ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags27b24 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY677177.1| Hordeum vulgare UDP-D-glucuronate decarboxylase (UXS1) mRNA, complete cds Length = 1433 Score = 232 bits (117), Expect = 2e-58 Identities = 131/137 (95%) Strand = Plus / Minus Query: 8 aaattccgtancgaaacacagcaacgaatattgacgaacccacccaactatgagtatgct 67 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1226 aaattccgtaacgaaacacagcaacgaatattgacgaacccacccaactatgagtatgct 1167 Query: 68 ctggcaaattggtgatgtncgccaaacgcagggaagtggcctnaggccttgggcttnttg 127 |||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||| ||| Sbjct: 1166 ctggcaaattggtgatgtacgccaaacgcagggaagtggccttaggccttggccttcttg 1107 Query: 128 ggcactgtcaaacgctc 144 ||||||| ||||||||| Sbjct: 1106 ggcactgccaaacgctc 1090
>emb|CT009662.23| Mouse DNA sequence from clone CH29-511O15 on chromosome 17, complete sequence Length = 231197 Score = 40.1 bits (20), Expect = 1.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 56 tatgagtatgctctggcaaa 75 |||||||||||||||||||| Sbjct: 208325 tatgagtatgctctggcaaa 208306
>gb|AC009840.7| Drosophila melanogaster 3L BAC RP98-2B14 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194790 Score = 38.2 bits (19), Expect = 6.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 29 caacgaatattgacgaacc 47 ||||||||||||||||||| Sbjct: 54657 caacgaatattgacgaacc 54639
>gb|AF093402.1|AF093402 Drosophila melanogaster presenilin (PS) gene, alternatively spliced products, complete cds Length = 5858 Score = 38.2 bits (19), Expect = 6.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 29 caacgaatattgacgaacc 47 ||||||||||||||||||| Sbjct: 348 caacgaatattgacgaacc 330
>gb|AE003591.4| Drosophila melanogaster chromosome 3L, section 72 of 83 of the complete sequence Length = 301136 Score = 38.2 bits (19), Expect = 6.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 29 caacgaatattgacgaacc 47 ||||||||||||||||||| Sbjct: 103949 caacgaatattgacgaacc 103931
>gb|AC091981.4| Homo sapiens chromosome 5 clone RP11-549L3, complete sequence Length = 187685 Score = 38.2 bits (19), Expect = 6.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 45 acccacccaactatgagta 63 ||||||||||||||||||| Sbjct: 18022 acccacccaactatgagta 18004 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 557,610 Number of Sequences: 3902068 Number of extensions: 557610 Number of successful extensions: 27137 Number of sequences better than 10.0: 6 Number of HSP's better than 10.0 without gapping: 6 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 27131 Number of HSP's gapped (non-prelim): 6 length of query: 144 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 123 effective length of database: 17,151,101,840 effective search space: 2109585526320 effective search space used: 2109585526320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
