>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete
             sequence
          Length = 100991

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 133   aaaatagagataccatgaaga 153
             |||||||||||||||||||||
Sbjct: 74383 aaaatagagataccatgaaga 74363

>gb|AC150845.11| Medicago truncatula clone mth2-150a2, complete sequence
          Length = 131577

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 133    aaaatagagataccatgaaga 153
              |||||||||||||||||||||
Sbjct: 129344 aaaatagagataccatgaaga 129364

>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence
          Length = 100985

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 133   aaaatagagataccatgaaga 153
             |||||||||||||||||||||
Sbjct: 74386 aaaatagagataccatgaaga 74366

>emb|AL136532.22| Human DNA sequence from clone RP11-379F14 on chromosome 20 Contains the
             MRPS16P gene for mitochondrial ribosomal protein S16
             pseudogene, complete sequence
          Length = 94387

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    tgcagaaccatatttagagt 59
             ||||||||||||||||||||
Sbjct: 62766 tgcagaaccatatttagagt 62747

>gb|AC010102.3|AC010102 Homo sapiens BAC clone RP11-486B15 from 2, complete sequence
          Length = 230827

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     tgcagaaccatatttagagt 59
              ||||||||||||||||||||
Sbjct: 201898 tgcagaaccatatttagagt 201879

>dbj|AB127931.1| Sphingomonas sp. A1 nadK gene for ATP-NAD kinase, complete cds
          Length = 897

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  ccgacgacaatggccagatc 116
           ||||||||||||||||||||
Sbjct: 227 ccgacgacaatggccagatc 208

>emb|AL772346.5| Mouse DNA sequence from clone RP23-413E7 on chromosome 4, complete
              sequence
          Length = 189115

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 232    ctgcatctatccttaacaaa 251
              ||||||||||||||||||||
Sbjct: 143483 ctgcatctatccttaacaaa 143464


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,636,959
Number of Sequences: 3902068
Number of extensions: 1636959
Number of successful extensions: 25335
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25327
Number of HSP's gapped (non-prelim): 8
length of query: 280
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 258
effective length of database: 17,147,199,772
effective search space: 4423977541176
effective search space used: 4423977541176
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)