ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags26m06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_466001.1| Oryza sativa (japonica cultivar-group), mRNA 149 8e-33
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 149 8e-33
3dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic D... 149 8e-33
4dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic D... 149 8e-33
5dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 8e-33
6gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence 141 2e-30
7ref|XM_472343.1| Oryza sativa (japonica cultivar-group), predic... 139 7e-30
8dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 139 7e-30
9dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 7e-30
10emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4,... 139 7e-30
11gb|AY105531.1| Zea mays PCO113958 mRNA sequence 131 2e-27
12gb|AY109584.1| Zea mays CL2436_1 mRNA sequence 127 3e-26
13gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein... 125 1e-25
14gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence 119 7e-24
15gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulf... 80 6e-12
16gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur... 80 6e-12
17gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence 80 6e-12
18emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske ... 72 1e-09
19ref|XM_447387.1| Candida glabrata CBS138 hypothetical protein (C... 68 2e-08
20emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 68 2e-08
21gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-su... 64 4e-07
22ref|XM_454973.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E22682g ... 64 4e-07
23emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 64 4e-07
24tpg|BK005644.1| TPA: TPA_inf: Triticum aestivum histidine-contai... 64 4e-07
25ref|NM_121347.3| Arabidopsis thaliana oxidoreductase/ ubiquinol-... 62 1e-06
26emb|AL163572.1|ATT22N19 Arabidopsis thaliana DNA chromosome 5, B... 62 1e-06
27gb|AY081510.1| Arabidopsis thaliana ubiquinol--cytochrome-c redu... 62 1e-06
28dbj|AK221169.1| Arabidopsis thaliana mRNA for ubiquinol--cytochr... 62 1e-06
29gb|AF370533.1|AF370533 Arabidopsis thaliana ubiquinol--cytochrom... 62 1e-06
30emb|BX829960.1|CNS0A1KF Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
31emb|BX830982.1|CNS0A0P7 Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
32gb|AY086148.1| Arabidopsis thaliana clone 21819 mRNA, complete s... 62 1e-06
33gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 60 6e-06
34ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA 60 6e-06
35ref|XM_654818.1| Aspergillus nidulans FGSC A4 hypothetical prote... 54 3e-04
36gb|CP000264.1| Jannaschia sp. CCS1, complete genome 54 3e-04
37gb|AY682089.1| Sinorhizobium meliloti strain GR4 plasmid pRmeGR4... 52 0.001
38gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of ... 52 0.001
39dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010 48 0.021
40ref|NM_121346.2| Arabidopsis thaliana oxidoreductase/ ubiquinol-... 46 0.083
41ref|XM_957255.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.083
42ref|XM_326460.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.083
43emb|X02472.1|NCCYRFES Neurospora gene for mitochondrial ubiquino... 46 0.083
44gb|AF375413.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, co... 46 0.083
45gb|AY066055.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, co... 46 0.083
46dbj|AK221073.1| Arabidopsis thaliana mRNA for ubiquinol--cytochr... 46 0.083
47emb|BX830387.1|CNS0A1JK Arabidopsis thaliana Full-length cDNA Co... 46 0.083
48emb|BX829878.1|CNS0A1B9 Arabidopsis thaliana Full-length cDNA Co... 46 0.083
49emb|BX829847.1|CNS0A1CH Arabidopsis thaliana Full-length cDNA Co... 46 0.083
50emb|BX831700.1|CNS0A14K Arabidopsis thaliana Full-length cDNA Co... 46 0.083
51emb|BX833733.1|CNS0A0BW Arabidopsis thaliana Full-length cDNA Co... 46 0.083
52gb|AY085370.1| Arabidopsis thaliana clone 1482 mRNA, complete se... 46 0.083
53dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 46 0.083
54gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 44 0.33
55emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete ch... 44 0.33
56emb|X56157.1|RSFBCOPER R. sphaeroides fbc operon for cytochrome ... 44 0.33
57ref|NM_213086.1| Danio rerio ubiquinol-cytochrome c reductase, R... 42 1.3
58gb|BC067544.1| Danio rerio ubiquinol-cytochrome c reductase, Rie... 42 1.3
59gb|AC140267.2| Mus musculus BAC clone RP24-303O5 from chromosome... 42 1.3
60gb|AC161199.4| Mus musculus chromosome 15, clone RP23-383D13, co... 42 1.3
61gb|AY558341.1| Saccharomyces cerevisiae clone FLH111526.01X YEL0... 42 1.3
62ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrom... 42 1.3
63gb|AC123065.3| Mus musculus BAC clone RP23-239F13 from 9, comple... 42 1.3
64gb|AC138714.4| Mus musculus chromosome 18 clone RP23-406C12, com... 42 1.3
65gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 42 1.3
66emb|X05630.1|RCPETG Rhodopseudomonas capsulata petABC operon 42 1.3
67emb|X03476.1|RCFBC Rhodopseudomonas sphaeroides fbc operon (fbcF... 42 1.3
68emb|BX640450.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.3
69emb|BX640434.1| Bordetella parapertussis strain 12822, complete ... 42 1.3
70emb|BX640412.1| Bordetella pertussis strain Tohama I, complete g... 42 1.3
71gb|BC059475.1| Danio rerio ubiquinol-cytochrome c reductase, Rie... 42 1.3
72dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.3
73gb|AC153145.4| Mus musculus BAC clone RP23-222C3 from chromosome... 42 1.3
74gb|AF332860.1|AF332860S1 Mus musculus diadenosine triphosphate h... 42 1.3
75emb|AL116266.1|CNS01D1U Botrytis cinerea strain T4 cDNA library 42 1.3
76emb|AL114037.1|CNS01BBX Botrytis cinerea strain T4 cDNA library 42 1.3
77emb|AL113155.1|CNS01ANF Botrytis cinerea strain T4 cDNA library 42 1.3
78emb|AL111908.1|CNS019OS Botrytis cinerea strain T4 cDNA library 42 1.3
79gb|AC122441.6| Mus musculus BAC clone RP24-225A21 from chromosom... 42 1.3
80gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmid... 42 1.3
81gb|AC147636.3| Mus musculus BAC clone RP23-201C3 from 9, complet... 42 1.3
82emb|BX005081.6| Zebrafish DNA sequence from clone CH211-69M16 in... 42 1.3
83gb|AC147989.4| Mus musculus BAC clone RP24-468I14 from 18, compl... 42 1.3
84emb|AL928926.9| Mouse DNA sequence from clone RP23-443G7 on chro... 42 1.3
85emb|AL831722.8| Mouse DNA sequence from clone RP23-312D15 on chr... 42 1.3
86emb|AL589873.11| Mouse DNA sequence from clone RP23-120P1 on chr... 42 1.3
87gb|M24500.1|YSCRIP1A S.cerevisiae Rieske iron-sulfur protein (RI... 42 1.3
88gb|M23316.1|YSCRIP1 Yeast (S.cerevisiae; DC5) Rieske iron-sulfur... 42 1.3
89gb|AC111093.10| Mus musculus chromosome 3, clone RP23-170E22, co... 40 5.1
90gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5... 40 5.1
91gb|AC165975.4| Mus musculus BAC clone RP23-3L23 from chromosome ... 40 5.1
92gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosom... 40 5.1
93gb|AC164647.3| Mus musculus BAC clone RP23-463P13 from chromosom... 40 5.1
94gb|AC159290.2| Mus musculus BAC clone RP23-291I2 from chromosome... 40 5.1
95ref|XM_473907.1| Oryza sativa (japonica cultivar-group), predic... 40 5.1
96gb|AC104918.13| Mus musculus chromosome 7, clone RP23-335G1, com... 40 5.1
97ref|NM_027429.1| Mus musculus RIKEN cDNA 2610300B10 gene (261030... 40 5.1
98gb|AC123747.26| Mus musculus chromosome 3, clone RP24-123I12, co... 40 5.1
99gb|AC144797.2| Mus musculus BAC clone RP24-349B2 from chromosome... 40 5.1
100gb|AC127421.3| Mus musculus BAC clone RP24-314F1 from chromosome... 40 5.1
101gb|AC116998.3| Mus musculus BAC clone RP23-16F6 from 18, complet... 40 5.1
102gb|BC060191.1| Mus musculus RIKEN cDNA 2610300B10 gene, mRNA (cD... 40 5.1
103gb|AC098725.3| Mus musculus BAC clone RP23-3D20 from 3, complete... 40 5.1
104gb|AC138640.7| Mus musculus chromosome 1, clone RP23-463G19, com... 40 5.1
105gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 40 5.1
106emb|AL050321.11|HSJ717M23 Human DNA sequence from clone RP4-717M... 40 5.1
107emb|AL606648.3|OSJN00093 Oryza sativa genomic DNA, chromosome 4,... 40 5.1
108emb|AL662970.2|OSJN00174 Oryza sativa genomic DNA, chromosome 4,... 40 5.1
109emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5 40 5.1
110emb|AL672178.8| Mouse DNA sequence from clone RP23-328O2 on chro... 40 5.1
111emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.1
112ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reducta... 40 5.1
113gb|AC055777.12| Mus musculus chromosome 10, clone RP23-56K17, co... 40 5.1
114gb|AC099517.2| Homo sapiens chromosome 5 clone RP11-5H14, comple... 40 5.1
115gb|AC025757.3| Homo sapiens chromosome 5 clone CTD-2195H9, compl... 40 5.1
116dbj|AK154611.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 5.1
117gb|AC158626.6| Mus musculus 6 BAC RP23-4F16 (Roswell Park Cancer... 40 5.1
118ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical... 40 5.1
119dbj|AK028960.1| Mus musculus 10 days neonate skin cDNA, RIKEN fu... 40 5.1
120gb|AC153872.2| Mus musculus 6 BAC RP23-226O20 (Roswell Park Canc... 40 5.1
121gb|AC010899.8| Homo sapiens BAC clone RP11-543K1 from 2, complet... 40 5.1
122gb|AC146977.22| Mus musculus chromosome 13, clone RP23-106I12, c... 40 5.1
123emb|BX537301.12| Mouse DNA sequence from clone RP23-127O5 on chr... 40 5.1
124dbj|AK103625.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.1
125emb|AL117264.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 5.1
126gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ... 40 5.1
127emb|CT030172.10| Mouse DNA sequence from clone RP23-313L22 on ch... 40 5.1
128gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfu... 40 5.1
129gb|AC174448.2| Mus musculus BAC clone RP23-204P24 from chromosom... 40 5.1
130gb|AC117775.8| Mus musculus chromosome 16, clone RP24-535F23, co... 40 5.1
131emb|CT030722.6| Mouse DNA sequence from clone RP23-191N15 on chr... 40 5.1
132gb|AC131120.4| Mus musculus BAC clone RP24-547N4 from 10, comple... 40 5.1
133gb|AC148020.3| Mus musculus BAC clone RP23-6A22 from 18, complet... 40 5.1
134gb|AC138719.4| Mus musculus BAC clone RP23-178O8 from 10, comple... 40 5.1
135gb|AC140410.3| Mus musculus BAC clone RP23-141J11 from 10, compl... 40 5.1
136emb|AL672278.12| Mouse DNA sequence from clone RP23-465H23 on ch... 40 5.1
137emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chr... 40 5.1 
>ref|XM_466001.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1157

 Score =  149 bits (75), Expect = 8e-33
 Identities = 161/190 (84%)
 Strand = Plus / Minus

                                                                       
Query: 195 gtaggtcgggacctccaggttgtagggtgctggtcccttcctgattctacctgagatgtc 254
           |||||||||||| || |||||||| ||||| || ||||| | |||||||||||| || ||
Sbjct: 873 gtaggtcgggacttcgaggttgtatggtgcagggcccttacggattctacctgatatatc 814

                                                                       
Query: 255 gtagtgtgagccatgacatgggcagaaccagccaccgaagtccccagagttgggcagggg 314
            || ||||| ||||| ||||| |||||||||||||| ||||| |||| |||||| || ||
Sbjct: 813 ataatgtgatccatggcatggacagaaccagccaccaaagtcaccagcgttgggaagtgg 754

                                                                       
Query: 315 aatgcagcccaggtgagtgcagacaccaatgacaacaagccactcagggttnttgacacg 374
           |||||||||||| ||||| || || ||||| ||||| |||||||||||||| ||||| ||
Sbjct: 753 aatgcagcccagatgagtacacaccccaatcacaaccagccactcagggttcttgactcg 694

                     
Query: 375 caccgcatcc 384
             ||||||||
Sbjct: 693 ttccgcatcc 684
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  149 bits (75), Expect = 8e-33
 Identities = 161/190 (84%)
 Strand = Plus / Plus

                                                                            
Query: 195      gtaggtcgggacctccaggttgtagggtgctggtcccttcctgattctacctgagatgtc 254
                |||||||||||| || |||||||| ||||| || ||||| | |||||||||||| || ||
Sbjct: 19000627 gtaggtcgggacttcgaggttgtatggtgcagggcccttacggattctacctgatatatc 19000686

                                                                            
Query: 255      gtagtgtgagccatgacatgggcagaaccagccaccgaagtccccagagttgggcagggg 314
                 || ||||| ||||| ||||| |||||||||||||| ||||| |||| |||||| || ||
Sbjct: 19000687 ataatgtgatccatggcatggacagaaccagccaccaaagtcaccagcgttgggaagtgg 19000746

                                                                            
Query: 315      aatgcagcccaggtgagtgcagacaccaatgacaacaagccactcagggttnttgacacg 374
                |||||||||||| ||||| || || ||||| ||||| |||||||||||||| ||||| ||
Sbjct: 19000747 aatgcagcccagatgagtacacaccccaatcacaaccagccactcagggttcttgactcg 19000806

                          
Query: 375      caccgcatcc 384
                  ||||||||
Sbjct: 19000807 ttccgcatcc 19000816
to top
>dbj|AP005842.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0003H22
          Length = 68256

 Score =  149 bits (75), Expect = 8e-33
 Identities = 161/190 (84%)
 Strand = Plus / Plus

                                                                         
Query: 195   gtaggtcgggacctccaggttgtagggtgctggtcccttcctgattctacctgagatgtc 254
             |||||||||||| || |||||||| ||||| || ||||| | |||||||||||| || ||
Sbjct: 55948 gtaggtcgggacttcgaggttgtatggtgcagggcccttacggattctacctgatatatc 56007

                                                                         
Query: 255   gtagtgtgagccatgacatgggcagaaccagccaccgaagtccccagagttgggcagggg 314
              || ||||| ||||| ||||| |||||||||||||| ||||| |||| |||||| || ||
Sbjct: 56008 ataatgtgatccatggcatggacagaaccagccaccaaagtcaccagcgttgggaagtgg 56067

                                                                         
Query: 315   aatgcagcccaggtgagtgcagacaccaatgacaacaagccactcagggttnttgacacg 374
             |||||||||||| ||||| || || ||||| ||||| |||||||||||||| ||||| ||
Sbjct: 56068 aatgcagcccagatgagtacacaccccaatcacaaccagccactcagggttcttgactcg 56127

                       
Query: 375   caccgcatcc 384
               ||||||||
Sbjct: 56128 ttccgcatcc 56137
to top
>dbj|AP005749.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0047A17
          Length = 149142

 Score =  149 bits (75), Expect = 8e-33
 Identities = 161/190 (84%)
 Strand = Plus / Plus

                                                                        
Query: 195  gtaggtcgggacctccaggttgtagggtgctggtcccttcctgattctacctgagatgtc 254
            |||||||||||| || |||||||| ||||| || ||||| | |||||||||||| || ||
Sbjct: 6148 gtaggtcgggacttcgaggttgtatggtgcagggcccttacggattctacctgatatatc 6207

                                                                        
Query: 255  gtagtgtgagccatgacatgggcagaaccagccaccgaagtccccagagttgggcagggg 314
             || ||||| ||||| ||||| |||||||||||||| ||||| |||| |||||| || ||
Sbjct: 6208 ataatgtgatccatggcatggacagaaccagccaccaaagtcaccagcgttgggaagtgg 6267

                                                                        
Query: 315  aatgcagcccaggtgagtgcagacaccaatgacaacaagccactcagggttnttgacacg 374
            |||||||||||| ||||| || || ||||| ||||| |||||||||||||| ||||| ||
Sbjct: 6268 aatgcagcccagatgagtacacaccccaatcacaaccagccactcagggttcttgactcg 6327

                      
Query: 375  caccgcatcc 384
              ||||||||
Sbjct: 6328 ttccgcatcc 6337
to top
>dbj|AK102815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108M09, full
           insert sequence
          Length = 1157

 Score =  149 bits (75), Expect = 8e-33
 Identities = 161/190 (84%)
 Strand = Plus / Minus

                                                                       
Query: 195 gtaggtcgggacctccaggttgtagggtgctggtcccttcctgattctacctgagatgtc 254
           |||||||||||| || |||||||| ||||| || ||||| | |||||||||||| || ||
Sbjct: 873 gtaggtcgggacttcgaggttgtatggtgcagggcccttacggattctacctgatatatc 814

                                                                       
Query: 255 gtagtgtgagccatgacatgggcagaaccagccaccgaagtccccagagttgggcagggg 314
            || ||||| ||||| ||||| |||||||||||||| ||||| |||| |||||| || ||
Sbjct: 813 ataatgtgatccatggcatggacagaaccagccaccaaagtcaccagcgttgggaagtgg 754

                                                                       
Query: 315 aatgcagcccaggtgagtgcagacaccaatgacaacaagccactcagggttnttgacacg 374
           |||||||||||| ||||| || || ||||| ||||| |||||||||||||| ||||| ||
Sbjct: 753 aatgcagcccagatgagtacacaccccaatcacaaccagccactcagggttcttgactcg 694

                     
Query: 375 caccgcatcc 384
             ||||||||
Sbjct: 693 ttccgcatcc 684
to top
>gb|BT018238.1| Zea mays clone EL01N0563B05.c mRNA sequence
          Length = 971

 Score =  141 bits (71), Expect = 2e-30
 Identities = 190/230 (82%)
 Strand = Plus / Minus

                                                                       
Query: 155 gctcttagccgataagcattttgttatcctccaagaaactgtaggtcgggacctccaggt 214
           ||||||| || || |||| |||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 790 gctcttaacctatgagcagtttgttctcctccaagaaactgtaggtcgggacctcgaggt 731

                                                                       
Query: 215 tgtagggtgctggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatg 274
           || | || || || ||||| | ||| || || || ||||||||||| || ||||| ||||
Sbjct: 730 tgaacggcgcagggcccttgcggatcctcccggatatgtcgtagtgggaaccatggcatg 671

                                                                       
Query: 275 ggcagaaccagccaccgaagtccccagagttgggcaggggaatgcagcccaggtgagtgc 334
           ||||||||||||| || ||||| || | ||| || || || |||||||| ||||||||||
Sbjct: 670 ggcagaaccagccgccaaagtctccggcgttcggtagtgggatgcagccgaggtgagtgc 611

                                                             
Query: 335 agacaccaatgacaacaagccactcagggttnttgacacgcaccgcatcc 384
           | || |||||||| || |||||||| || || || |||||| | ||||||
Sbjct: 610 acacgccaatgaccaccagccactcgggattcttcacacgctctgcatcc 561
to top
>ref|XM_472343.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 837

 Score =  139 bits (70), Expect = 7e-30
 Identities = 168/201 (83%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| |||||||||||||||||||| ||||||||||||||| | || || || ||||| 
Sbjct: 821 ttgttctcctccaagaaactgtaggtagggacctccaggttgaatggagcggggcccttg 762

                                                                       
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccaccgaag 294
           |  || || || |||||||||||||| |||||||| || ||||||||||| || ||||| 
Sbjct: 761 cgaatcctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacctccgaaa 702

                                                                       
Query: 295 tccccagagttgggcaggggaatgcagcccaggtgagtgcagacaccaatgacaacaagc 354
           || ||||  ||||| || |||||||| || ||||| |||||||| |||||||| || |||
Sbjct: 701 tctccagcattggggagaggaatgcaaccaaggtgggtgcagacgccaatgaccactagc 642

                                
Query: 355 cactcagggttnttgacacgc 375
           ||||| ||||| || ||||||
Sbjct: 641 cactctgggttcttcacacgc 621
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  139 bits (70), Expect = 7e-30
 Identities = 168/201 (83%)
 Strand = Plus / Minus

                                                                            
Query: 175      ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
                ||||| |||||||||||||||||||| ||||||||||||||| | || || || ||||| 
Sbjct: 19696244 ttgttctcctccaagaaactgtaggtagggacctccaggttgaatggagcggggcccttg 19696185

                                                                            
Query: 235      ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccaccgaag 294
                |  || || || |||||||||||||| |||||||| || ||||||||||| || ||||| 
Sbjct: 19696184 cgaatcctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacctccgaaa 19696125

                                                                            
Query: 295      tccccagagttgggcaggggaatgcagcccaggtgagtgcagacaccaatgacaacaagc 354
                || ||||  ||||| || |||||||| || ||||| |||||||| |||||||| || |||
Sbjct: 19696124 tctccagcattggggagaggaatgcaaccaaggtgggtgcagacgccaatgaccactagc 19696065

                                     
Query: 355      cactcagggttnttgacacgc 375
                ||||| ||||| || ||||||
Sbjct: 19696064 cactctgggttcttcacacgc 19696044



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 176      tgttatcctccaagaaactg 195
                ||||||||||||||||||||
Sbjct: 31448299 tgttatcctccaagaaactg 31448318
to top
>dbj|AK059519.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-C04, full
           insert sequence
          Length = 1242

 Score =  139 bits (70), Expect = 7e-30
 Identities = 168/201 (83%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| |||||||||||||||||||| ||||||||||||||| | || || || ||||| 
Sbjct: 950 ttgttctcctccaagaaactgtaggtagggacctccaggttgaatggagcggggcccttg 891

                                                                       
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccaccgaag 294
           |  || || || |||||||||||||| |||||||| || ||||||||||| || ||||| 
Sbjct: 890 cgaatcctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacctccgaaa 831

                                                                       
Query: 295 tccccagagttgggcaggggaatgcagcccaggtgagtgcagacaccaatgacaacaagc 354
           || ||||  ||||| || |||||||| || ||||| |||||||| |||||||| || |||
Sbjct: 830 tctccagcattggggagaggaatgcaaccaaggtgggtgcagacgccaatgaccactagc 771

                                
Query: 355 cactcagggttnttgacacgc 375
           ||||| ||||| || ||||||
Sbjct: 770 cactctgggttcttcacacgc 750
to top
>emb|AL731591.3|OSJN00240 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039C07,
              complete sequence
          Length = 166410

 Score =  139 bits (70), Expect = 7e-30
 Identities = 168/201 (83%)
 Strand = Plus / Minus

                                                                          
Query: 175    ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
              ||||| |||||||||||||||||||| ||||||||||||||| | || || || ||||| 
Sbjct: 146970 ttgttctcctccaagaaactgtaggtagggacctccaggttgaatggagcggggcccttg 146911

                                                                          
Query: 235    ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccaccgaag 294
              |  || || || |||||||||||||| |||||||| || ||||||||||| || ||||| 
Sbjct: 146910 cgaatcctgccagagatgtcgtagtgggagccatggcacgggcagaaccaacctccgaaa 146851

                                                                          
Query: 295    tccccagagttgggcaggggaatgcagcccaggtgagtgcagacaccaatgacaacaagc 354
              || ||||  ||||| || |||||||| || ||||| |||||||| |||||||| || |||
Sbjct: 146850 tctccagcattggggagaggaatgcaaccaaggtgggtgcagacgccaatgaccactagc 146791

                                   
Query: 355    cactcagggttnttgacacgc 375
              ||||| ||||| || ||||||
Sbjct: 146790 cactctgggttcttcacacgc 146770
to top
>gb|AY105531.1| Zea mays PCO113958 mRNA sequence
          Length = 1217

 Score =  131 bits (66), Expect = 2e-27
 Identities = 164/197 (83%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| || |||||||| ||||| ||||| || ||||||||| ||||||| || ||||| 
Sbjct: 946 ttgttctcttccaagaagctgtatgtcggcacttccaggttgaagggtgccgggcccttg 887

                                                                       
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccaccgaag 294
           | ||| ||||| || ||||||||||| ||||| || || ||||||||||||||||| |||
Sbjct: 886 cggatcctaccagaaatgtcgtagtgcgagccgtggcacgggcagaaccagccaccaaag 827

                                                                       
Query: 295 tccccagagttgggcaggggaatgcagcccaggtgagtgcagacaccaatgacaacaagc 354
           || || |  || || || || ||||||||||||||||||||||| |||||||| || |||
Sbjct: 826 tctcctgcattagggagcgggatgcagcccaggtgagtgcagaccccaatgacgaccagc 767

                            
Query: 355 cactcagggttnttgac 371
           || || ||||| |||||
Sbjct: 766 cattcggggttcttgac 750
to top
>gb|AY109584.1| Zea mays CL2436_1 mRNA sequence
          Length = 1746

 Score =  127 bits (64), Expect = 3e-26
 Identities = 186/227 (81%)
 Strand = Plus / Minus

                                                                        
Query: 158  cttagccgataagcattttgttatcctccaagaaactgtaggtcgggacctccaggttgt 217
            ||||||| || |||| |||||| |||||||||||||||||||| |||||||| |||||| 
Sbjct: 1439 cttagcctatgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggttga 1380

                                                                        
Query: 218  agggtgctggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggc 277
            | || || || ||||| | ||| || || || ||||| ||||| || ||||| |||||||
Sbjct: 1379 acggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatgggc 1320

                                                                        
Query: 278  agaaccagccaccgaagtccccagagttgggcaggggaatgcagcccaggtgagtgcaga 337
            |||||||||| || ||||| || |  || || || || |||||||| ||||| ||||| |
Sbjct: 1319 agaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgcaca 1260

                                                           
Query: 338  caccaatgacaacaagccactcagggttnttgacacgcaccgcatcc 384
            | |||||||| || |||||||||||||| || |||||| | ||||||
Sbjct: 1259 cgccaatgaccaccagccactcagggttcttcacacgctctgcatcc 1213
to top
>gb|M77224.1|MZERFESPA Zea mays mitochondrial Rieske Fe-S protein mRNA, complete cds
          Length = 1197

 Score =  125 bits (63), Expect = 1e-25
 Identities = 188/230 (81%)
 Strand = Plus / Minus

                                                                       
Query: 155 gctcttagccgataagcattttgttatcctccaagaaactgtaggtcgggacctccaggt 214
           |||||||||| |  |||| |||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 933 gctcttagcctacgagcagtttgttctcctccaagaaactgtaggtagggacctcgaggt 874

                                                                       
Query: 215 tgtagggtgctggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatg 274
           || | || || || ||||| | ||| || || || ||||| ||||| || ||||| ||||
Sbjct: 873 tgaacggcgcagggcccttgcggatcctcccggaaatgtcatagtgggaaccatggcatg 814

                                                                       
Query: 275 ggcagaaccagccaccgaagtccccagagttgggcaggggaatgcagcccaggtgagtgc 334
           ||||||||||||| || ||||| || |  || || || || |||||||| ||||| ||||
Sbjct: 813 ggcagaaccagccgccaaagtctccggcattaggtagtgggatgcagccgaggtgcgtgc 754

                                                             
Query: 335 agacaccaatgacaacaagccactcagggttnttgacacgcaccgcatcc 384
           | || |||||||| || |||||||||||||| || |||||| | ||||||
Sbjct: 753 acacgccaatgaccaccagccactcagggttcttcacacgctctgcatcc 704
to top
>gb|BT017520.1| Zea mays clone EL01N0421A02.c mRNA sequence
          Length = 1172

 Score =  119 bits (60), Expect = 7e-24
 Identities = 170/207 (82%)
 Strand = Plus / Minus

                                                                       
Query: 169 agcattttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggt 228
           |||| |||||| ||||||||||||||||||||||||||||| |||||| | || || || 
Sbjct: 888 agcagtttgttctcctccaagaaactgtaggtcgggacctcgaggttgaacggggcaggg 829

                                                                       
Query: 229 cccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagcca 288
           ||||| | ||| || || || |||| |||||| || ||||| ||||||||||||||||| 
Sbjct: 828 cccttgcggatcctcccggatatgtagtagtgggaaccatggcatgggcagaaccagccg 769

                                                                       
Query: 289 ccgaagtccccagagttgggcaggggaatgcagcccaggtgagtgcagacaccaatgaca 348
           || ||||| || | ||| || || || ||||| || ||||||||||| || |||||||| 
Sbjct: 768 ccaaagtctccggcgttcggtagtgggatgcaaccgaggtgagtgcacacgccaatgacc 709

                                      
Query: 349 acaagccactcagggttnttgacacgc 375
           || |||||||| || || || ||||||
Sbjct: 708 accagccactcgggattcttcacacgc 682
to top
>gb|L16811.1|TOBFESB Nicotiana tabacum clone 8.8 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1202

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| ||||||| |||||||||||| || |||||||| || || ||||| ||||| || 
Sbjct: 906 ttgttctcctccatgaaactgtaggtaggcacctccagattatatggtgcaggtcctttg 847

                                                                   
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           |  || ||||| |||||||| ||||| |||||||| |||||||| ||||| |||||
Sbjct: 846 cgaatcctaccagagatgtcatagtgggagccatggcatgggcaaaaccaaccacc 791
to top
>gb|DQ207870.1| Solanum tuberosum clone 087E11 rieske iron-sulfur protein-like
           mRNA, complete cds
          Length = 1098

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| || ||||||||||||||||| || |||||||| || || ||||| ||||| || 
Sbjct: 840 ttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtcctttg 781

                                                                   
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           |  || ||||| ||||||||||| || |||||||| |||||||| ||||| |||||
Sbjct: 780 cgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccacc 725
to top
>gb|BT014059.1| Lycopersicon esculentum clone 133157F, mRNA sequence
          Length = 1087

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| || ||||||||||||||||| || |||||||| || || ||||| ||||| || 
Sbjct: 852 ttgttctcttccaagaaactgtaggtaggcacctccagattatacggtgcgggtcctttg 793

                                                                   
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           |  || ||||| ||||||||||| || |||||||| |||||||| ||||| |||||
Sbjct: 792 cgaatcctaccagagatgtcgtaatgagagccatggcatgggcaaaaccaaccacc 737
to top
>emb|X79332.1|STFES1G S.tuberosum (Desiree) FeS1 mRNA for Rieske iron-sulfur protein
          Length = 993

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| || ||||||||||| ||||| || |||||||| || || ||||| ||||| || 
Sbjct: 803 ttgttctcttccaagaaactataggtaggcacctccagattatacggtgcgggtcctttg 744

                                                                   
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           |  || ||||| ||||||||||| || |||||||| |||||||| ||||| |||||
Sbjct: 743 cgaatcctaccagagatgtcgtaatgggagccatggcatgggcaaaaccaaccacc 688
to top
>ref|XM_447387.1| Candida glabrata CBS138 hypothetical protein (CAGL0I03190g) partial
           mRNA
          Length = 642

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 223 gctggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaac 282
           ||||| ||||| || |||||||| ||||| |||||||| || || ||||| |||||||||
Sbjct: 581 gctgggccctttctaattctaccagagatatcgtagtgagaaccgtgacaagggcagaac 522

                         
Query: 283 cagccaccgaagtc 296
           || |||||||||||
Sbjct: 521 caaccaccgaagtc 508
to top
>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                          
Query: 223    gctggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaac 282
              ||||| ||||| || |||||||| ||||| |||||||| || || ||||| |||||||||
Sbjct: 274042 gctgggccctttctaattctaccagagatatcgtagtgagaaccgtgacaagggcagaac 274101

                            
Query: 283    cagccaccgaagtc 296
              || |||||||||||
Sbjct: 274102 caaccaccgaagtc 274115
to top
>gb|L16813.1|TOBFESD Nicotiana tabacum clone 32.10 Rieske iron-sulfur protein mRNA,
           complete cds; mitochondrial
          Length = 1121

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 95/116 (81%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgttatcctccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttc 234
           ||||| ||||||| |||||||||||| || |||||||| || || || || ||||| || 
Sbjct: 890 ttgttctcctccatgaaactgtaggtaggcacctccagattatatggcgcaggtcctttg 831

                                                                   
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           |  || ||||| |||||||| ||||| || ||||| |||||||| ||||| |||||
Sbjct: 830 cgaatcctaccagagatgtcatagtgggaaccatggcatgggcaaaaccaaccacc 775
to top
>ref|XM_454973.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E22682g predicted mRNA
          Length = 642

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 223 gctggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaac 282
           ||||| ||||| ||||||||||| ||||| ||||| || || || |||||||| ||||||
Sbjct: 581 gctggaccctttctgattctaccggagatatcgtaatgggaaccgtgacatggacagaac 522

                               
Query: 283 cagccaccgaagtccccaga 302
           || |||||||| || |||||
Sbjct: 521 caaccaccgaaatcaccaga 502
to top
>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                           
Query: 223     gctggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaac 282
               ||||| ||||| ||||||||||| ||||| ||||| || || || |||||||| ||||||
Sbjct: 2014752 gctggaccctttctgattctaccggagatatcgtaatgggaaccgtgacatggacagaac 2014693

                                   
Query: 283     cagccaccgaagtccccaga 302
               || |||||||| || |||||
Sbjct: 2014692 caaccaccgaaatcaccaga 2014673
to top
>tpg|BK005644.1| TPA: TPA_inf: Triticum aestivum histidine-containing
           phosphotransfer protein 2 (HP) mRNA, complete cds
          Length = 1212

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 gctcttagccgataagcattttgttatcctccaagaaactgtaggtcgggacctccaggt 214
           |||||||||| || ||||| |||||||| ||||||||||||||||| || ||||| ||||
Sbjct: 291 gctcttagcctatgagcatcttgttatcttccaagaaactgtaggtgggcacctcaaggt 350
to top
>ref|NM_121347.3| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c
           reductase AT5G13440 mRNA, complete cds
          Length = 1286

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 959 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 900

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 899 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 853
to top
>emb|AL163572.1|ATT22N19 Arabidopsis thaliana DNA chromosome 5, BAC clone T22N19 (ESSA project)
          Length = 68948

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                         
Query: 184   tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
             |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 51620 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 51679

                                                            
Query: 244   cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
             || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 51680 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 51726



 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Plus

                                                                         
Query: 184   tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
             |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 48603 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 48662

                                                            
Query: 244   cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
             || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 48663 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 48709
to top
>gb|AY081510.1| Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein
           (At5g13440) mRNA, complete cds
          Length = 932

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 800 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 741

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 740 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 694
to top
>dbj|AK221169.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase
           -like protein, partial cds, clone: RAFL22-96-P11
          Length = 800

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 518 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 459

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 458 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 412
to top
>gb|AF370533.1|AF370533 Arabidopsis thaliana ubiquinol--cytochrome-c reductase-like protein
           (T22N19_90) mRNA, complete cds
          Length = 1080

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 856 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 797

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 796 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 750
to top
>emb|BX829960.1|CNS0A1KF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZG05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1003

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 815 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 756

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 755 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 709
to top
>emb|BX830982.1|CNS0A0P7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS45ZG07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1231

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 904 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 845

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 844 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 798
to top
>gb|AY086148.1| Arabidopsis thaliana clone 21819 mRNA, complete sequence
          Length = 1226

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||||||| ||||||||||| || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 960 tccaagaagctgtaggtcggtacttccaggttgtatggtgcaggacctttcctaattctt 901

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 900 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 854
to top
>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                          
Query: 235    ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccaccgaag 294
              ||||||||||| || || |||||||| || || || |||||||||||||||||||| |||
Sbjct: 508736 ctgattctaccggaaatatcgtagtgggaaccgtggcatgggcagaaccagccaccaaag 508677

                
Query: 295    tc 296
              ||
Sbjct: 508676 tc 508675
to top
>ref|NM_210148.1| Eremothecium gossypii AEL067Wp (AEL067W), mRNA
          Length = 639

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 235 ctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagccaccgaag 294
           ||||||||||| || || |||||||| || || || |||||||||||||||||||| |||
Sbjct: 566 ctgattctaccggaaatatcgtagtgggaaccgtggcatgggcagaaccagccaccaaag 507

             
Query: 295 tc 296
           ||
Sbjct: 506 tc 505
to top
>ref|XM_654818.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2306.2), mRNA
          Length = 717

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
           ||||||||||| || |  || ||||| |||||||| || ||||| || ||||||||||||
Sbjct: 650 ggtcccttcctaatacggccggagatatcgtagtgcgaaccatggcaggggcagaaccag 591

                      
Query: 286 ccaccgaagtc 296
           || ||||||||
Sbjct: 590 ccgccgaagtc 580
to top
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                 
Query: 251    tgtcgtagtgtgagccatgacatgggcagaaccagccaccgaagtccccag 301
              |||| ||||| ||||| || || ||||||||||||||||||||||| ||||
Sbjct: 331091 tgtcatagtgagagccgtggcaggggcagaaccagccaccgaagtcaccag 331041
to top
>gb|AY682089.1| Sinorhizobium meliloti strain GR4 plasmid pRmeGR4a RepC (repC)
           locus, partial sequence
          Length = 6728

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 251 tgtcgtagtgtgagccatgacatgggcagaaccagccaccgaagtc 296
           |||||||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 334 tgtcgtagtgcgacccgtgacaggggcagaaccagccgccgaagtc 379
to top
>gb|AE005720.1| Caulobacter crescentus CB15 section 46 of 359 of the complete genome
          Length = 11816

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                          
Query: 251  tgtcgtagtgtgagccatgacatgggcagaaccagccaccgaagtc 296
            |||||||||| ||||| || || |||||||||||||| ||||||||
Sbjct: 5536 tgtcgtagtgcgagccgtggcaggggcagaaccagccgccgaagtc 5491
to top
>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010
          Length = 2039961

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                           
Query: 229     cccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccagcca 288
               ||||||||||| |  || |||||||||||||| || || || || |||||||||||||| 
Sbjct: 1276821 cccttcctgatacggccggagatgtcgtagtgagaaccgtggcaggggcagaaccagccg 1276762

                       
Query: 289     ccgaagtc 296
               || |||||
Sbjct: 1276761 ccaaagtc 1276754
to top
>ref|NM_121346.2| Arabidopsis thaliana oxidoreductase/ ubiquinol-cytochrome-c
           reductase AT5G13430 mRNA, complete cds
          Length = 1222

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 908 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 849

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 848 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 802
to top
>ref|XM_957255.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial
           mRNA
          Length = 696

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
           ||||| |||||||| |  || ||||| |||||||| || || || || ||||||||||||
Sbjct: 629 ggtcctttcctgatacggccagagatatcgtagtgagaaccgtggcaagggcagaaccag 570

                      
Query: 286 ccaccgaagtc 296
           |||||| ||||
Sbjct: 569 ccaccgtagtc 559
to top
>ref|XM_326460.1| Neurospora crassa OR74A hypothetical protein (NCU06606.1) partial
           mRNA
          Length = 696

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
           ||||| |||||||| |  || ||||| |||||||| || || || || ||||||||||||
Sbjct: 629 ggtcctttcctgatacggccagagatatcgtagtgagaaccgtggcaagggcagaaccag 570

                      
Query: 286 ccaccgaagtc 296
           |||||| ||||
Sbjct: 569 ccaccgtagtc 559
to top
>emb|X02472.1|NCCYRFES Neurospora gene for mitochondrial ubiquinol-cytochrome c reductase
            iron-sulfur subunit
          Length = 1790

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 226  ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
            ||||| |||||||| |  || ||||| |||||||| || || || || ||||||||||||
Sbjct: 1418 ggtcctttcctgatacggccagagatatcgtagtgagaaccgtggcaagggcagaaccag 1359

                       
Query: 286  ccaccgaagtc 296
            |||||| ||||
Sbjct: 1358 ccaccgtagtc 1348
to top
>gb|AF375413.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds
          Length = 1067

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 874 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 815

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 814 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 768
to top
>gb|AY066055.1| Arabidopsis thaliana AT5g13430/T22N19_80 mRNA, complete cds
          Length = 819

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 794 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 735

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 734 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 688
to top
>dbj|AK221073.1| Arabidopsis thaliana mRNA for ubiquinol--cytochrome-c reductase
           -like protein, partial cds, clone: RAFL22-79-D17
          Length = 414

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 214 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 155

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 154 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 108
to top
>emb|BX830387.1|CNS0A1JK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZD09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 826 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 767

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 766 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 720
to top
>emb|BX829878.1|CNS0A1B9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZG11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 863 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 804

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 803 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 757
to top
>emb|BX829847.1|CNS0A1CH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB40ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 864 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 805

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 804 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 758
to top
>emb|BX831700.1|CNS0A14K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH24ZF01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 542

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 319 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 260

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 259 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 213
to top
>emb|BX833733.1|CNS0A0BW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL74ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 992

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 864 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 805

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 804 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 758
to top
>gb|AY085370.1| Arabidopsis thaliana clone 1482 mRNA, complete sequence
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 tccaagaaactgtaggtcgggacctccaggttgtagggtgctggtcccttcctgattcta 243
           |||| ||| |||||||| || || ||||||||||| ||||| || || ||||| ||||| 
Sbjct: 899 tccaggaagctgtaggttggtacttccaggttgtatggtgcaggacctttcctaattctt 840

                                                          
Query: 244 cctgagatgtcgtagtgtgagccatgacatgggcagaaccagccacc 290
           || || || ||||| ||||| || ||||| || || ||||| |||||
Sbjct: 839 ccagatatatcgtaatgtgatccgtgacacggacaaaaccaaccacc 793
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                          
Query: 251     tgtcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
               ||||||| || |||||||| || |||||||||||||| |||||
Sbjct: 2177358 tgtcgtactgcgagccatggcacgggcagaaccagccgccgaa 2177400
to top
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                             
Query: 251     tgtcgtagtgtgagccatgacatgggcagaaccagccaccgaagtc 296
               |||||||||| || || || || |||||||||||||| ||||||||
Sbjct: 3174549 tgtcgtagtgcgatccgtggcaggggcagaaccagcccccgaagtc 3174594
to top
>emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete chromosome; segment 7/12
          Length = 306250

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 251    tgtcgtagtgtgagccatgacatgggcagaaccagccaccgaagtc 296
              |||||||||| ||||| || || || ||||||||||| ||||||||
Sbjct: 193695 tgtcgtagtgcgagccgtggcagggacagaaccagccgccgaagtc 193740
to top
>emb|X56157.1|RSFBCOPER R. sphaeroides fbc operon for cytochrome bc1 complex reductase (EC
           1.10.2.2)
          Length = 3381

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 251 tgtcgtagtgtgagccatgacatgggcagaaccagccaccgaagtc 296
           |||||||||| || || || || |||||||||||||| ||||||||
Sbjct: 751 tgtcgtagtgcgatccgtggcaggggcagaaccagcccccgaagtc 706
to top
>ref|NM_213086.1| Danio rerio ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (uqcrfs1), mRNA
          Length = 1028

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 cagcccaggtgagtgcagacaccaatgac 347
           |||||||| || |||||||||||||||||
Sbjct: 679 cagcccagatgggtgcagacaccaatgac 651
to top
>gb|BC067544.1| Danio rerio ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone MGC:85614
           IMAGE:6524377), complete cds
          Length = 1582

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 cagcccaggtgagtgcagacaccaatgac 347
           |||||||| || |||||||||||||||||
Sbjct: 705 cagcccagatgggtgcagacaccaatgac 677
to top
>gb|AC140267.2| Mus musculus BAC clone RP24-303O5 from chromosome 15, complete sequence
          Length = 169842

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 147    cagtcagtgctcttagccgat 167
              |||||||||||||||||||||
Sbjct: 130792 cagtcagtgctcttagccgat 130812
to top
>gb|AC161199.4| Mus musculus chromosome 15, clone RP23-383D13, complete sequence
          Length = 218523

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 147    cagtcagtgctcttagccgat 167
              |||||||||||||||||||||
Sbjct: 161981 cagtcagtgctcttagccgat 161961
to top
>gb|AY558341.1| Saccharomyces cerevisiae clone FLH111526.01X YEL024W gene, complete
           cds
          Length = 648

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
           |||||||| ||||||||||| || || || || ||||| ||||| || || |||||||| 
Sbjct: 584 ggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacagaaccaa 525

                
Query: 286 ccacc 290
           |||||
Sbjct: 524 ccacc 520
to top
>ref|XM_748490.1| Aspergillus fumigatus Af293 ubiquinol-cytochrome c reductase
           iron-sulfur subunit precursor (Afu5g10610) partial mRNA
          Length = 897

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 319 cagcccaggtgagtgcagacaccaa 343
           ||||| |||||||||||||||||||
Sbjct: 737 cagccaaggtgagtgcagacaccaa 713
to top
>gb|AC123065.3| Mus musculus BAC clone RP23-239F13 from 9, complete sequence
          Length = 158137

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 147   cagtcagtgctcttagccgataagc 171
             ||||||||||||||| |||||||||
Sbjct: 98803 cagtcagtgctcttaaccgataagc 98779
to top
>gb|AC138714.4| Mus musculus chromosome 18 clone RP23-406C12, complete sequence
          Length = 191928

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 147   cagtcagtgctcttagccgat 167
             |||||||||||||||||||||
Sbjct: 62708 cagtcagtgctcttagccgat 62688
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 313     ggaatgcagcccaggtgagtgcaga 337
               ||||||||||| |||||||||||||
Sbjct: 1467269 ggaatgcagccaaggtgagtgcaga 1467245
to top
>emb|X05630.1|RCPETG Rhodopseudomonas capsulata petABC operon
          Length = 4007

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 253  tcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
            |||||||| ||||| || || |||||||||||||| |||||
Sbjct: 1213 tcgtagtgcgagccgtggcaggggcagaaccagccgccgaa 1173
to top
>emb|X03476.1|RCFBC Rhodopseudomonas sphaeroides fbc operon (fbcF, fbcB, fbcC genes)
          Length = 3874

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 253  tcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
            |||||||| ||||| || || |||||||||||||| |||||
Sbjct: 1324 tcgtagtgcgagccgtggcaggggcagaaccagccgccgaa 1284
to top
>emb|BX640450.1| Bordetella bronchiseptica strain RB50, complete genome; segment 14/16
          Length = 346287

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 198  ggtcgggacctccaggttgta 218
            |||||||||||||||||||||
Sbjct: 4912 ggtcgggacctccaggttgta 4932
to top
>emb|BX640434.1| Bordetella parapertussis strain 12822, complete genome; segment 12/14
          Length = 344805

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 198    ggtcgggacctccaggttgta 218
              |||||||||||||||||||||
Sbjct: 298182 ggtcgggacctccaggttgta 298202
to top
>emb|BX640412.1| Bordetella pertussis strain Tohama I, complete genome; segment 2/12
          Length = 348171

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 198   ggtcgggacctccaggttgta 218
             |||||||||||||||||||||
Sbjct: 71849 ggtcgggacctccaggttgta 71829
to top
>gb|BC059475.1| Danio rerio ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1, mRNA (cDNA clone MGC:73109
           IMAGE:4786975), complete cds
          Length = 1028

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 319 cagcccaggtgagtgcagacaccaatgac 347
           |||||||| || |||||||||||||||||
Sbjct: 679 cagcccagatgggtgcagacaccaatgac 651
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 253     tcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
               |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 4489656 tcgtagtgcgatccatggcacgggcagaaccagccgccgaa 4489616
to top
>gb|AC153145.4| Mus musculus BAC clone RP23-222C3 from chromosome 18, complete sequence
          Length = 193382

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 147   cagtcagtgctcttagccgat 167
             |||||||||||||||||||||
Sbjct: 62701 cagtcagtgctcttagccgat 62681
to top
>gb|AF332860.1|AF332860S1 Mus musculus diadenosine triphosphate hydrolase (Fhit) gene, exons 3
             and 4
          Length = 147968

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 147   cagtcagtgctcttagccgat 167
             |||||||||||||||||||||
Sbjct: 87693 cagtcagtgctcttagccgat 87713
to top
>emb|AL116266.1|CNS01D1U Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 253 tcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
           |||||||| || || ||||||||||||||||| || |||||
Sbjct: 329 tcgtagtgggaaccgtgacatgggcagaaccatcctccgaa 289
to top
>emb|AL114037.1|CNS01BBX Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 253 tcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
           |||||||| || || ||||||||||||||||| || |||||
Sbjct: 233 tcgtagtgggaaccgtgacatgggcagaaccatcctccgaa 193
to top
>emb|AL113155.1|CNS01ANF Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 253 tcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
           |||||||| || || ||||||||||||||||| || |||||
Sbjct: 342 tcgtagtgggaaccgtgacatgggcagaaccatcctccgaa 302
to top
>emb|AL111908.1|CNS019OS Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 253 tcgtagtgtgagccatgacatgggcagaaccagccaccgaa 293
           |||||||| || || ||||||||||||||||| || |||||
Sbjct: 220 tcgtagtgggaaccgtgacatgggcagaaccatcctccgaa 180
to top
>gb|AC122441.6| Mus musculus BAC clone RP24-225A21 from chromosome 8, complete sequence
          Length = 177689

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 147    cagtcagtgctcttagccgataagc 171
              ||||||||||||||| |||||||||
Sbjct: 151045 cagtcagtgctcttaaccgataagc 151069
to top
>gb|U18530.1|SCE9871 Saccharomyces cerevisiae chromosome V cosmids 9871, 8199, 9867, 9495
             and lambda clones 6693 and 5898
          Length = 62643

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 226   ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
             |||||||| ||||||||||| || || || || ||||| ||||| || || |||||||| 
Sbjct: 18249 ggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacagaaccaa 18190

                  
Query: 286   ccacc 290
             |||||
Sbjct: 18189 ccacc 18185
to top
>gb|AC147636.3| Mus musculus BAC clone RP23-201C3 from 9, complete sequence
          Length = 202197

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 147   cagtcagtgctcttagccgataagc 171
             ||||||||||||||| |||||||||
Sbjct: 78478 cagtcagtgctcttaaccgataagc 78454
to top
>emb|BX005081.6| Zebrafish DNA sequence from clone CH211-69M16 in linkage group 7,
             complete sequence
          Length = 168607

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 319   cagcccaggtgagtgcagacaccaatgac 347
             |||||||| || |||||||||||||||||
Sbjct: 35045 cagcccagatgggtgcagacaccaatgac 35073
to top
>gb|AC147989.4| Mus musculus BAC clone RP24-468I14 from 18, complete sequence
          Length = 204168

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 147   cagtcagtgctcttagccgat 167
             |||||||||||||||||||||
Sbjct: 28143 cagtcagtgctcttagccgat 28163
to top
>emb|AL928926.9| Mouse DNA sequence from clone RP23-443G7 on chromosome 2, complete
              sequence
          Length = 211456

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 147    cagtcagtgctcttagccgataagc 171
              ||||||||||||||||||| |||||
Sbjct: 173193 cagtcagtgctcttagccgctaagc 173169
to top
>emb|AL831722.8| Mouse DNA sequence from clone RP23-312D15 on chromosome X, complete
             sequence
          Length = 148564

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 147   cagtcagtgctcttagccgat 167
             |||||||||||||||||||||
Sbjct: 72055 cagtcagtgctcttagccgat 72075
to top
>emb|AL589873.11| Mouse DNA sequence from clone RP23-120P1 on chromosome 2, complete
             sequence
          Length = 170936

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 147   cagtcagtgctcttagccgataagc 171
             ||||||||||||||| |||||||||
Sbjct: 48697 cagtcagtgctcttaaccgataagc 48721
to top
>gb|M24500.1|YSCRIP1A S.cerevisiae Rieske iron-sulfur protein (RIP1) gene, complete cds
          Length = 1238

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
           |||||||| ||||||||||| || || || || ||||| ||||| || || |||||||| 
Sbjct: 906 ggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacagaaccaa 847

                
Query: 286 ccacc 290
           |||||
Sbjct: 846 ccacc 842
to top
>gb|M23316.1|YSCRIP1 Yeast (S.cerevisiae; DC5) Rieske iron-sulfur protein gene, complete
           cds
          Length = 1238

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 ggtcccttcctgattctacctgagatgtcgtagtgtgagccatgacatgggcagaaccag 285
           |||||||| ||||||||||| || || || || ||||| ||||| || || |||||||| 
Sbjct: 906 ggtccctttctgattctaccggaaatatcataatgtgaaccatggcaaggacagaaccaa 847

                
Query: 286 ccacc 290
           |||||
Sbjct: 846 ccacc 842
to top
>gb|AC111093.10| Mus musculus chromosome 3, clone RP23-170E22, complete sequence
          Length = 201202

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    aaaaaggtgaattatcaaac 107
             ||||||||||||||||||||
Sbjct: 91299 aaaaaggtgaattatcaaac 91280
to top
>gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5, complete sequence
          Length = 219218

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 303    gttgggcaggggaatgcagc 322
              ||||||||||||||||||||
Sbjct: 120529 gttgggcaggggaatgcagc 120510
to top
>gb|AC165975.4| Mus musculus BAC clone RP23-3L23 from chromosome 5, complete sequence
          Length = 259091

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 128    caccataggattcatcctac 147
              ||||||||||||||||||||
Sbjct: 144101 caccataggattcatcctac 144082
to top
>gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosome 5, complete sequence
          Length = 206735

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 303    gttgggcaggggaatgcagc 322
              ||||||||||||||||||||
Sbjct: 152930 gttgggcaggggaatgcagc 152949
to top
>gb|AC164647.3| Mus musculus BAC clone RP23-463P13 from chromosome 16, complete sequence
          Length = 181953

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 132808 acagtcagtgctcttagccg 132827
to top
>gb|AC159290.2| Mus musculus BAC clone RP23-291I2 from chromosome 13, complete sequence
          Length = 231853

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   tcctacagtcagtgctctta 161
             ||||||||||||||||||||
Sbjct: 76136 tcctacagtcagtgctctta 76155
to top
>ref|XM_473907.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 897

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 tgttatcctccaagaaactg 195
           ||||||||||||||||||||
Sbjct: 382 tgttatcctccaagaaactg 363
to top
>gb|AC104918.13| Mus musculus chromosome 7, clone RP23-335G1, complete sequence
          Length = 204099

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   cagtcagtgctcttagccga 166
             ||||||||||||||||||||
Sbjct: 98778 cagtcagtgctcttagccga 98797
to top
>ref|NM_027429.1| Mus musculus RIKEN cDNA 2610300B10 gene (2610300B10Rik), mRNA
          Length = 4262

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 148  agtcagtgctcttagccgataagc 171
            |||||||||||||||||| |||||
Sbjct: 2215 agtcagtgctcttagccgctaagc 2238
to top
>gb|AC123747.26| Mus musculus chromosome 3, clone RP24-123I12, complete sequence
          Length = 188946

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 143128 acagtcagtgctcttagccg 143109
to top
>gb|AC144797.2| Mus musculus BAC clone RP24-349B2 from chromosome 16, complete sequence
          Length = 129045

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 85850 acagtcagtgctcttagccg 85831
to top
>gb|AC127421.3| Mus musculus BAC clone RP24-314F1 from chromosome 18, complete sequence
          Length = 170221

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 164919 acagtcagtgctcttagccg 164938
to top
>gb|AC116998.3| Mus musculus BAC clone RP23-16F6 from 18, complete sequence
          Length = 216959

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 156297 acagtcagtgctcttagccg 156316
to top
>gb|BC060191.1| Mus musculus RIKEN cDNA 2610300B10 gene, mRNA (cDNA clone
            IMAGE:6833993), partial cds
          Length = 4371

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 148  agtcagtgctcttagccgataagc 171
            |||||||||||||||||| |||||
Sbjct: 2281 agtcagtgctcttagccgctaagc 2304
to top
>gb|AC098725.3| Mus musculus BAC clone RP23-3D20 from 3, complete sequence
          Length = 234471

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 62918 acagtcagtgctcttagccg 62899
to top
>gb|AC138640.7| Mus musculus chromosome 1, clone RP23-463G19, complete sequence
          Length = 167384

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 148    agtcagtgctcttagccgataagc 171
              |||||||||||||||||| |||||
Sbjct: 105811 agtcagtgctcttagccgctaagc 105788
to top
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 262     gagccatgacatgggcagaa 281
               ||||||||||||||||||||
Sbjct: 1943120 gagccatgacatgggcagaa 1943101
to top
>emb|AL050321.11|HSJ717M23 Human DNA sequence from clone RP4-717M23 on chromosome 20 Contains the
             CSRP2BP gene for CSRP2 binding protein, a chromosome 7
             open reading frame 24 (C7orf24) pseudogene and two CpG
             islands, complete sequence
          Length = 101589

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   ttatcctccaagaaactgta 197
             ||||||||||||||||||||
Sbjct: 26919 ttatcctccaagaaactgta 26938
to top
>emb|AL606648.3|OSJN00093 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0093O08,
              complete sequence
          Length = 148860

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    tgttatcctccaagaaactg 195
              ||||||||||||||||||||
Sbjct: 145107 tgttatcctccaagaaactg 145126
to top
>emb|AL662970.2|OSJN00174 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0058K23,
             complete sequence
          Length = 164805

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   tgttatcctccaagaaactg 195
             ||||||||||||||||||||
Sbjct: 25982 tgttatcctccaagaaactg 26001
to top
>emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5
          Length = 35660

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 328   tgagtgcagacaccaatgacaacaagccactc 359
             ||||| ||||||||||| | ||||||||||||
Sbjct: 20424 tgagtacagacaccaatcataacaagccactc 20455
to top
>emb|AL672178.8| Mouse DNA sequence from clone RP23-328O2 on chromosome 11 Contains part
             of a novel gene, complete sequence
          Length = 19104

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 12039 acagtcagtgctcttagccg 12020
to top
>emb|AJ719669.1| Gallus gallus mRNA for hypothetical protein, clone 5b19
          Length = 1070

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 195 gtaggtcgggacctccaggttgtagggtgctggtcccttcctgattct 242
           |||||| || ||||||||||| ||||| || || || |||||||||||
Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattct 798
to top
>ref|NM_001005843.1| Gallus gallus ubiquinol-cytochrome c reductase, Rieske iron-sulfur
           polypeptide 1 (UQCRFS1), mRNA
          Length = 1070

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 195 gtaggtcgggacctccaggttgtagggtgctggtcccttcctgattct 242
           |||||| || ||||||||||| ||||| || || || |||||||||||
Sbjct: 845 gtaggttggaacctccaggttatagggggcaggacctttcctgattct 798
to top
>gb|AC055777.12| Mus musculus chromosome 10, clone RP23-56K17, complete sequence
          Length = 186105

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 51881 acagtcagtgctcttagccg 51862
to top
>gb|AC099517.2| Homo sapiens chromosome 5 clone RP11-5H14, complete sequence
          Length = 150438

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   tgttatcctccaagaaactg 195
             ||||||||||||||||||||
Sbjct: 18669 tgttatcctccaagaaactg 18650
to top
>gb|AC025757.3| Homo sapiens chromosome 5 clone CTD-2195H9, complete sequence
          Length = 135862

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    tgttatcctccaagaaactg 195
              ||||||||||||||||||||
Sbjct: 115223 tgttatcctccaagaaactg 115204
to top
>dbj|AK154611.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630101E21
            product:hypothetical protein, full insert sequence
          Length = 4262

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 148  agtcagtgctcttagccgataagc 171
            |||||||||||||||||| |||||
Sbjct: 2215 agtcagtgctcttagccgctaagc 2238
to top
>gb|AC158626.6| Mus musculus 6 BAC RP23-4F16 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 240079

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 28146 acagtcagtgctcttagccg 28165
to top
>ref|NM_001021849.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC16H5.06),
           partial mRNA
          Length = 687

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 tgagtgcagacaccaatgacaacaagccactc 359
           ||||| ||||||||||| | ||||||||||||
Sbjct: 521 tgagtacagacaccaatcataacaagccactc 490
to top
>dbj|AK028960.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched
           library, clone:4732474I19 product:RIKEN cDNA 2610300B10
           gene, full insert sequence
          Length = 2951

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 148 agtcagtgctcttagccgataagc 171
           |||||||||||||||||| |||||
Sbjct: 508 agtcagtgctcttagccgctaagc 531
to top
>gb|AC153872.2| Mus musculus 6 BAC RP23-226O20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 203418

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 16675 acagtcagtgctcttagccg 16656
to top
>gb|AC010899.8| Homo sapiens BAC clone RP11-543K1 from 2, complete sequence
          Length = 210232

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   acacaaatgacagcacagca 129
             ||||||||||||||||||||
Sbjct: 81345 acacaaatgacagcacagca 81326
to top
>gb|AC146977.22| Mus musculus chromosome 13, clone RP23-106I12, complete sequence
          Length = 200131

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   tcctacagtcagtgctctta 161
             ||||||||||||||||||||
Sbjct: 61086 tcctacagtcagtgctctta 61067
to top
>emb|BX537301.12| Mouse DNA sequence from clone RP23-127O5 on chromosome 4, complete
             sequence
          Length = 103179

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 147   cagtcagtgctcttagccgataag 170
             ||||||||||||||| ||||||||
Sbjct: 27710 cagtcagtgctcttaaccgataag 27687
to top
>dbj|AK103625.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133N17, full
           insert sequence
          Length = 1195

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 tgttatcctccaagaaactg 195
           ||||||||||||||||||||
Sbjct: 488 tgttatcctccaagaaactg 469
to top
>emb|AL117264.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0313F03, complete
             sequence
          Length = 131195

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   tgttatcctccaagaaactg 195
             ||||||||||||||||||||
Sbjct: 68140 tgttatcctccaagaaactg 68159
to top
>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 262     gagccatgacatgggcagaa 281
               ||||||||||||||||||||
Sbjct: 2498559 gagccatgacatgggcagaa 2498578
to top
>emb|CT030172.10| Mouse DNA sequence from clone RP23-313L22 on chromosome 13, complete
              sequence
          Length = 228833

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    tcctacagtcagtgctctta 161
              ||||||||||||||||||||
Sbjct: 185728 tcctacagtcagtgctctta 185709
to top
>gb|U40480.1|SPU40480 Schizosaccharomyces pombe Rieske iron-sulfur protein (Rip1) mRNA,
           complete cds
          Length = 746

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 tgagtgcagacaccaatgacaacaagccactc 359
           ||||| ||||||||||| | ||||||||||||
Sbjct: 575 tgagtacagacaccaatcataacaagccactc 544
to top
>gb|AC174448.2| Mus musculus BAC clone RP23-204P24 from chromosome 16, complete
             sequence
          Length = 198814

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 22171 acagtcagtgctcttagccg 22152
to top
>gb|AC117775.8| Mus musculus chromosome 16, clone RP24-535F23, complete sequence
          Length = 127815

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 89006 acagtcagtgctcttagccg 89025
to top
>emb|CT030722.6| Mouse DNA sequence from clone RP23-191N15 on chromosome 13, complete
             sequence
          Length = 187837

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   tcctacagtcagtgctctta 161
             ||||||||||||||||||||
Sbjct: 30145 tcctacagtcagtgctctta 30126
to top
>gb|AC131120.4| Mus musculus BAC clone RP24-547N4 from 10, complete sequence
          Length = 228657

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 129588 acagtcagtgctcttagccg 129569
to top
>gb|AC148020.3| Mus musculus BAC clone RP23-6A22 from 18, complete sequence
          Length = 238892

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 192644 acagtcagtgctcttagccg 192625
to top
>gb|AC138719.4| Mus musculus BAC clone RP23-178O8 from 10, complete sequence
          Length = 183689

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 158624 acagtcagtgctcttagccg 158605
to top
>gb|AC140410.3| Mus musculus BAC clone RP23-141J11 from 10, complete sequence
          Length = 205197

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 16454 acagtcagtgctcttagccg 16435
to top
>emb|AL672278.12| Mouse DNA sequence from clone RP23-465H23 on chromosome 16, complete
             sequence
          Length = 187418

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 146   acagtcagtgctcttagccg 165
             ||||||||||||||||||||
Sbjct: 35879 acagtcagtgctcttagccg 35898
to top
>emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chromosome X, complete
              sequence
          Length = 203581

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    acagtcagtgctcttagccg 165
              ||||||||||||||||||||
Sbjct: 132688 acagtcagtgctcttagccg 132707


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,159,500
Number of Sequences: 3902068
Number of extensions: 3159500
Number of successful extensions: 109146
Number of sequences better than 10.0: 137
Number of HSP's better than 10.0 without gapping: 138
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108529
Number of HSP's gapped (non-prelim): 610
length of query: 384
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 362
effective length of database: 17,147,199,772
effective search space: 6207286317464
effective search space used: 6207286317464
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top