||| ||||| |||||
Sbjct: 9469464 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 9469511



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                     
Query: 383      tcttcttgttgtccttcgccgcgttgccggcaagctc 419
                |||||||||||||| |||||||||| ||||| |||||
Sbjct: 29089634 tcttcttgttgtccctcgccgcgttcccggccagctc 29089598



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 210     cttcttgggcgacttcgcctccttctcggccgcggcgg 247
               ||||||||||||||| ||||||||  |||| |||||||
Sbjct: 9469293 cttcttgggcgacttggcctccttgccggcggcggcgg 9469330



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 222     cttcgcctccttctcggccgcggc 245
               ||||||||||||||| ||||||||
Sbjct: 9597817 cttcgcctccttctccgccgcggc 9597840

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  119 bits (60), Expect = 8e-24
 Identities = 141/168 (83%)
 Strand = Plus / Minus

                                                                            
Query: 252      cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
                ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| ||
Sbjct: 17417149 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 17417090

                                                                            
Query: 312      gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
                |||||| |||||||||||||| |||| |||||| | ||  || || || | |||||||||
Sbjct: 17417089 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 17417030

                                                                
Query: 372      gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
                |||||| | | |||||||||||||| | |||||||| ||||| |||||
Sbjct: 17417029 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 17416982



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                      
Query: 210      cttcttgggcgacttcgcctccttctcggccgcggcgg 247
                ||||||||||||||| ||||||||  |||| |||||||
Sbjct: 17417200 cttcttgggcgacttggcctccttgccggcggcggcgg 17417163

---

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  119 bits (60), Expect = 8e-24
 Identities = 141/168 (83%)
 Strand = Plus / Minus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| ||
Sbjct: 70541 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 70482

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             |||||| |||||||||||||| |||| |||||| | ||  || || || | |||||||||
Sbjct: 70481 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 70422

                                                             
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
             |||||| | | |||||||||||||| | |||||||| ||||| |||||
Sbjct: 70421 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 70374



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 210   cttcttgggcgacttcgcctccttctcggccgcggcgg 247
             ||||||||||||||| ||||||||  |||| |||||||
Sbjct: 70592 cttcttgggcgacttggcctccttgccggcggcggcgg 70555

---

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  119 bits (60), Expect = 8e-24
 Identities = 141/168 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| ||
Sbjct: 489 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 430

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||||| |||||||||||||| |||| |||||| | ||  || || || | |||||||||
Sbjct: 429 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 370

                                                           
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
           |||||| | | |||||||||||||| | |||||||| ||||| |||||
Sbjct: 369 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 322



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 210 cttcttgggcgacttcgcctccttctcggccgcggcgg 247
           ||||||||||||||| ||||||||  |||| |||||||
Sbjct: 540 cttcttgggcgacttggcctccttgccggcggcggcgg 503

---

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  117 bits (59), Expect = 3e-23
 Identities = 155/187 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 312
           ||||||||||||||||| | |||||||||||| |  || |||||||| || |||||||||
Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408

                                                                       
Query: 313 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 372
           ||||| || ||||| ||||| ||||  ||||||||||  || || || | ||| ||||||
Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348

                                                                       
Query: 373 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 432
           ||||| ||| ||||||||||||||  ||| ||||| || || | ||| |||||||| |||
Sbjct: 347 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 288

                  
Query: 433 gcgaggt 439
           |||||||
Sbjct: 287 gcgaggt 281

---

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score =  111 bits (56), Expect = 2e-21
 Identities = 137/164 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| ||||||||||||   || |||||| ||||| |||||||||||   |  ||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||||||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                       
Query: 396 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           | |||||||||| ||||| ||||| || | ||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggt 325

---

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score =  111 bits (56), Expect = 2e-21
 Identities = 137/164 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| ||||||||||||   || |||||| ||||| |||||||||||   |  ||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||||||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                       
Query: 396 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           | |||||||||| ||||| ||||| || | ||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggt 325

---

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score =  111 bits (56), Expect = 2e-21
 Identities = 137/164 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| ||||||||||||   || |||||| ||||| |||||||||||   |  ||
Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||||||
Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370

                                                       
Query: 396 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           | |||||||||| ||||| ||||| || | ||||||||||||||
Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggt 326

---

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || || ||||| ||
Sbjct: 360 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||   ||||||||||||||||||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccagga 188

---

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || || ||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||   ||||||||||||||||||||| ||||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccagga 230

---

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || || ||||| ||
Sbjct: 392 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 333

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||   ||||||||||||||||||||| ||||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccagga 220

---

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 235

---

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || || ||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||   ||||||||||||||||||||| ||||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccagga 230

---

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 149654 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 149713

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 149714 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 149773

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 149774 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 149826

---

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 235

---

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||| ||||  | ||||||||| |  ||||| || || || ||||| ||
Sbjct: 100907 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 100848

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 100847 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 100788

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||   ||||||||||||||||||||| ||||
Sbjct: 100787 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccagga 100735

---

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 986 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 927

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 926 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 867

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 866 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 814

---

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 401 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 342

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 341 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 282

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 281 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 229

---

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 430 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 371

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 370 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 311

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 310 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 258

---

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 427 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 367 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 308

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 307 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 255

---

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| |  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgtgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| |||| |||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccagga 188

---

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || || ||||| ||
Sbjct: 752 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 693

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 692 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 633

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||   ||||||||||||||||||||| ||||
Sbjct: 632 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccagga 580

---

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score =  103 bits (52), Expect = 5e-19
 Identities = 136/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| || |||||||||   || |||||| ||||| |||||||||||  ||| ||
Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||||||
Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335

                                                       
Query: 396 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           | |||||||||| ||||| ||||| || | ||| ||||||||||
Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggt 291

---

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score =  103 bits (52), Expect = 5e-19
 Identities = 136/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| || |||||||||   || |||||| ||||| |||||||||||  ||| ||
Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||||||
Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334

                                                       
Query: 396 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           | |||||||||| ||||| ||||| || | ||| ||||||||||
Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggt 290

---

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score =  103 bits (52), Expect = 5e-19
 Identities = 154/188 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| || | |||||| ||||||| ||| ||||||||||| ||||| ||
Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||| || || |||| |||||| ||||  || ||||| | |||||||||
Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
            || ||||| ||||||||||||||| | || || || || || ||||| || | ||||||
Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctccagaacctcagc 307

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 306 ggcgaggt 299



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 210 cttcttgggcgacttcgcctcctt 233
           ||||||||||||||| ||||||||
Sbjct: 540 cttcttgggcgactttgcctcctt 517

---

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score =  103 bits (52), Expect = 5e-19
 Identities = 154/188 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||| || | |||||| ||||||| ||| ||||||||||| ||||| ||
Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | | |||||| || || |||| |||||| ||||  || ||||| | |||||||||
Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
            || ||||| ||||||||||||||| | || || || ||||| ||||| || | ||||||
Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagc 288

                   
Query: 432 ggcgaggt 439
           ||||||||
Sbjct: 287 ggcgaggt 280



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 210 cttcttgggcgacttcgcctcctt 233
           ||||||||||||||| ||||||||
Sbjct: 521 cttcttgggcgactttgcctcctt 498

---

>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962),
           mRNA
          Length = 437

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 92/106 (86%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 307 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 248

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 247 cgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 202

---

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||| |||||||||||||  | ||||||||| |  |||||||| ||||| ||||||||
Sbjct: 360 cttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatggtgac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              | | |||||||||  ||| |||| ||||||||||| ||| ||  | | ||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtgacgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           |||||||||||||||||||||||||   ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctccagga 188

---

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 64629 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 64570

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 64569 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 64510

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 64509 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 64457



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 60548 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 60607

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 60608 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60667

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 60668 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 60720



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 101108 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 101167

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | | |||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 101168 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 101227

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 101228 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 101280

---

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 670

---

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 363 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 304

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 251

---

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 429 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 370

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 369 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 310

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 309 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 257

---

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 384 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 325

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 324 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 265

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 264 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 212

---

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 392 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 333

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 220

---

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 394 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 335

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 334 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 275

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 274 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 222

---

>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J
           (LOC632401), mRNA
          Length = 1833

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || || ||||| ||
Sbjct: 456 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 397

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            | | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 396 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 337

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 336 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 284

---

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 219

---

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 411 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 352

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 351 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 292

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 291 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 239

---

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 1308 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1249

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 1248 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1189

                                                                 
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
            ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 1188 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 1136

---

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 1309 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1250

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 1249 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1190

                                                                 
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
            ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 1189 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 1137

---

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 370 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 311

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 310 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 251

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 250 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 198

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 163973 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 164032

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 164033 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 164092

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 164093 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 164145



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 55436 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 55377

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 55376 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 55317

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 55316 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 55264



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 51355 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 51414

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 51415 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 51474

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 51475 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 51527



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 14872 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 14813

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | | |||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 14812 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 14753

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 14752 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 14700

---

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 232

---

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 33283 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 33342

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 33343 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 33402

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 33403 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 33455



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 10993 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 10934

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 10933 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 10874

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 10873 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 10821

---

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 59924 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 59983

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 59984 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60043

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 60044 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 60096



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
             ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 52549 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 52608

                                                                         
Query: 312   gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 52609 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 52668

                                                                  
Query: 372   gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 52669 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 52721

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 142450 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142509

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 142510 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142569

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 142570 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 142622



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 137771 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 137712

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 137711 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137652

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 137651 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 137599



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 174458 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 174517

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 174518 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 174577

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||| ||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 174578 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 174630



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/149 (81%)
 Strand = Plus / Plus

                                                                          
Query: 276    gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
              ||||||||| |  |||||||| || || ||||| |||| | | |||||||||  ||| ||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932

                                                                          
Query: 336    ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
              || ||||||||||| ||| ||  | |||||||||||||||||||| ||||||||||||||
Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992

                                           
Query: 396    cttcgccgcgttgccggcaagctctagga 424
                  ||||||||||| || ||||| ||||
Sbjct: 207993 gcgggccgcgttgcccgccagctccagga 208021

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 136886 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 136945

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 136946 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137005

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 137006 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 137058



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 142180 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142121

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 142120 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142061

                                      
Query: 372    gatgatgcgggtcttcttgttgtc 395
              ||||||||| ||||||||||||||
Sbjct: 142060 gatgatgcgcgtcttcttgttgtc 142037

---

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 210

---

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 390 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 331

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 330 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 271

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 270 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 218

---

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 393 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 334

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 333 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 274

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 273 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 221

---

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 143/173 (82%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 371 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 312

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || ||| |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 311 gc-ggccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 200

---

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 219

---

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 405 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 346

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 345 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 286

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 285 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 233

---

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 200

---

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 200

---

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 630 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 571

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 570 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 511

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 510 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 458

---

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 628 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 569

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 568 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 509

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 508 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 456

---

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 210

---

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 301

---

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 1469 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1528

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 1529 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1588

                                                                 
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
            ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 1589 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 1641

---

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 301

---

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 232

---

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| |  | |||||| || |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcaccgcctggatgtttggcagaacgccgccctgtgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| |||| |||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccagga 188

---

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 688

---

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 688

---

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 688

---

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 688

---

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 859 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 800

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 799 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 740

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 739 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 687

---

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 685

---

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 688

---

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 670

---

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 685

---

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:36202 IMAGE:5055276), complete cds
          Length = 550

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || || ||||| ||
Sbjct: 412 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 353

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            | | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 352 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 293

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 292 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 240

---

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 483 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 424

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 423 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 364

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 363 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 311

---

>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Plus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 524 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 583

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 584 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 643

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 644 gatgatgcgcgtcttcttgttgtc 667

---

>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 477 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 418

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 417 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 358

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 357 gatgatgcgcgtcttcttgttgtc 334

---

>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 470 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 411

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 410 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 351

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 350 gatgatgcgcgtcttcttgttgtc 327

---

>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 481 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 422

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 421 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 362

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 361 gatgatgcgcgtcttcttgttgtc 338

---

>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 345

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 344 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 284 gatgatgcgcgtcttcttgttgtc 261

---

>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Plus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 117 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 176

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 177 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 236

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 237 gatgatgcgcgtcttcttgttgtc 260

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 1933 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1874

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 1873 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1814

                                    
Query: 372  gatgatgcgggtcttcttgttgtc 395
            ||||||||| ||||||||||||||
Sbjct: 1813 gatgatgcgcgtcttcttgttgtc 1790

---

>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones
          Length = 1653

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 147/180 (81%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 1496 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1437

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            || | | ||||||||   ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 1436 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1377

                                                                        
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
            ||| ||||| ||||||||||| ||| ||||||| ||||| || ||||| |||| ||||||
Sbjct: 1376 gataatgcgcgtcttcttgttatccctcgccgcattgcccgccagctccaggatctcagc 1317

---

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  ||||| || || || ||||||||
Sbjct: 1165 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatggtgac 1106

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            |||| | |||||||||  ||| |||| ||||||||| ||||| ||  | ||||| || ||
Sbjct: 1105 gccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1046

                                    
Query: 372  gatgatgcgggtcttcttgttgtc 395
            ||||||||||||||||||||||||
Sbjct: 1045 gatgatgcgggtcttcttgttgtc 1022

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Plus

                                                                            
Query: 276      gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
                ||||||||| || |||||||||   || |||||| ||||| |||||||||||  ||| ||
Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608

                                                                            
Query: 336      ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
                || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||||||
Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668

                                        
Query: 396      cttcgccgcgttgccggcaagctc 419
                | |||||||||| ||||| |||||
Sbjct: 14468669 cctcgccgcgttcccggcgagctc 14468692



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 105/132 (79%)
 Strand = Plus / Plus

                                                                            
Query: 276      gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
                ||||||||| | ||||||||||   || ||||||||| || |||||||| |||  || ||
Sbjct: 20924457 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20924516

                                                                            
Query: 336      ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
                || ||||||||| || || ||  | | ||| | ||| | ||| ||| |||||||||||||
Sbjct: 20924517 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20924576

                            
Query: 396      cttcgccgcgtt 407
                | ||||||||||
Sbjct: 20924577 cctcgccgcgtt 20924588

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                            
Query: 276      gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
                ||||||||| ||||||||||||   || |||||| ||||| |||||||||||   |  ||
Sbjct: 21537003 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 21536944

                                                                            
Query: 336      ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
                || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||||||
Sbjct: 21536943 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 21536884

                                        
Query: 396      cttcgccgcgttgccggcaagctc 419
                | |||||||||| ||||| |||||
Sbjct: 21536883 cctcgccgcgttcccggcgagctc 21536860



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                            
Query: 334      tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
                |||| ||||||||||||||||||  | | |||||| || |  ||||||||||||||||||
Sbjct: 21539584 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 21539525

                                          
Query: 394      tccttcgccgcgttgccggcaagctc 419
                ||| |||||||||| ||||| |||||
Sbjct: 21539524 tccctcgccgcgttcccggcgagctc 21539499

---

>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA
          Length = 393

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 147/180 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | ||||||||   ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           ||| ||||| ||||||||||| ||| ||||||| ||||| || ||||| |||| ||||||
Sbjct: 240 gataatgcgcgtcttcttgttatccctcgccgcattgcccgccagctccaggatctcagc 181

---

>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1582_D10
          Length = 103475

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                         
Query: 276   gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
             ||||||||| ||||||||||||   || |||||| ||||| |||||||||||   |  ||
Sbjct: 74787 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 74728

                                                                         
Query: 336   ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
             || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||||||
Sbjct: 74727 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 74668

                                     
Query: 396   cttcgccgcgttgccggcaagctc 419
             | |||||||||| ||||| |||||
Sbjct: 74667 cctcgccgcgttcccggcgagctc 74644



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                         
Query: 334   tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
             |||| ||||||||||||||||||  | | |||||| || |  ||||||||||||||||||
Sbjct: 77368 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 77309

                                       
Query: 394   tccttcgccgcgttgccggcaagctc 419
             ||| |||||||||| ||||| |||||
Sbjct: 77308 tccctcgccgcgttcccggcgagctc 77283

---

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
           |||| ||||||||||||||||||  | | ||||||||| | |||||||||||||||||||
Sbjct: 365 tcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttg 306

                                                       
Query: 394 tccttcgccgcgttgccggcaagctctaggagctcagcggcgag 437
           ||| |||||||||| ||||| | ||| || | ||||||||||||
Sbjct: 305 tccctcgccgcgttcccggccaactccagaacctcagcggcgag 262

---

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
           |||| ||||||||||||||||||  | | ||||||||| | |||||||||||||||||||
Sbjct: 363 tcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttg 304

                                                       
Query: 394 tccttcgccgcgttgccggcaagctctaggagctcagcggcgag 437
           ||| |||||||||| ||||| | ||| || | ||||||||||||
Sbjct: 303 tccctcgccgcgttcccggccaactccagaacctcagcggcgag 260

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Plus

                                                                            
Query: 276      gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
                ||||||||| || |||||||||   || |||||| ||||| |||||||||||  ||| ||
Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892

                                                                            
Query: 336      ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
                || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||||||
Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952

                                        
Query: 396      cttcgccgcgttgccggcaagctc 419
                | |||||||||| ||||| |||||
Sbjct: 14422953 cctcgccgcgttcccggcgagctc 14422976



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 105/132 (79%)
 Strand = Plus / Plus

                                                                            
Query: 276      gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
                ||||||||| | ||||||||||   || ||||||||| || |||||||| |||  || ||
Sbjct: 20850671 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20850730

                                                                            
Query: 336      ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
                || ||||||||| || || ||  | | ||| | ||| | ||| ||| |||||||||||||
Sbjct: 20850731 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20850790

                            
Query: 396      cttcgccgcgtt 407
                | ||||||||||
Sbjct: 20850791 cctcgccgcgtt 20850802

---

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                         
Query: 276   gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
             ||||||||| || |||||||||   || |||||| ||||| |||||||||||  ||| ||
Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684

                                                                         
Query: 336   ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
             || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||||||
Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624

                                     
Query: 396   cttcgccgcgttgccggcaagctc 419
             | |||||||||| ||||| |||||
Sbjct: 48623 cctcgccgcgttcccggcgagctc 48600

---

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatggtcac 328

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 327 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 267 gatgatgcgcgtcttcttgttgtc 244

---

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 523 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 464

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 463 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 404

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 403 gatgatgcgcgtcttcttgttgtc 380

---

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 122/147 (82%)
 Strand = Plus / Plus

                                                                       
Query: 249 ggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggt 308
           |||||||||||| ||||| |||| ||  |||||||| | ||| ||||||   ||||||||
Sbjct: 468 ggacttcttgggcagcagaacggcgtgaatgttgggcagcacaccgccggacgcaatggt 527

                                                                       
Query: 309 gacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcg 368
            ||| || | ||||||||||| || |||| ||||||||||| ||||||  | | ||||||
Sbjct: 528 cacgtcgcccagcagcttgcccagctcctcgtcgttgcggatggcgagctggatgtggcg 587

                                      
Query: 369 cgggatgatgcgggtcttcttgttgtc 395
           ||||| ||||||| |||||||||||||
Sbjct: 588 cgggacgatgcggttcttcttgttgtc 614

---

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
           |||| ||||||||||||||||||  | | |||||| || |  ||||||||||||||||||
Sbjct: 436 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 377

                                                         
Query: 394 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           ||| |||||||||| ||||| ||||| || | ||||||||||||||
Sbjct: 376 tccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggt 331

---

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
           |||| ||||||||||||||||||  | | |||||| || |  ||||||||||||||||||
Sbjct: 436 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 377

                                                         
Query: 394 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           ||| |||||||||| ||||| ||||| || | ||||||||||||||
Sbjct: 376 tccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggt 331

---

>gb|AY108339.1| Zea mays PCO070432 mRNA sequence
          Length = 811

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
           |||| ||||||||||||||||||  | | ||||||||||| |||||||||||||||||||
Sbjct: 391 tcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttcttgttg 332

                                     
Query: 394 tccttcgccgcgttgccggcaagctc 419
           |||   |||||||| |||||||||||
Sbjct: 331 tcccgagccgcgttcccggcaagctc 306

---

>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA
          Length = 1754

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || || ||||| ||
Sbjct: 377 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 318

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            | | | |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 317 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 258

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 257 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 205

---

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Plus

                                                                          
Query: 252    cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
              ||||||||| ||||||||||  | ||| ||||| |  |||||||| || || ||||| ||
Sbjct: 108584 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 108643

                                                                          
Query: 312    gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
               | | | |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 108644 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 108703

                                                                   
Query: 372    gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              ||||||||| ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 108704 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 108756

---

>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130307C13 product:HISTONE H2A homolog
           [Gallus gallus], full insert sequence
          Length = 1754

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || || ||||| ||
Sbjct: 377 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 318

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            | | | |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 317 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 258

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 257 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 205

---

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||| ||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone H2A.l (H2A/l)
           (LOC502125), mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| |  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcaccgcttggatgttgggcagaacgccgccctgggcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            | | | |||||||||  ||||||||  ||||| || | ||| ||  | |||||||||||
Sbjct: 300 acggcccagcagcttgttgagttcctcatcgttccgaatggccagctgtaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgtgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 188

---

>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x)
           (LOC500987), mRNA
          Length = 1569

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || || || ||
Sbjct: 639 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagtcac 580

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| |||||||||||  || ||  | |||||||||||
Sbjct: 579 gccgcccagcagcttgttgagctcctcgtcgttgcggatagccagctgcaggtggcgcgg 520

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||| ||||| |||||||||||||||   ||||||||||| || ||||| ||||
Sbjct: 519 gataatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccagga 467

---

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 884 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 825

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | | |||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 824 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 765

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 764 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 712

---

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 894 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 835

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 834 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 775

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||| ||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 774 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 722

---

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | | |||||||  ||| |||| ||||||||||| ||| ||  | |||||||||||
Sbjct: 300 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:118637 IMAGE:1383389), complete cds
          Length = 587

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||| ||||| |  |||||||| || || ||||| ||
Sbjct: 434 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 375

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            | | | |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 374 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 315

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||| ||||||||||||| || ||||| ||||
Sbjct: 314 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 262

---

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||  ||||||||||| ||| ||  | |||||||||||
Sbjct: 363 gcggcccagcagcttgttgagctccacgtcgttgcggatggccagctgcaggtggcgcgg 304

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 251

---

>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Plus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 74  cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 133

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| |   | |||||||||||
Sbjct: 134 cccggacagcagcttgttcagctcctcgtcgttgcggatggccaactgcaggtggcgcgg 193

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 194 gatgatgcgcgtcttcttgttgtc 217

---

>emb|X14730.1|CMHIST2A Duck H2A histone gene
          Length = 845

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 140/172 (81%)
 Strand = Plus / Minus

                                                                       
Query: 253 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 312
           |||||||| ||||||||||  | ||||||||| | ||| ||||| || || |||||||| 
Sbjct: 509 ttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgacc 450

                                                                       
Query: 313 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 372
             | | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| |||
Sbjct: 449 ttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcggggg 390

                                                               
Query: 373 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           |||||||| ||||||||||||||    ||||||||||| || ||||||||||
Sbjct: 389 atgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctctagga 338

---

>ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (predicted)
           (Hist1h2ao_predicted), mRNA
          Length = 483

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || ||||| || ||
Sbjct: 360 cttcttgggcagcagcacggcttggatgttgggcaggacgccaccctgcgcaatagtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           || | | |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgg 241

                                                           
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 419
            |||||||| ||||| ||||||||| ||||||||||||| || |||||
Sbjct: 240 aatgatgcgtgtctttttgttgtccctcgccgcgttgcctgcgagctc 193

---

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 357 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 298

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | || ||||||||
Sbjct: 297 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 238

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 237 gatgatgcgcgtcttcttgttgtc 214

---

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 471 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 412

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||||  |||||||||   || |||| ||||||||||| ||| ||  | || ||||||||
Sbjct: 411 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 352

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           ||||||||| ||||||||||||||
Sbjct: 351 gatgatgcgcgtcttcttgttgtc 328

---

>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA
          Length = 413

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| ||||||||||||
Sbjct: 313 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatg 254

                                                      
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctcta 421
           ||||||||||||||||||   ||||||||||| || |||||||
Sbjct: 253 cgggtcttcttgttgtcccgggccgcgttgcccgccagctcta 211

---

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                        
Query: 319  agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
            |||||||||  |||||| | ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 1293 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 1234

                                                                   
Query: 379  cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcgg 433
            |||||||||||||||||    ||||||||||| || ||||| |||| ||| ||||
Sbjct: 1233 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcgg 1179

---

>ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (predicted)
           (Hist2h2aa_predicted), mRNA
          Length = 591

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  |||||| | ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 491 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 432

                                                                  
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcgg 433
           |||||||||||||||||    ||||||||||| || ||||| |||| ||| ||||
Sbjct: 431 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcgg 377

---

>ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2aa1 protein
           (LOC499676), mRNA
          Length = 675

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  |||||| | ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 566 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 507

                                                                  
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcgg 433
           |||||||||||||||||    ||||||||||| || ||||| |||| ||| ||||
Sbjct: 506 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcgg 452

---

>ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone H2a(A)-613
           (LOC499675), mRNA
          Length = 510

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  |||||| | ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 407 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 348

                                                                  
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcgg 433
           |||||||||||||||||    ||||||||||| || ||||| |||| ||| ||||
Sbjct: 347 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcgg 293

---

>gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds
          Length = 613

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 120/146 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 gacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtg 309
           ||||||||||| || ||||| |||| |||||||||||  ||||||||    |||||||||
Sbjct: 359 gacttcttgggcaggagcaccgagtggatgttggggaggacgccgcccgaggcaatggtg 300

                                                                       
Query: 310 acgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgc 369
           |||||| |||| | ||||  ||| |||| |||||||||||| ||||| |  |||||||||
Sbjct: 299 acgccgccgaggaacttgttgagctcctcgtcgttgcggaccgcgaggacgaggtggcgc 240

                                     
Query: 370 gggatgatgcgggtcttcttgttgtc 395
           ||  ||| |||  |||||||||||||
Sbjct: 239 ggcgtgacgcgcttcttcttgttgtc 214

---

>gb|AY104826.1| Zea mays PCO099353 mRNA sequence
          Length = 793

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
           |||| ||||||||| ||||||||  | | ||| ||||| | |||||||||||||||||| 
Sbjct: 380 tcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcgggtcttcttgtta 321

                                                         
Query: 394 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggt 439
           ||| |||| ||||| || |||||||| |||| ||||||||||||||
Sbjct: 320 tccctcgctgcgttcccagcaagctccaggacctcagcggcgaggt 275

---

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || || || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              | | |||||||||  ||| |||| ||||||||||| ||||||  | |||||||| ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 271

---

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || || || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              | | |||||||||  ||| |||| ||||||||||| ||||||  | |||||||| ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 271

---

>ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H2A.l (H2A/l)
           (LOC462490), mRNA
          Length = 565

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 365 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 306

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 305 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 246

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 245 ccggccagctccaggatctcggcgg 221

---

>gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:1730
           IMAGE:2988620), complete cds
          Length = 1656

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 375 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 316

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 315 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 256

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 255 ccggccagctccaggatctcggcgg 231

---

>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA
          Length = 393

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| |  | ||||||||| |  |||||||| ||||| ||||||||
Sbjct: 360 cttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgagcgatggtgac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              | | |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgg 241

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||| || ||||||||||||||||||   ||||||||||| || ||||| ||||
Sbjct: 240 gataatacgggtcttcttgttgtcccgggccgcgttgcccgccagctccagga 188

---

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                          
Query: 289    acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
              |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 108497 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 108438

                                                                          
Query: 349    acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
              | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 108437 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 108378

                                       
Query: 409    ccggcaagctctaggagctcagcgg 433
              ||||| ||||| |||| ||| ||||
Sbjct: 108377 ccggccagctccaggatctcggcgg 108353



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                          
Query: 334    tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
              |||| ||||||||||| ||| ||  | ||||||||||||||||||||||||||||| |||
Sbjct: 201252 tcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttattg 201193

                                          
Query: 394    tccttcgccgcgttgccggcaagctcta 421
              ||    ||||||||||| || |||||||
Sbjct: 201192 tcgcgagccgcgttgccagctagctcta 201165



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                                
Query: 361   aggtggcgcgggatgatgcgggtcttcttgttgtc 395
             |||||||||||||||||||||||||||||||||||
Sbjct: 17260 aggtggcgcgggatgatgcgggtcttcttgttgtc 17294



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                          
Query: 334    tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
              |||| ||||||||||| ||| ||  | ||||| || ||||||||||||||||||||||||
Sbjct: 182966 tcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttgttg 183025

                
Query: 394    tc 395
              ||
Sbjct: 183026 tc 183027

---

>ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA
          Length = 546

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 411 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 352

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 351 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 292

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 291 ccggccagctccaggatctcggcgg 267

---

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 657 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgtcac 598

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 597 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 538

                                                                
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           ||||||||| ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 537 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 485

---

>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the
             3' part of the HFE gene for haemochromatosis protein, two
             genes for novel histone 4 family members, two genes for
             novel histone 1 family members, three genes for novel
             histone 2B family members, a gene for a novel histone 2A
             family member, a novel pseudogene, STSs, GSSs, ESTs and
             CpG islands, complete sequence
          Length = 101099

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                         
Query: 289   acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
             |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 30878 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 30819

                                                                         
Query: 349   acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
             | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 30818 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 30759

                                      
Query: 409   ccggcaagctctaggagctcagcgg 433
             ||||| ||||| |||| ||| ||||
Sbjct: 30758 ccggccagctccaggatctcggcgg 30734

---

>gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter sequence
          Length = 457

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 151 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 92

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 91  atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 32

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 31  ccggccagctccaggatctcggcgg 7

---

>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 120/145 (82%), Gaps = 1/145 (0%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 231 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 172

                                                                       
Query: 312 g-ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcg 370
             ||||  |||||||||   || |||| ||||||||||| ||| ||  | ||||||||||
Sbjct: 171 ctccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcg 112

                                    
Query: 371 ggatgatgcgggtcttcttgttgtc 395
           |||||||||| ||||||||||||||
Sbjct: 111 ggatgatgcgcgtcttcttgttgtc 87

---

>emb|Z80778.1|HSH2AL H.sapiens H2A/l gene
          Length = 601

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 462 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 403

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 402 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 343

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 342 ccggccagctccaggatctcggcgg 318

---

>emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones
          Length = 1635

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 125/153 (81%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| |||||||| |  | ||||||||| |  |||||||| || || ||||| ||
Sbjct: 1242 cttcttgggcagcagcacagcctggatgttgggcagaacgccgccctgcgcgatggtcac 1183

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            || | | |||||||||  ||| ||||  |||||||||| ||| ||  | |||||||||||
Sbjct: 1182 gcggcccagcagcttgttgagctcctcatcgttgcggatggccagctgcaggtggcgcgg 1123

                                             
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgc 404
            |||||| || ||||||||||||||| |||||||
Sbjct: 1122 gatgatccgcgtcttcttgttgtccctcgccgc 1090

---

>emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1446

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 353 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 294

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 293 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 234

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 233 ccggccagctccaggatctcggcgg 209

---

>emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1462

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 353 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 294

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 293 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 234

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 233 ccggccagctccaggatctcggcgg 209

---

>emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1620

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 339 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 280

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 279 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 220

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 219 ccggccagctccaggatctcggcgg 195

---

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
             hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
             sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Plus

                                                                         
Query: 289   acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
             |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 16504 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 16563

                                                                         
Query: 349   acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
             | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 16564 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 16623

                                      
Query: 409   ccggcaagctctaggagctcagcgg 433
             ||||| ||||| |||| ||| ||||
Sbjct: 16624 ccggccagctccaggatctcggcgg 16648



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                                 
Query: 361    aggtggcgcgggatgatgcgggtcttcttgttgtc 395
              |||||||||||||||||||||||||||||||||||
Sbjct: 107741 aggtggcgcgggatgatgcgggtcttcttgttgtc 107707

---

>gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA, complete cds
          Length = 1666

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 420 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 361

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 360 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 301

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 300 ccggccagctccaggatctcggcgg 276

---

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| |  |||||||| || || ||||| |||| | | |||||||||  ||| ||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||||| ||| ||  | |||||||||||||||||||| ||||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                        
Query: 396 cttcgccgcgttgccggcaagctctagga 424
               ||||||||||| || ||||| ||||
Sbjct: 216 gcgggccgcgttgcccgccagctccagga 188

---

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| |  |||||||| || || ||||| |||| | | |||||||||  ||| ||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||||| ||| ||  | |||||||||||||||||||| ||||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                        
Query: 396 cttcgccgcgttgccggcaagctctagga 424
               ||||||||||| || ||||| ||||
Sbjct: 716 gcgggccgcgttgcccgccagctccagga 688

---

>gb|BC085010.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:99519
           IMAGE:5933682), complete cds
          Length = 1516

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 372 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 313

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 312 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 253

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 252 ccggccagctccaggatctcggcgg 228

---

>gb|AY894000.1| Synthetic construct Homo sapiens clone FLH130938.01L histone 1 H2ac
           (HIST1H2AC) mRNA, partial cds
          Length = 393

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 323 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 264

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 263 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 204

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 203 ccggccagctccaggatctcggcgg 179

---

>gb|AY893556.1| Synthetic construct Homo sapiens clone FLH130901.01X histone 1 H2ac
           (HIST1H2AC) mRNA, complete cds
          Length = 393

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 323 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 264

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 263 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 204

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 203 ccggccagctccaggatctcggcgg 179

---

>gb|AY893555.1| Synthetic construct Homo sapiens clone FLH130900.01X histone 1 H2ac
           (HIST1H2AC) mRNA, complete cds
          Length = 393

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 323 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 264

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 263 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 204

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 203 ccggccagctccaggatctcggcgg 179

---

>gb|BC050602.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:60051
           IMAGE:6526471), complete cds
          Length = 1478

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 367 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 308

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 307 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 248

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 247 ccggccagctccaggatctcggcgg 223

---

>gb|AY131984.1| Homo sapiens histone H2A (HIST1H2AC) gene, complete cds
          Length = 1173

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| ||||||||||| || | | | ||||| |||  ||| |||| ||||||||||
Sbjct: 715 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 656

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | | |||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 655 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 596

                                    
Query: 409 ccggcaagctctaggagctcagcgg 433
           ||||| ||||| |||| ||| ||||
Sbjct: 595 ccggccagctccaggatctcggcgg 571

---

>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x)
           (LOC466864), mRNA
          Length = 432

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 240 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181

                   
Query: 432 ggcgaggt 439
           || |||||
Sbjct: 180 ggtgaggt 173

---

>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:4759 IMAGE:3537648), complete cds
          Length = 1580

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 403 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 344

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 343 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 284

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 283 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 224

                   
Query: 432 ggcgaggt 439
           || |||||
Sbjct: 223 ggtgaggt 216

---

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 112/136 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 348
           |||||||| || || ||||| |||| | | |||||||||  ||| |||| ||||||||||
Sbjct: 470 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 411

                                                                       
Query: 349 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 408
           | ||| ||  | |||||||||||||||||||| ||||||||||||||    |||||||||
Sbjct: 410 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 351

                           
Query: 409 ccggcaagctctagga 424
           || || ||||| ||||
Sbjct: 350 cccgccagctccagga 335

---

>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J
           isoform 2 (LOC486669), mRNA
          Length = 598

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 118/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||||||
Sbjct: 438 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtgac 379

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
                | |||||||||  ||| |||| ||||||||||| ||||||  | |||||||||||
Sbjct: 378 tttccccagcagcttgttgagctcctcgtcgttgcggatggcgagttgcaggtggcgcgg 319

                                   
Query: 372 gatgatgcgggtcttcttgttgtc 395
           |||||| | |||||||||||||||
Sbjct: 318 gatgatcctggtcttcttgttgtc 295

---

>ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AFX), mRNA
          Length = 1651

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254

                   
Query: 432 ggcgaggt 439
           || |||||
Sbjct: 253 ggtgaggt 246

---

>emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chromosome 6 Contains the
             3' end of the gene for sectretagogin (SECRET), the genes
             for novel H2A and H2B histone family members, H2A and H2B
             histone family pseudogenes, complete sequence
          Length = 49963

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                         
Query: 319   agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
             ||||||||| |||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 39873 agcagcttgtcgagctccttgtcgttgcggatggccagctgcaggtggcgcgggatgatg 39814

                             
Query: 379   cgggtcttcttgttgt 394
             ||||||||||| ||||
Sbjct: 39813 cgggtcttcttcttgt 39798

---

>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 100/120 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 335
           ||||||||| | ||||||||| || || ||||| || ||||  |||||||||   || ||
Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagcttgttcagctc 82

                                                                       
Query: 336 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 395
           || ||||||||||| ||| ||  | |||||||||||||||||||| ||||||||||||||
Sbjct: 81  ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 22

---

>emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X
          Length = 1585

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254

                   
Query: 432 ggcgaggt 439
           || |||||
Sbjct: 253 ggtgaggt 246

---

>gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:4703 IMAGE:3534359), complete cds
          Length = 1616

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 398 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 339

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 338 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 279

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 278 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 219

                   
Query: 432 ggcgaggt 439
           || |||||
Sbjct: 218 ggtgaggt 211

---

>emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1373

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 415 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 356

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 355 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 296

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 295 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 236

                   
Query: 432 ggcgaggt 439
           || |||||
Sbjct: 235 ggtgaggt 228

---

>ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (RGD1564767_predicted),
           mRNA
          Length = 393

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                       
Query: 361 aggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctct 420
           |||||||||||||||||||| ||||| ||||||||| ||||||||||||| || ||||| 
Sbjct: 251 aggtggcgcgggatgatgcgtgtctttttgttgtccctcgccgcgttgcccgccagctcc 192

               
Query: 421 agga 424
           ||||
Sbjct: 191 agga 188

---

>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr)
            genes, complete cds
          Length = 2396

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 115/140 (82%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  |||||||| || || ||||||||
Sbjct: 1584 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatggtgac 1525

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
             ||| | |||||||||  ||| |||| ||||||||| ||||| ||  | ||||| || ||
Sbjct: 1524 tccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1465

                                
Query: 372  gatgatgcgggtcttcttgt 391
            ||||||||||||||| ||||
Sbjct: 1464 gatgatgcgggtcttgttgt 1445

---

>gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX) gene, complete cds
          Length = 5462

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 2431 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 2372

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 2371 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 2312

                                                                        
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
            |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 2311 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 2252

                    
Query: 432  ggcgaggt 439
            || |||||
Sbjct: 2251 ggtgaggt 2244

---

>dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000067010, based on BLAT search
          Length = 161

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                       
Query: 361 aggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctct 420
           |||||||| ||||||||||| ||||||||||||||| ||||||||||||| || ||||| 
Sbjct: 146 aggtggcgagggatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctcc 87

               
Query: 421 agga 424
           ||||
Sbjct: 86  agga 83

---

>gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:19656 IMAGE:3139343), complete cds
          Length = 1589

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 413 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 354

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
           |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 353 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 294

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 293 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 234

                   
Query: 432 ggcgaggt 439
           || |||||
Sbjct: 233 ggtgaggt 226

---

>dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2589C9, complete
            sequences
          Length = 46239

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Plus

                                                                        
Query: 252  cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
            ||||||||| ||||||||||  | ||||||||| |  ||||| || || || || || ||
Sbjct: 9807 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 9866

                                                                        
Query: 312  gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            |||| | |||||||||  ||| |||| ||||||||||| ||| ||  | |||||||| ||
Sbjct: 9867 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 9926

                                                                        
Query: 372  gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
            |||||| || ||||||||||||||    ||||| ||||| || ||||| |||| ||||||
Sbjct: 9927 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 9986

                    
Query: 432  ggcgaggt 439
            || |||||
Sbjct: 9987 ggtgaggt 9994

---

>gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complete cds
          Length = 575

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                       
Query: 361 aggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctct 420
           |||||||||||||||||||| ||||| ||||||||| ||||||||||||| || ||||| 
Sbjct: 315 aggtggcgcgggatgatgcgtgtctttttgttgtccctcgccgcgttgcccgccagctcc 256

               
Query: 421 agga 424
           ||||
Sbjct: 255 agga 252

---

>ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC529277), mRNA
          Length = 522

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||| ||||||||||||
Sbjct: 294 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatg 235

                                                      
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctcta 421
           || |||||||||||||||   ||||||||||| || |||||||
Sbjct: 234 cgcgtcttcttgttgtcccgggccgcgttgcccgccagctcta 192

---

>gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MGC:120083
           IMAGE:40021705), complete cds
          Length = 480

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Minus

                                                                       
Query: 331 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 390
           ||||||| ||||||||||| ||| ||  | ||||| || ||||||||||| |||||||||
Sbjct: 281 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 222

                                                      
Query: 391 ttgtccttcgccgcgttgccggcaagctctaggagctcagcgg 433
           ||||||   ||||||||||| || ||||| |||| ||||||||
Sbjct: 221 ttgtcccgagccgcgttgcccgccagctccaggatctcagcgg 179

---

>ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone protein Hist1h2af
           (LOC471884), mRNA
          Length = 420

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 334 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 393
           |||| ||||||||||| ||| ||  | |||||||||||||||||||||||||||||||||
Sbjct: 278 tcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttgttg 219

             
Query: 394 tc 395
           ||
Sbjct: 218 tc 217

---

>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA
          Length = 390

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 293 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 234

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 233 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 336 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 277

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 276 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 231

---

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 320 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 261

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 260 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 215

---

>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122),
           partial cds
          Length = 543

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 320 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 261

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 260 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 215

---

>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA
          Length = 390

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 293 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 234

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 233 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC670497), mRNA
          Length = 3003

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 299 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 240

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 239 cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 194

---

>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC667728), mRNA
          Length = 3054

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 350 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 291

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 290 cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 245

---

>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC677006), mRNA
          Length = 2991

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 287 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 228

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 227 cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 182

---

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 320 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 261

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 260 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 215

---

>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds
          Length = 819

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 319 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 260

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 259 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 214

---

>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA
          Length = 547

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 146/182 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| |  | ||||||||| | ||||||||| || || ||||| ||
Sbjct: 389 cttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcac 330

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||| | |||||||||   || |||| ||||||||| ||||| ||  | ||||| |||||
Sbjct: 329 tccgcccagcagcttgttcagctcctcgtcgttgcgcacggccagctgcaggtgccgcgg 270

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||| | |||||||||||||||    || ||||| ||||| ||||| |||| ||||||
Sbjct: 269 gatgatcctggtcttcttgttgtcgcgggcggcgttcccggccagctccaggatctcagc 210

             
Query: 432 gg 433
           ||
Sbjct: 209 gg 208

---

>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA
          Length = 775

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 147/182 (80%), Gaps = 1/182 (0%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           ||||||||| |||||||| |  | ||||||||| | ||||||||| ||||| ||||| ||
Sbjct: 398 cttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgagcgatggtcac 339

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
            ||  | |||||||||  ||| |||| ||||||||| || || ||  | |||||||| ||
Sbjct: 338 tcctcccagcagcttgttgagctcctcgtcgttgcgcaccgccagctgcaggtggcgggg 279

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           |||||||||||| |||||||||||    || ||||||||||| ||||| |||| ||| ||
Sbjct: 278 gatgatgcgggt-ttcttgttgtcgcgggcagcgttgccggccagctccaggatctcggc 220

             
Query: 432 gg 433
           ||
Sbjct: 219 gg 218

---

>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds
          Length = 1680

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 501 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 442

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 441 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 396



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 364 tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagg 423
           ||||||||||||||||| ||||||||||||||    ||||||||||| || ||||| |||
Sbjct: 890 tggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagg 949

            
Query: 424 a 424
           |
Sbjct: 950 a 950

---

>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial)
          Length = 523

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 315 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 256

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 255 cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 210

---

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                        
Query: 319  agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
            |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 1109 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 1050

                                                          
Query: 379  cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
            || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 1049 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 1004

---

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                        
Query: 319  agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
            |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 1150 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 1091

                                                          
Query: 379  cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
            || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 1090 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 1045

---

>dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930118D21 product:unclassifiable, full
           insert sequence
          Length = 2833

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 509 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 568

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 569 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 614

---

>dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-14092, similar to human
           histone 2, H2aa (HIST2H2AA), mRNA, RefSeq: NM_003516.2
          Length = 778

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 146/182 (80%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 311
           |||||| |||||||||||||  | |||||| || |  |||||||| || || ||||||||
Sbjct: 559 cttcttagggagcagcacggcctggatgttaggcaggacgccgccctgggcgatggtgac 500

                                                                       
Query: 312 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 371
              | | |||||||||   ||||||| ||||||||||| ||| ||  | ||||| || ||
Sbjct: 499 tttgcccagcagcttgttcagttcctcgtcgttgcggatggccagctggaggtgacgagg 440

                                                                       
Query: 372 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 431
           ||||||||| |||||||||||||||   ||||||||||| || ||||| |||| ||| ||
Sbjct: 439 gatgatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccaggatctcggc 380

             
Query: 432 gg 433
           ||
Sbjct: 379 gg 378

---

>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700048I17 product:histone gene complex
           2, full insert sequence
          Length = 578

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 336 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 277

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 276 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 231

---

>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932439K17 product:histone gene complex
           2, full insert sequence
          Length = 2876

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 151 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 92

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 91  cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 46

---

>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610031H01 product:histone gene complex
           2, full insert sequence
          Length = 545

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 337 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 278

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 277 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 232

---

>dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930558E18 product:histone gene complex
           2, full insert sequence
          Length = 1059

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 89  agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 148

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 149 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 194

---

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                        
Query: 319  agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
            |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 1299 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 1240

                                                          
Query: 379  cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
            || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 1239 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 1194

---

>gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2a(B)-613, and histone
            H2b-613 (H2b) genes, complete cds
          Length = 2618

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                        
Query: 319  agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
            |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 1300 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 1359

                                                          
Query: 379  cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
            || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 1360 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 1405



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 364 tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagg 423
           ||||||||||||||||| ||||||||||||||    ||||||||||| || ||||| |||
Sbjct: 911 tggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagg 852

            
Query: 424 a 424
           |
Sbjct: 851 a 851

---

>dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210403F13 product:histone gene complex
           2, full insert sequence
          Length = 2428

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 567 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 626

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 627 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 672

---

>ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA
          Length = 393

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 293 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 234

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 233 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 188

---

>gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, complete cds
          Length = 1440

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 491 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 550

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 551 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 596

---

>gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, complete cds
          Length = 1387

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 790 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 731

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 730 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 685

---

>gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, complete cds
          Length = 1387

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 790 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 731

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 730 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 685

---

>gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, complete cds
          Length = 1200

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 601 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 542

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 541 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 496



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                        
Query: 364  tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagg 423
            ||||||||||||||||| ||||||||||||||    ||||||||||| || ||||| |||
Sbjct: 990  tggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagg 1049

             
Query: 424  a 424
            |
Sbjct: 1050 a 1050

---

>gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:73680
           IMAGE:1448126), complete cds
          Length = 552

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 320 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 261

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 260 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 215

---

>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence
          Length = 712

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Plus

                                                                       
Query: 317 cgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatga 376
           |||||||||||| |||||||| ||||||||| ||||||||  | | ||| ||||| | ||
Sbjct: 337 cgagcagcttgctgagttcctcgtcgttgcgcacggcgagctggatgtgacgcggcacga 396

                                             
Query: 377 tgcgggtcttcttgttgtccttcgccgcgttgcc 410
           ||||| |||||||||||||   ||||||||||||
Sbjct: 397 tgcggttcttcttgttgtcgcgcgccgcgttgcc 430

---

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                         
Query: 319   agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
             |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 70512 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 70453

                                                           
Query: 379   cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 70452 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 70407



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                         
Query: 319   agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
             |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 64597 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 64656

                                                           
Query: 379   cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 64657 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 64702



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Plus

                                                                         
Query: 319   agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
             |||||||||  ||| |||| ||||||||||| ||| ||  | || |||||||||||||||
Sbjct: 45191 agcagcttgttgagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatg 45250

                                                           
Query: 379   cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 45251 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 45296



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                         
Query: 364   tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagg 423
             ||||||||||||||||| ||||||||||||||    ||||||||||| || ||||| |||
Sbjct: 44802 tggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagg 44743

              
Query: 424   a 424
             |
Sbjct: 44742 a 44742

---

>gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome 13, complete sequence
          Length = 189500

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                          
Query: 319    agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
              |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 132639 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 132580

                                                            
Query: 379    cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 132579 cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 132534

---

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                         
Query: 319   agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
             |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 36096 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 36037

                                                           
Query: 379   cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 36036 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 35991



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                         
Query: 319   agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
             |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 30181 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 30240

                                                           
Query: 379   cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 30241 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 30286



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 88/106 (83%)
 Strand = Plus / Minus

                                                                         
Query: 319   agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
             |||||||||  ||| |||| ||||||||||| ||| ||  | || |||||||||||||||
Sbjct: 55502 agcagcttgttgagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatg 55443

                                                           
Query: 379   cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
             || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 55442 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 55397



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                         
Query: 364   tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagg 423
             ||||||||||||||||| ||||||||||||||    ||||||||||| || ||||| |||
Sbjct: 55891 tggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagg 55950

              
Query: 424   a 424
             |
Sbjct: 55951 a 55951

---

>gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone IMAGE:1349026)
          Length = 570

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 329 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 270

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 269 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 224

---

>ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB300144.00.0), partial
           mRNA
          Length = 378

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 278 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 219

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 218 cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 173

---

>gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:107211
           IMAGE:6771160), complete cds
          Length = 637

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 377 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 318

                                                         
Query: 379 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
           || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 317 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 272

---

>gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome 13, complete sequence
          Length = 208856

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                          
Query: 319    agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
              |||||||||  ||| |||| ||||||||||| ||| ||  | ||||||||||||||||||
Sbjct: 184226 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 184285

                                                            
Query: 379    cgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 424
              || ||||||||||||||    ||||||||||| || ||||| ||||
Sbjct: 184286 cgagtcttcttgttgtcgcgggccgcgttgcccgccagctccagga 184331

---

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | | ||||||||||||||||
Sbjct: 239 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatg 180

                            
Query: 379 cgggtcttcttgttgtc 395
           |||||||||||||||||
Sbjct: 179 cgggtcttcttgttgtc 163

---

>gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125892
           IMAGE:40031339), complete cds
          Length = 438

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 319 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 378
           |||||||||  ||| |||| ||||||||||| ||| ||  | | ||||||||||||||||
Sbjct: 293 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatg 234

                            
Query: 379 cgggtcttcttgttgtc 395
           |||||||||||||||||
Sbjct: 233 cgggtcttcttgttgtc 217


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,235,664
Number of Sequences: 3902068
Number of extensions: 3235664
Number of successful extensions: 62610
Number of sequences better than 10.0: 650
Number of HSP's better than 10.0 without gapping: 652
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 60858
Number of HSP's gapped (non-prelim): 1636
length of query: 439
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 417
effective length of database: 17,147,199,772
effective search space: 7150382304924
effective search space used: 7150382304924
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---