ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags27b14
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_196939.1| Oryza sativa (japonica cultivar-group) putative... 131 3e-27
2gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 geno... 131 3e-27
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
4dbj|AK120876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 3e-27
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 131 3e-27
6gb|AF306827.1|AF306827 Triticum monococcum subsp. monococcum clo... 78 4e-11
7gb|AF306829.1|AF306829 Triticum urartu clone 581 cytosolic acety... 62 2e-06
8gb|AF306824.1|AF306824 Triticum timopheevii subsp. armeniacum cl... 62 2e-06
9gb|AF306828.1|AF306828 Triticum turgidum subsp. dicoccoides clon... 54 5e-04
10gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 44 0.50
11emb|AL354766.17| Human DNA sequence from clone RP11-323C15 on ch... 44 0.50
12gb|AC140403.3| Mus musculus BAC clone RP23-144M22 from 15, compl... 44 0.50
13gb|BC074227.1| Xenopus laevis NIMA-family kinase Nercc1, mRNA (c... 42 2.0
14emb|AL161507.2|ATCHRIV19 Arabidopsis thaliana DNA chromosome 4, ... 42 2.0
15gb|AY271412.1| Xenopus laevis NIMA-family kinase Nercc1 mRNA, co... 42 2.0
16gb|AC099507.3| Homo sapiens chromosome 5 clone RP11-24H18, compl... 42 2.0
17gb|AC074270.25|AC074270 Homo sapiens 12 BAC RP11-84G21 (Roswell ... 42 2.0
18gb|BC044295.1| Xenopus laevis, Similar to NIMA (never in mitosis... 42 2.0
19gb|AF128395.1|F5K24 Arabidopsis thaliana BAC F5K24 42 2.0
20gb|AC135421.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
21gb|AC148466.2| Xenopus tropicalis clone CH216-69C13, complete se... 40 7.8
22emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 40 7.8
23emb|CR926129.9| Zebrafish DNA sequence from clone DKEY-261J15 in... 40 7.8
24emb|CR626934.1| Triticum aestivum 40 7.8
25emb|CR626926.1| Aegilops tauschii 40 7.8
26gb|AC125142.4| Mus musculus BAC clone RP24-342G10 from chromosom... 40 7.8
27gb|AC129851.5| Homo sapiens X BAC RP11-669P14 (Roswell Park Canc... 40 7.8
28emb|AL353743.22| Human DNA sequence from clone RP11-213G2 on chr... 40 7.8
29gb|AC129852.5| Homo sapiens X BAC RP11-540E20 (Roswell Park Canc... 40 7.8
30emb|BX070169.1|CNS09QB1 Single read from an extremity of a full-... 40 7.8
31emb|BX064290.1|CNS09LRQ Single read from an extremity of a full-... 40 7.8
32emb|BX058290.1|CNS09H52 Single read from an extremity of a full-... 40 7.8
33emb|BX056496.1|CNS09FR8 Single read from an extremity of a full-... 40 7.8
34emb|BX053036.1|CNS09D34 Single read from an extremity of a full-... 40 7.8
35emb|BX054415.1|CNS09E5F Single read from an extremity of a full-... 40 7.8
36emb|BX031025.1|CNS08W3P Single read from an extremity of a full-... 40 7.8
37emb|BX030933.1|CNS08W15 Single read from an extremity of a full-... 40 7.8
38emb|BX035628.1|CNS08ZNK Single read from an extremity of a full-... 40 7.8
39emb|BX035345.1|CNS08ZFP Single read from an extremity of a full-... 40 7.8
40emb|BX033736.1|CNS08Y70 Single read from an extremity of a full-... 40 7.8
41emb|BX023661.1|CNS08QF5 Single read from an extremity of a full-... 40 7.8
42emb|BX015096.1|CNS08JT8 Single read from an extremity of a full-... 40 7.8
43emb|BX011577.1|CNS08H3H Single read from an extremity of a full-... 40 7.8
44gb|AE016828.2| Coxiella burnetii RSA 493, complete genome 40 7.8
45gb|AY159805.1| Aegilops tauschii puroindoline a gene, complete cds 40 7.8
46emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chro... 40 7.8
47emb|CR931743.1| Medicago truncatula chromosome 5 clone mth2-4c23... 40 7.8
48emb|BX511221.4| Zebrafish DNA sequence from clone CH211-246N5, c... 40 7.8
49emb|BX323012.5| Zebrafish DNA sequence from clone DKEYP-46F3, co... 40 7.8
50gb|AC007197.6| Arabidopsis thaliana chromosome 2 clone T22C12 ma... 40 7.8
51gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 7.8
52gb|U23449.2| Caenorhabditis elegans cosmid K06A1, complete sequence 40 7.8
53gb|AF306826.1|AF306826 Triticum timopheevii subsp. armeniacum cl... 40 7.8
54gb|AF306825.1|AF306825 Triticum timopheevii subsp. timopheevii c... 40 7.8
55ref|NM_062900.2| Caenorhabditis elegans K06A1.6 (K06A1.6) mRNA, ... 40 7.8
56dbj|AK053392.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 40 7.8
57dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
58gb|AC009962.11| Homo sapiens BAC clone RP11-366L5 from 2, comple... 40 7.8
59gb|AC021613.14| Homo sapiens chromosome 8, clone RP11-279N21, co... 40 7.8
60emb|BX679674.3| Mouse DNA sequence from clone RP23-66H6 on chrom... 40 7.8
61gb|AC155258.2| Mus musculus BAC clone RP24-83B1 from 12, complet... 40 7.8
62emb|AL732515.15| Zebrafish DNA sequence from clone RP71-1K13 in ... 40 7.8
63emb|CT572998.9| Mouse DNA sequence from clone RP23-26C23 on chro... 40 7.8
64emb|AL954867.12| Zebrafish DNA sequence from clone DKEY-1G17 in ... 40 7.8
65dbj|AP004940.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 7.8 
>ref|NM_196939.1| Oryza sativa (japonica cultivar-group) putative protein kinase
            (OSJNBa0006L06.21), mRNA
          Length = 3837

 Score =  131 bits (66), Expect = 3e-27
 Identities = 138/162 (85%)
 Strand = Plus / Minus

                                                                        
Query: 415  tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 474
            ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 3837 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 3778

                                                                        
Query: 475  ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 534
            ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 3777 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 3718

                                                      
Query: 535  atttaccctggtgcaggcaagcgctatcctgacgatgaacac 576
             || ||||| |||||  ||||||| || || |||||||||||
Sbjct: 3717 gttcacccttgtgcaaccaagcgcgattctcacgatgaacac 3676
to top
>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete
              sequence
          Length = 162339

 Score =  131 bits (66), Expect = 3e-27
 Identities = 138/162 (85%)
 Strand = Plus / Minus

                                                                          
Query: 415    tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 474
              ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 146110 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 146051

                                                                          
Query: 475    ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 534
              ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 146050 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 145991

                                                        
Query: 535    atttaccctggtgcaggcaagcgctatcctgacgatgaacac 576
               || ||||| |||||  ||||||| || || |||||||||||
Sbjct: 145990 gttcacccttgtgcaaccaagcgcgattctcacgatgaacac 145949
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  131 bits (66), Expect = 3e-27
 Identities = 138/162 (85%)
 Strand = Plus / Minus

                                                                            
Query: 415      tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 474
                ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 16801593 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 16801534

                                                                            
Query: 475      ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 534
                ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 16801533 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 16801474

                                                          
Query: 535      atttaccctggtgcaggcaagcgctatcctgacgatgaacac 576
                 || ||||| |||||  ||||||| || || |||||||||||
Sbjct: 16801473 gttcacccttgtgcaaccaagcgcgattctcacgatgaacac 16801432
to top
>dbj|AK120876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027F13, full
            insert sequence
          Length = 4032

 Score =  131 bits (66), Expect = 3e-27
 Identities = 138/162 (85%)
 Strand = Plus / Minus

                                                                        
Query: 415  tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 474
            ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 3713 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 3654

                                                                        
Query: 475  ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 534
            ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 3653 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 3594

                                                      
Query: 535  atttaccctggtgcaggcaagcgctatcctgacgatgaacac 576
             || ||||| |||||  ||||||| || || |||||||||||
Sbjct: 3593 gttcacccttgtgcaaccaagcgcgattctcacgatgaacac 3552
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  131 bits (66), Expect = 3e-27
 Identities = 138/162 (85%)
 Strand = Plus / Minus

                                                                            
Query: 415      tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 474
                ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 16810633 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 16810574

                                                                            
Query: 475      ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 534
                ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 16810573 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 16810514

                                                          
Query: 535      atttaccctggtgcaggcaagcgctatcctgacgatgaacac 576
                 || ||||| |||||  ||||||| || || |||||||||||
Sbjct: 16810513 gttcacccttgtgcaaccaagcgcgattctcacgatgaacac 16810472
to top
>gb|AF306827.1|AF306827 Triticum monococcum subsp. monococcum clone 437 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1812

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 64/71 (90%), Gaps = 1/71 (1%)
 Strand = Plus / Plus

                                                                       
Query: 96  tactacctctgtaactaaatataggacgtttta-cagttcaaattgagctgcaaaaacgt 154
           ||||||||||||  ||||||||| ||||||||  ||||||||||||| ||||||||||||
Sbjct: 686 tactacctctgtttctaaatataagacgtttttgcagttcaaattgaactgcaaaaacgt 745

                      
Query: 155 cttgtatttag 165
           ||| |||||||
Sbjct: 746 cttatatttag 756



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 58/66 (87%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 101 cctctgtaactaaatataggacgtttta-cagttcaaattgagctgcaaaaacgtcttgt 159
           |||||||  ||||||||| ||||||||  |||||||| |||| ||||||||||||||| |
Sbjct: 765 cctctgttcctaaatataagacgtttttgcagttcaatttgaactgcaaaaacgtcttat 706

                 
Query: 160 atttag 165
           ||||||
Sbjct: 705 atttag 700
to top
>gb|AF306829.1|AF306829 Triticum urartu clone 581 cytosolic acetyl-CoA carboxylase gene,
           partial cds
          Length = 1812

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 62/71 (87%), Gaps = 1/71 (1%)
 Strand = Plus / Plus

                                                                       
Query: 96  tactacctctgtaactaaatataggacgtttta-cagttcaaattgagctgcaaaaacgt 154
           ||||||||||||  ||||||||| ||||||||  |||||||| |||| || |||||||||
Sbjct: 686 tactacctctgtttctaaatataagacgtttttgcagttcaatttgaactacaaaaacgt 745

                      
Query: 155 cttgtatttag 165
           ||| |||||||
Sbjct: 746 cttatatttag 756



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 58/66 (87%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 101 cctctgtaactaaatataggacgttttac-agttcaaattgagctgcaaaaacgtcttgt 159
           |||||||  ||||||||| ||||||||   |||||||||||| ||||||||||||||| |
Sbjct: 765 cctctgttcctaaatataagacgtttttgtagttcaaattgaactgcaaaaacgtcttat 706

                 
Query: 160 atttag 165
           ||||||
Sbjct: 705 atttag 700
to top
>gb|AF306824.1|AF306824 Triticum timopheevii subsp. armeniacum clone 453 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1812

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 62/71 (87%), Gaps = 1/71 (1%)
 Strand = Plus / Plus

                                                                       
Query: 96  tactacctctgtaactaaatataggacgtttta-cagttcaaattgagctgcaaaaacgt 154
           ||||||||||||  ||||||||| ||||||||  |||||||| |||| || |||||||||
Sbjct: 686 tactacctctgtttctaaatataagacgtttttgcagttcaatttgaactacaaaaacgt 745

                      
Query: 155 cttgtatttag 165
           ||| |||||||
Sbjct: 746 cttatatttag 756



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 58/66 (87%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 101 cctctgtaactaaatataggacgttttac-agttcaaattgagctgcaaaaacgtcttgt 159
           |||||||  ||||||||| ||||||||   |||||||||||| ||||||||||||||| |
Sbjct: 765 cctctgttcctaaatataagacgtttttgtagttcaaattgaactgcaaaaacgtcttat 706

                 
Query: 160 atttag 165
           ||||||
Sbjct: 705 atttag 700
to top
>gb|AF306828.1|AF306828 Triticum turgidum subsp. dicoccoides clone 465 cytosolic acetyl-CoA
           carboxylase gene, partial cds
          Length = 1836

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 55/63 (87%), Gaps = 1/63 (1%)
 Strand = Plus / Minus

                                                                       
Query: 101 cctctgtaactaaatataggacgttttac-agttcaaattgagctgcaaaaacgtcttgt 159
           |||||||  ||||||||| ||||||||   |||||||||||| ||||||||||||||| |
Sbjct: 765 cctctgttcctaaatataagacgtttttgtagttcaaattgaactgcaaaaacgtcttat 706

              
Query: 160 att 162
           |||
Sbjct: 705 att 703



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 124 ttttacagttcaaattgagctgcaaaaacgtcttgtatttag 165
           |||| |||||||| |||| || |||||||||||| |||||||
Sbjct: 715 ttttgcagttcaatttgaactacaaaaacgtcttatatttag 756
to top
>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
             SNF2P genes, complete cds; nucellin pseudogene, complete
             sequence; putative transposase, phosphatidylinositol
             phosphatidylcholine transfer protein sec14 cytosolic-like
             protein, and phytochrome P450-like protein genes, complete
             cds; and unknown genes
          Length = 438828

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 138   ttgagctgcaaaaacgtcttgtattt 163
             |||| |||||||||||||||||||||
Sbjct: 14427 ttgaactgcaaaaacgtcttgtattt 14452
to top
>emb|AL354766.17| Human DNA sequence from clone RP11-323C15 on chromosome 20 Contains an
             RPL13 (ribosomal protein L13) pseudogene, a novel gene,
             the 5' end of the EYA2 gene for eyes absent homolog 2
             (Drosophila) and a CpG island, complete sequence
          Length = 111170

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 45    ttgcttttttattgtctatctt 66
             ||||||||||||||||||||||
Sbjct: 88854 ttgcttttttattgtctatctt 88833
to top
>gb|AC140403.3| Mus musculus BAC clone RP23-144M22 from 15, complete sequence
          Length = 192144

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 426  agtctgttagtttgcttattgt 447
            ||||||||||||||||||||||
Sbjct: 9319 agtctgttagtttgcttattgt 9340
to top
>gb|BC074227.1| Xenopus laevis NIMA-family kinase Nercc1, mRNA (cDNA clone
           MGC:83419 IMAGE:7008816), complete cds
          Length = 3112

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 331 gatttgaaactgtattttaca 351
           |||||||||||||||||||||
Sbjct: 664 gatttgaaactgtattttaca 644
to top
>emb|AL161507.2|ATCHRIV19 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 19
          Length = 183181

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 45     ttgcttttttattgtctatct 65
              |||||||||||||||||||||
Sbjct: 144778 ttgcttttttattgtctatct 144798
to top
>gb|AY271412.1| Xenopus laevis NIMA-family kinase Nercc1 mRNA, complete cds
          Length = 2835

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 331 gatttgaaactgtattttaca 351
           |||||||||||||||||||||
Sbjct: 641 gatttgaaactgtattttaca 621
to top
>gb|AC099507.3| Homo sapiens chromosome 5 clone RP11-24H18, complete sequence
          Length = 187386

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 41    cttattgcttttttattgtct 61
             |||||||||||||||||||||
Sbjct: 53656 cttattgcttttttattgtct 53676
to top
>gb|AC074270.25|AC074270 Homo sapiens 12 BAC RP11-84G21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 140597

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 481   ggtatgtgctgatatctcttgtgct 505
             ||||||||||||||||| |||||||
Sbjct: 99671 ggtatgtgctgatatctattgtgct 99647
to top
>gb|BC044295.1| Xenopus laevis, Similar to NIMA (never in mitosis gene a)- related
           kinase 9, clone IMAGE:5569930, mRNA
          Length = 3289

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 331 gatttgaaactgtattttaca 351
           |||||||||||||||||||||
Sbjct: 689 gatttgaaactgtattttaca 669
to top
>gb|AF128395.1|F5K24 Arabidopsis thaliana BAC F5K24
          Length = 109786

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 45    ttgcttttttattgtctatct 65
             |||||||||||||||||||||
Sbjct: 24507 ttgcttttttattgtctatct 24527
to top
>gb|AC135421.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0012G21, complete sequence
          Length = 135750

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 95    atactacctctgtaactaaatata 118
             |||||||||||||| |||||||||
Sbjct: 21095 atactacctctgtacctaaatata 21072
to top
>gb|AC148466.2| Xenopus tropicalis clone CH216-69C13, complete sequence
          Length = 177332

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 33    acataacacttattgcttttttat 56
             |||||||||||| |||||||||||
Sbjct: 86238 acataacacttaatgcttttttat 86215
to top
>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete
              sequence
          Length = 3214944

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 168    atttagggagtagaataatg 187
              ||||||||||||||||||||
Sbjct: 349902 atttagggagtagaataatg 349921
to top
>emb|CR926129.9| Zebrafish DNA sequence from clone DKEY-261J15 in linkage group 6,
             complete sequence
          Length = 142272

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 484   atgtgctgatatctcttgtg 503
             ||||||||||||||||||||
Sbjct: 31770 atgtgctgatatctcttgtg 31789
to top
>emb|CR626934.1| Triticum aestivum
          Length = 94398

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 96    tactacctctgtaactaaatataggacgtttt 127
             ||||||||||||| | ||||||| ||||||||
Sbjct: 26045 tactacctctgtaccgaaatataagacgtttt 26076
to top
>emb|CR626926.1| Aegilops tauschii
          Length = 94421

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 96    tactacctctgtaactaaatataggacgtttt 127
             ||||||||||||| | ||||||| ||||||||
Sbjct: 24140 tactacctctgtaccgaaatataagacgtttt 24171
to top
>gb|AC125142.4| Mus musculus BAC clone RP24-342G10 from chromosome 12, complete sequence
          Length = 174908

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 240    atagcttagctatctatttt 259
              ||||||||||||||||||||
Sbjct: 129583 atagcttagctatctatttt 129602
to top
>gb|AC129851.5| Homo sapiens X BAC RP11-669P14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 166653

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 280    ctctcctaatgctggtcttt 299
              ||||||||||||||||||||
Sbjct: 115651 ctctcctaatgctggtcttt 115670
to top
>emb|AL353743.22| Human DNA sequence from clone RP11-213G2 on chromosome 9 Contains the 3'
              end of a  pseudogene similar to part of a novel protein
              (DKFZp434D0917), a pseudogene similar to part of a novel
              protein (DKFZp434D0917), a novel gene, a prohibitin
              pseudogene (PHB), a novel pseudogene (DFKZP564M182), the 5'
              end of a novel gene (FLJ21613) similar to rat corneal wound
              healing related protein (includes FLJ22634) and two CpG
              islands, complete sequence
          Length = 181864

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 178    tagaataatgagaaatacaaacat 201
              ||||||||||||||||| ||||||
Sbjct: 105478 tagaataatgagaaataaaaacat 105501
to top
>gb|AC129852.5| Homo sapiens X BAC RP11-540E20 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 170072

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 280  ctctcctaatgctggtcttt 299
            ||||||||||||||||||||
Sbjct: 3813 ctctcctaatgctggtcttt 3832
to top
>emb|BX070169.1|CNS09QB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 719

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 107 gttagtttgcttattgtgat 88
to top
>emb|BX064290.1|CNS09LRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 129 gttagtttgcttattgtgat 110
to top
>emb|BX058290.1|CNS09H52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 507

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 182 gttagtttgcttattgtgat 163
to top
>emb|BX056496.1|CNS09FR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 94  gttagtttgcttattgtgat 75
to top
>emb|BX053036.1|CNS09D34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 729

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 103 gttagtttgcttattgtgat 84
to top
>emb|BX054415.1|CNS09E5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 254 gttagtttgcttattgtgat 235
to top
>emb|BX031025.1|CNS08W3P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 54  gttagtttgcttattgtgat 35
to top
>emb|BX030933.1|CNS08W15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 273 gttagtttgcttattgtgat 254
to top
>emb|BX035628.1|CNS08ZNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 448

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 298 gttagtttgcttattgtgat 279
to top
>emb|BX035345.1|CNS08ZFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 118 gttagtttgcttattgtgat 99
to top
>emb|BX033736.1|CNS08Y70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 200 gttagtttgcttattgtgat 181
to top
>emb|BX023661.1|CNS08QF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 137 gttagtttgcttattgtgat 118
to top
>emb|BX015096.1|CNS08JT8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 482 gttagtttgcttattgtgat 463
to top
>emb|BX011577.1|CNS08H3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 431 gttagtttgcttattgtgat 450
           ||||||||||||||||||||
Sbjct: 176 gttagtttgcttattgtgat 157
to top
>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 320   aagtacttgaggatttgaaa 339
             ||||||||||||||||||||
Sbjct: 80653 aagtacttgaggatttgaaa 80672
to top
>gb|AY159805.1| Aegilops tauschii puroindoline a gene, complete cds
          Length = 3573

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 96   tactacctctgtaactaaatataggacgtttt 127
            ||||||||||||| | ||||||| ||||||||
Sbjct: 2413 tactacctctgtaccgaaatataagacgtttt 2444
to top
>emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chromosome 11 Contains part
             of the Ranbp17 gene for RAN binding protein 17, an acidic
             (leucine-rich) nuclear phosphoprotein 32 family, member E
             (Anp32e) pseudogene and a high mobility group box 1
             (Hmgb1) pseudogene, complete sequence
          Length = 198926

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 326   ttgaggatttgaaactgtat 345
             ||||||||||||||||||||
Sbjct: 27038 ttgaggatttgaaactgtat 27019
to top
>emb|CR931743.1| Medicago truncatula chromosome 5 clone mth2-4c23, COMPLETE SEQUENCE
          Length = 109311

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 94    aatactacctctgtaactaaatatagga 121
             ||||||||||||||  ||||||||||||
Sbjct: 69361 aatactacctctgtccctaaatatagga 69334
to top
>emb|BX511221.4| Zebrafish DNA sequence from clone CH211-246N5, complete sequence
          Length = 62093

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 33    acataacacttattgcttttttattgtc 60
             ||||||||||| |||||||||| |||||
Sbjct: 57928 acataacacttgttgcttttttgttgtc 57901
to top
>emb|BX323012.5| Zebrafish DNA sequence from clone DKEYP-46F3, complete sequence
          Length = 175238

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 354    attaataagtctgcaatttt 373
              ||||||||||||||||||||
Sbjct: 135107 attaataagtctgcaatttt 135126
to top
>gb|AC007197.6| Arabidopsis thaliana chromosome 2 clone T22C12 map mi398, complete
             sequence
          Length = 84908

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 158   gtatttagttatttagggag 177
             ||||||||||||||||||||
Sbjct: 14138 gtatttagttatttagggag 14119
to top
>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   gtcttgtatttagttattta 172
             ||||||||||||||||||||
Sbjct: 61044 gtcttgtatttagttattta 61025
to top
>gb|U23449.2| Caenorhabditis elegans cosmid K06A1, complete sequence
          Length = 26449

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 123   gttttacagttcaaattgag 142
             ||||||||||||||||||||
Sbjct: 18431 gttttacagttcaaattgag 18450
to top
>gb|AF306826.1|AF306826 Triticum timopheevii subsp. armeniacum clone 506 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1797

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 96  tactacctctgtaactaaatataggacgtttt 127
           ||||||||||||  ||||||||| ||||||||
Sbjct: 694 tactacctctgttcctaaatataagacgtttt 725
to top
>gb|AF306825.1|AF306825 Triticum timopheevii subsp. timopheevii clone 513 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1796

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 96  tactacctctgtaactaaatataggacgtttt 127
           ||||||||||||  ||||||||| ||||||||
Sbjct: 694 tactacctctgttcctaaatataagacgtttt 725
to top
>ref|NM_062900.2| Caenorhabditis elegans K06A1.6 (K06A1.6) mRNA, complete cds
          Length = 3137

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 123 gttttacagttcaaattgag 142
           ||||||||||||||||||||
Sbjct: 844 gttttacagttcaaattgag 825
to top
>dbj|AK053392.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130013L03 product:unclassifiable, full
            insert sequence
          Length = 3233

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 326  ttgaggatttgaaactgtat 345
            ||||||||||||||||||||
Sbjct: 3027 ttgaggatttgaaactgtat 3046
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 95       atactacctctgtaactaaatata 118
                |||||||||||||| |||||||||
Sbjct: 21768686 atactacctctgtacctaaatata 21768663
to top
>gb|AC009962.11| Homo sapiens BAC clone RP11-366L5 from 2, complete sequence
          Length = 177512

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 171    tagggagtagaataatgaga 190
              ||||||||||||||||||||
Sbjct: 174288 tagggagtagaataatgaga 174269
to top
>gb|AC021613.14| Homo sapiens chromosome 8, clone RP11-279N21, complete sequence
          Length = 143960

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   atgagaaatacaaacatcac 204
             ||||||||||||||||||||
Sbjct: 97111 atgagaaatacaaacatcac 97092
to top
>emb|BX679674.3| Mouse DNA sequence from clone RP23-66H6 on chromosome X, complete
             sequence
          Length = 205905

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    acttattgcttttttattgt 59
             ||||||||||||||||||||
Sbjct: 33149 acttattgcttttttattgt 33168
to top
>gb|AC155258.2| Mus musculus BAC clone RP24-83B1 from 12, complete sequence
          Length = 221264

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 463   ttcagagaggtaggcctggg 482
             ||||||||||||||||||||
Sbjct: 75631 ttcagagaggtaggcctggg 75612
to top
>emb|AL732515.15| Zebrafish DNA sequence from clone RP71-1K13 in linkage group 23, complete
              sequence
          Length = 154426

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 40     acttattgcttttttattgt 59
              ||||||||||||||||||||
Sbjct: 126186 acttattgcttttttattgt 126205
to top
>emb|CT572998.9| Mouse DNA sequence from clone RP23-26C23 on chromosome 12, complete
              sequence
          Length = 180742

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 463    ttcagagaggtaggcctggg 482
              ||||||||||||||||||||
Sbjct: 137460 ttcagagaggtaggcctggg 137441
to top
>emb|AL954867.12| Zebrafish DNA sequence from clone DKEY-1G17 in linkage group 6, complete
              sequence
          Length = 222787

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 484    atgtgctgatatctcttgtg 503
              ||||||||||||||||||||
Sbjct: 161042 atgtgctgatatctcttgtg 161061
to top
>dbj|AP004940.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT48I11, TM0106,
             complete sequence
          Length = 103636

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    gtctatcttacagttacaac 77
             ||||||||||||||||||||
Sbjct: 52290 gtctatcttacagttacaac 52309


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,401,418
Number of Sequences: 3902068
Number of extensions: 5401418
Number of successful extensions: 102752
Number of sequences better than 10.0: 65
Number of HSP's better than 10.0 without gapping: 65
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102534
Number of HSP's gapped (non-prelim): 215
length of query: 577
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 554
effective length of database: 17,143,297,704
effective search space: 9497386928016
effective search space used: 9497386928016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top