ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags27a09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC134537.3| Mus musculus BAC clone RP24-388M1 from chromosome 12, complete sequence Length = 221662 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 431 gcaaacagaagcagcattttca 452 |||||||||||||||||||||| Sbjct: 170761 gcaaacagaagcagcattttca 170740
>gb|AC146193.3| Pan troglodytes BAC clone CH251-483N24 from Y, complete sequence Length = 232304 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 96094 agggatcgagaccagcctgacc 96115
>gb|AC068531.9| Homo sapiens chromosome 17, clone RP11-463M16, complete sequence Length = 182555 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 168079 agggatcgagaccagcctgacc 168100
>gb|AC127337.4| Mus musculus BAC clone RP23-168F21 from 12, complete sequence Length = 209066 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 431 gcaaacagaagcagcattttca 452 |||||||||||||||||||||| Sbjct: 789 gcaaacagaagcagcattttca 768
>emb|AL360155.11| Human DNA sequence from clone RP11-721G11 on chromosome 6 Contains a pseudogene similar to part of KIAA1925, complete sequence Length = 107908 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 349 cttgctcagcttcttcttgtca 370 |||||||||||||||||||||| Sbjct: 25944 cttgctcagcttcttcttgtca 25923
>gb|AC091133.11| Homo sapiens chromosome 17, clone RP11-501C14, complete sequence Length = 168613 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 167916 agggatcgagaccagcctgacc 167895 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 329 gggatcgagaccagcctgacc 349 ||||||||||||||||||||| Sbjct: 75981 gggatcgagaccagcctgacc 75961
>dbj|BS000611.1| Pan troglodytes chromosome Y clone:PTB-386A09, complete sequences Length = 171989 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 92613 agggatcgagaccagcctgacc 92592
>dbj|BS000534.1| Pan troglodytes chromosome Y clone:PTB-092H12, complete sequences Length = 224014 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 221100 agggatcgagaccagcctgacc 221079
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 22747750 agggatcgagaccagcctgacc 22747771
>gb|AC151479.4| Pan troglodytes BAC clone CH251-656P8 from chromosome y, complete sequence Length = 179557 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 161816 agggatcgagaccagcctgacc 161837
>gb|AC007284.4|AC007284 Homo sapiens BAC clone RP11-558K21 from Y, complete sequence Length = 171449 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 328 agggatcgagaccagcctgacc 349 |||||||||||||||||||||| Sbjct: 67843 agggatcgagaccagcctgacc 67822
>ref|XM_472538.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1803 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 atagtgaaggacatttgcgca 94 ||||||||||||||||||||| Sbjct: 1288 atagtgaaggacatttgcgca 1308
>ref|XM_472565.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 4371 Score = 42.1 bits (21), Expect = 1.7 Identities = 83/104 (79%) Strand = Plus / Minus Query: 404 gtccatgtatcgactaggtttggtattgcaaacagaagcagcattttcacctccagcgat 463 |||||||| ||||||||| | ||||| || | ||||| ||||| | |||| ||| ||| Sbjct: 3926 gtccatgtgtcgactaggctaggtatcgcggatagaagaagcatctctaccttcagagat 3867 Query: 464 ttcagtatctcctcnatgtaatccaccagttgcctgcacatccc 507 ||||| |||| || |||||||||| || ||||||||||||| Sbjct: 3866 ttcagcatctgttcaatgtaatccatgagacgcctgcacatccc 3823
>gb|U00040.1| Caenorhabditis elegans cosmid C18H2, complete sequence Length = 41762 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 308 ttcttcagaagaacagttcca 328 ||||||||||||||||||||| Sbjct: 36005 ttcttcagaagaacagttcca 36025
>gb|BC014430.1| Homo sapiens Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse), mRNA (cDNA clone IMAGE:4552615), with apparent retained intron Length = 1812 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 326 ccagggatcgagaccagcctg 346 ||||||||||||||||||||| Sbjct: 1560 ccagggatcgagaccagcctg 1580
>emb|AL157769.12| Human DNA sequence from clone RP11-484I6 on chromosome 13q32.3-33.3 Contains 3 novel genes, the gene for endoplasmic reticulum resident protein 58 (MGC5302), the BIVM gene for basic, immunoglobulin-like variable motif containing, the ERCC5 gene for excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) and 3 CpG islands, complete sequence Length = 172052 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 322 agttccagggatcgagaccagcctg 346 |||||||||| |||||||||||||| Sbjct: 74549 agttccagggttcgagaccagcctg 74525
>emb|AL022721.1|HS109F14 Human DNA sequence from clone RP1-109F14 on chromosome 6p21.2-21.3 Contains the TEAD3 gene for TEA domain family member 3, the RPL10A gene for ribosomal protein RPL10a, the FANCE gene for Fanconi anemia, complementation group E, the PPARD gene for peroxisome proliferative activated receptor delta, the MKRNP2 pseudogene (a makorin ring finger protein pseudogene 2) and six CpG islands, complete sequence Length = 170245 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 329 gggatcgagaccagcctgacc 349 ||||||||||||||||||||| Sbjct: 16959 gggatcgagaccagcctgacc 16979
>emb|AL662941.3|OSJN00147 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0074B10, complete sequence Length = 165400 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 atagtgaaggacatttgcgca 94 ||||||||||||||||||||| Sbjct: 133788 atagtgaaggacatttgcgca 133808
>gb|AC073548.5| Homo sapiens chromosome 19 clone RP11-43N16, complete sequence Length = 167722 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 326 ccagggatcgagaccagcctg 346 ||||||||||||||||||||| Sbjct: 61599 ccagggatcgagaccagcctg 61579
>gb|AC110794.3| Homo sapiens BAC clone RP11-598O12 from 4, complete sequence Length = 148841 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 329 gggatcgagaccagcctgacc 349 ||||||||||||||||||||| Sbjct: 38213 gggatcgagaccagcctgacc 38233
>gb|AC021753.7| Homo sapiens chromosome 15 clone RP11-129I12 map 15q15, complete sequence Length = 167996 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 325 tccagggatcgagaccagcctgacc 349 ||||| ||||||||||||||||||| Sbjct: 136232 tccagagatcgagaccagcctgacc 136208
>gb|AC022408.6| Homo sapiens chromosome 15 clone RP11-118J16 map 15q15, complete sequence Length = 150266 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 325 tccagggatcgagaccagcctgacc 349 ||||| ||||||||||||||||||| Sbjct: 68649 tccagagatcgagaccagcctgacc 68625
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 atagtgaaggacatttgcgca 94 ||||||||||||||||||||| Sbjct: 3229349 atagtgaaggacatttgcgca 3229369 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 atagtgaaggacatttgcgca 94 ||||||||||||||||||||| Sbjct: 2816734 atagtgaaggacatttgcgca 2816754
>gb|AC093675.4| Homo sapiens BAC clone RP11-592G13 from 2, complete sequence Length = 123182 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 329 gggatcgagaccagcctgacc 349 ||||||||||||||||||||| Sbjct: 92794 gggatcgagaccagcctgacc 92774
>gb|AC022509.21|AC022509 Homo sapiens 12 BAC RP11-283G6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 204228 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 329 gggatcgagaccagcctgacc 349 ||||||||||||||||||||| Sbjct: 7353 gggatcgagaccagcctgacc 7373
>gb|AC006511.5| Homo sapiens 12 BAC RPCI11-69M1 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 186321 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 329 gggatcgagaccagcctgacc 349 ||||||||||||||||||||| Sbjct: 10970 gggatcgagaccagcctgacc 10990
>dbj|AK102268.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088O08, full insert sequence Length = 2150 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 atagtgaaggacatttgcgca 94 ||||||||||||||||||||| Sbjct: 1476 atagtgaaggacatttgcgca 1496
>gb|BC054601.1| Danio rerio transketolase, mRNA (cDNA clone MGC:64048 IMAGE:6793658), complete cds Length = 3842 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 ttcttcttgtcacagtcttc 378 |||||||||||||||||||| Sbjct: 822 ttcttcttgtcacagtcttc 803
>emb|Z97832.11|HS329A5 Human DNA sequence from clone RP3-329A5 on chromosome 6p21.1-21.33 Contains the gene for a novel EGF-like and CUB domain protein similar to mouse CUB domain EGF-like signal peptide 1 (Scube1) and mouse and human CEGP1, the ZNF76 gene for zinc finger protein 76 (expressed in testis), the DEF6 gene for differentially expressed in FDCP 6 homolog (mouse), a ribosomal protein L35A (RPL35A) pseudogene and three CpG islands, complete sequence Length = 117026 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 tcgagaccagcctgaccttg 352 |||||||||||||||||||| Sbjct: 17809 tcgagaccagcctgaccttg 17790
>emb|AL512326.25| Human DNA sequence from clone RP11-345I18 on chromosome 1 Contains the 5' end of the ABL2 gene for v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene), a ubiquinol-cytochrome c reductase (6.4kD) subunit (UQCR) pseudogene, a pseudogene similar to mouse SET translocation, a eukaryotic translation initiation factor 4A, isoform 1 pseudogene, a UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (B3GALT3) pseudogene, a cytochrome c oxidase subunit Vb (COX5B) pseudogene, the 5' end of the SOAT1 gene for sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1, complete sequence Length = 187270 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 ggatcgagaccagcctgacc 349 |||||||||||||||||||| Sbjct: 167524 ggatcgagaccagcctgacc 167505
>emb|AL158207.15| Human DNA sequence from clone RP11-409K20 on chromosome 9 Contains the TOR1B gene for torsin family 1 member B (torsin B) (DQ1), the DYT1 gene for dystonia 1, torsion (autosomal dominant; torsin A) (DQ2, TOR1A), the gene for hepatocellular carcinoma-associated antigen 59 (HSPC220, LOC51759), the USP20 gene for ubiquitin specific protease 20 (KIAA1003), the 3' end of the FNBP1 gene for formin-binding protein 17 (FBP17), two novel genes, a 60S ribosomal protein L34 (RPL34) pseudogene and four CpG islands, complete sequence Length = 169963 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 127 gcatttcccaagagcaacagccaa 150 ||||| |||||||||||||||||| Sbjct: 18348 gcattgcccaagagcaacagccaa 18325
>emb|AL021391.2|HS102D24 Human DNA sequence from clone RP1-102D24 on chromosome 22, complete sequence Length = 138129 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 323 gttccagggatcgagaccagcctg 346 |||| ||||||||||||||||||| Sbjct: 12137 gttcaagggatcgagaccagcctg 12114
>gb|AC105600.5| Rattus norvegicus 4 BAC CH230-209E1 (Children's Hospital Oakland Research Institute) complete sequence Length = 218874 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 430 tgcaaacagaagcagcattt 449 |||||||||||||||||||| Sbjct: 97549 tgcaaacagaagcagcattt 97568
>emb|AJ421778.1|MMU421778 Macaca mulatta znfl gene (partial), sacm2L gene (partial), htatsf1L gene (partial), ring1 gene, fabgl gene and ke4 gene (partial) Length = 67401 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 tcgagaccagcctgaccttg 352 |||||||||||||||||||| Sbjct: 49241 tcgagaccagcctgaccttg 49222
>dbj|AK124068.1| Homo sapiens cDNA FLJ42074 fis, clone SYNOV2016124 Length = 1767 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 tcgagaccagcctgaccttg 352 |||||||||||||||||||| Sbjct: 1569 tcgagaccagcctgaccttg 1588
>ref|NM_198070.2| Danio rerio transketolase (tkt), mRNA Length = 3842 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 ttcttcttgtcacagtcttc 378 |||||||||||||||||||| Sbjct: 822 ttcttcttgtcacagtcttc 803
>gb|AC097469.2| Homo sapiens BAC clone RP11-55N4 from 4, complete sequence Length = 191883 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 331 gatcgagaccagcctgacct 350 |||||||||||||||||||| Sbjct: 137442 gatcgagaccagcctgacct 137423
>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold Length = 1889755 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 ttcttcttgtcacagtcttc 378 |||||||||||||||||||| Sbjct: 1046493 ttcttcttgtcacagtcttc 1046474
>gb|AC124042.3| Oryctolagus cuniculus clone LB1-56H19, complete sequence Length = 194657 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 ttcttcttgtcacagtcttc 378 |||||||||||||||||||| Sbjct: 43543 ttcttcttgtcacagtcttc 43524
>gb|AY040205.1| Homo sapiens acyl-CoA:cholesterol acyltransferase-1 gene, upstream sequence Length = 10251 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 ggatcgagaccagcctgacc 349 |||||||||||||||||||| Sbjct: 10174 ggatcgagaccagcctgacc 10155
>gb|BC097057.1| Danio rerio cDNA clone IMAGE:7088812 Length = 1111 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 359 ttcttcttgtcacagtcttc 378 |||||||||||||||||||| Sbjct: 715 ttcttcttgtcacagtcttc 696
>gb|AC132477.3| Homo sapiens BAC clone RP11-115H11 from 2, complete sequence Length = 44608 Score = 40.1 bits (20), Expect = 6.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 322 agttccagggatcgagaccagcctgacc 349 |||||||| ||| ||||||||||||||| Sbjct: 31184 agttccagagattgagaccagcctgacc 31211
>emb|BX072582.6| Zebrafish DNA sequence from clone DKEY-222O19 in linkage group 11, complete sequence Length = 194918 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 430 tgcaaacagaagcagcattt 449 |||||||||||||||||||| Sbjct: 16299 tgcaaacagaagcagcattt 16318
>emb|CT030182.8| Mouse DNA sequence from clone RP23-21N15 on chromosome 13, complete sequence Length = 218811 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 354 tcagcttcttcttgtcacagtctt 377 |||||||||||| ||||||||||| Sbjct: 108403 tcagcttcttctggtcacagtctt 108380 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,549,709 Number of Sequences: 3902068 Number of extensions: 4549709 Number of successful extensions: 325133 Number of sequences better than 10.0: 44 Number of HSP's better than 10.0 without gapping: 44 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 324499 Number of HSP's gapped (non-prelim): 634 length of query: 508 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 486 effective length of database: 17,147,199,772 effective search space: 8333539089192 effective search space used: 8333539089192 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
