ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags26k04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_468756.1| Oryza sativa (japonica cultivar-group), mRNA 307 2e-80
2ref|XM_468752.1| Oryza sativa (japonica cultivar-group), mRNA 283 2e-73
3dbj|AK104954.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 2e-73
4dbj|AK099047.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 2e-73
5dbj|AK067470.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 2e-73
6gb|BT016991.1| Zea mays clone EK07D2305A08.c mRNA sequence 258 1e-65
7gb|AY110589.1| Zea mays CL4331_3 mRNA sequence 258 1e-65
8gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome... 226 5e-56
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 226 5e-56
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 226 5e-56
11gb|AY109388.1| Zea mays CL4331_2 mRNA sequence 226 5e-56
12dbj|D29730.1|RICYK44 Oryza sativa mRNA, partial homologous to ri... 127 3e-26
13gb|AY496117.1| Capsicum annuum 40S ribosomal protein S19 mRNA, c... 52 0.002
14gb|AY496133.1| Capsicum annuum 40S ribosomal protein S19 mRNA, c... 52 0.002
15emb|AJ012684.1|CAR012684 Cicer arietinum mRNA for 40S ribosomal ... 48 0.026
16gb|DQ241845.1| Solanum tuberosum clone 186F02 40S ribosomal prot... 48 0.026
17gb|DQ104695.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
18gb|DQ104694.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
19gb|DQ104693.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
20gb|DQ104692.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
21gb|DQ104691.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
22gb|DQ104690.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
23gb|DQ104689.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
24gb|DQ104688.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
25gb|DQ104687.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
26gb|DQ104686.1| Lycopersicon pimpinellifolium 40S ribosomal prote... 46 0.10
27gb|DQ104675.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
28gb|DQ104674.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
29gb|DQ104673.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
30gb|DQ104672.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
31gb|DQ104671.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
32gb|DQ104670.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
33gb|DQ104669.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
34gb|DQ104668.1| Lycopersicon hirsutum 40S ribosomal protein S19 (... 46 0.10
35gb|DQ104667.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
36gb|DQ104666.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
37gb|DQ104665.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
38gb|DQ104664.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
39gb|DQ104663.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
40gb|DQ104662.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
41gb|DQ104661.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
42gb|DQ104660.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
43gb|DQ104659.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
44gb|DQ104658.1| Lycopersicon chilense 40S ribosomal protein S19 (... 46 0.10
45gb|DQ104657.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
46gb|DQ104656.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
47gb|DQ104655.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
48gb|DQ104654.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
49gb|DQ104653.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
50gb|DQ104652.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
51gb|DQ104651.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
52gb|DQ104650.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
53gb|DQ104649.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
54gb|DQ104648.1| Lycopersicon peruvianum 40S ribosomal protein S19... 46 0.10
55gb|DQ104647.1| Solanum ochranthum 40S ribosomal protein S19 (CT1... 46 0.10
56ref|NM_111074.2| Arabidopsis thaliana structural constituent of ... 44 0.40
57gb|AY063012.1| Arabidopsis thaliana putative 40S ribosomal prote... 44 0.40
58gb|AF370277.1| Arabidopsis thaliana putative 40S ribosomal prote... 44 0.40
59emb|BX822422.1|CNS0A71W Arabidopsis thaliana Full-length cDNA Co... 44 0.40
60emb|BX825648.1|CNS0A6BC Arabidopsis thaliana Full-length cDNA Co... 44 0.40
61gb|AY088134.1| Arabidopsis thaliana clone 41619 mRNA, complete s... 44 0.40
62gb|AC149197.13| Medicago truncatula clone mth2-33p18, complete s... 42 1.6
63emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on ch... 42 1.6
64gb|AC148395.12| Medicago truncatula clone mth2-28d22, complete s... 42 1.6
65gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete... 42 1.6
66gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, comple... 42 1.6
67ref|NM_125510.3| Arabidopsis thaliana structural constituent of ... 40 6.3
68ref|XM_535846.2| PREDICTED: Canis familiaris similar to HRAS-lik... 40 6.3
69emb|Z81054.1|CEF01D4 Caenorhabditis elegans Cosmid F01D4, comple... 40 6.3
70gb|BT010524.1| Arabidopsis thaliana At5g61170 gene, complete cds 40 6.3
71emb|AL358134.11| Human DNA sequence from clone RP11-306O13 on ch... 40 6.3
72gb|BC054381.1| Mus musculus cDNA clone IMAGE:6468809, partial cds 40 6.3
73gb|AC092999.3| Homo sapiens 3 BAC RP11-170K4 (Roswell Park Cance... 40 6.3
74emb|BX784026.17| Zebrafish DNA sequence from clone CH211-66P13 i... 40 6.3
75dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
76dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
77emb|BX832341.1|CNS09ZKD Arabidopsis thaliana Full-length cDNA Co... 40 6.3
78emb|BX664619.13| Mouse DNA sequence from clone RP23-349B9 on chr... 40 6.3
79dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
80dbj|AK175989.1| Arabidopsis thaliana mRNA for 40S ribosomal prot... 40 6.3
81dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
82dbj|AP006848.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
83dbj|AB006696.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 6.3
84gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, com... 40 6.3
85gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome... 40 6.3
86emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chrom... 40 6.3
87gb|DQ104685.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
88gb|DQ104684.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
89gb|DQ104683.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
90gb|DQ104682.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
91gb|DQ104681.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
92gb|DQ104680.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
93gb|DQ104679.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
94gb|DQ104678.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
95gb|DQ104677.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
96gb|DQ104676.1| Lycopersicon chmielewskii 40S ribosomal protein S... 40 6.3
97emb|AL808017.4| Mouse DNA sequence from clone RP23-145G21 on chr... 40 6.3
98gb|M20244.1|CELMEC3 C.elegans mec-3 gene encoding differentiatio... 40 6.3 
>ref|XM_468756.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 635

 Score =  307 bits (155), Expect = 2e-80
 Identities = 220/242 (90%)
 Strand = Plus / Minus

                                                                       
Query: 224 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 283
           ||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 460 tggtccagatcacgccttccctgggaggtgatgagtcttccacccttcgggtcgacatca 401

                                                                       
Query: 284 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 343
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 400 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 341

                                                                       
Query: 344 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 403
           |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| |||
Sbjct: 340 cagaagtgcggggggcgtgagccgttcctctggcggccaccatagatcttctggaagcca 281

                                                                       
Query: 404 ccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcagccctgatgtag 463
           || |  ||||| |||||||| ||||||||||||||||| ||||||||||||||  |||||
Sbjct: 280 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 221

             
Query: 464 ta 465
           ||
Sbjct: 220 ta 219
to top
>ref|XM_468752.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 829

 Score =  283 bits (143), Expect = 2e-73
 Identities = 217/242 (89%)
 Strand = Plus / Minus

                                                                       
Query: 224 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 283
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 483 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 424

                                                                       
Query: 284 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 343
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 423 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 364

                                                                       
Query: 344 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 403
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 363 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 304

                                                                       
Query: 404 ccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcagccctgatgtag 463
           || |  ||||| |||||||| ||||||||||||||||| ||||||||||||||  |||||
Sbjct: 303 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 244

             
Query: 464 ta 465
           ||
Sbjct: 243 ta 242
to top
>dbj|AK104954.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-G11, full
           insert sequence
          Length = 786

 Score =  283 bits (143), Expect = 2e-73
 Identities = 217/242 (89%)
 Strand = Plus / Minus

                                                                       
Query: 224 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 283
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 491 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 432

                                                                       
Query: 284 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 343
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 431 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 372

                                                                       
Query: 344 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 403
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 371 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 312

                                                                       
Query: 404 ccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcagccctgatgtag 463
           || |  ||||| |||||||| ||||||||||||||||| ||||||||||||||  |||||
Sbjct: 311 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 252

             
Query: 464 ta 465
           ||
Sbjct: 251 ta 250
to top
>dbj|AK099047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013147E16, full
           insert sequence
          Length = 937

 Score =  283 bits (143), Expect = 2e-73
 Identities = 217/242 (89%)
 Strand = Plus / Minus

                                                                       
Query: 224 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 283
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 492 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 433

                                                                       
Query: 284 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 343
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 432 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 373

                                                                       
Query: 344 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 403
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 372 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 313

                                                                       
Query: 404 ccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcagccctgatgtag 463
           || |  ||||| |||||||| ||||||||||||||||| ||||||||||||||  |||||
Sbjct: 312 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 253

             
Query: 464 ta 465
           ||
Sbjct: 252 ta 251
to top
>dbj|AK067470.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106H18, full
           insert sequence
          Length = 862

 Score =  283 bits (143), Expect = 2e-73
 Identities = 217/242 (89%)
 Strand = Plus / Minus

                                                                       
Query: 224 tggtcaagatcacgccttccctgggaggtgatgagccttccacccttggggtcgacatca 283
           ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 494 tggtccagatcacgccttccctgggaggtgatgagtcttccgcccttggggtcgacatcg 435

                                                                       
Query: 284 atgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttg 343
           ||||||||||||||||||| || ||||||||||||||| || | ||| || |||||||||
Sbjct: 434 atgatgcccatcttctgcagctgctgaaggatgttgcgtgagatagcgccgctgctcttg 375

                                                                       
Query: 344 cagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatcttctggaatcca 403
           |||||||| ||||| ||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 374 cagaagtgcgggggacgtgagccattcctctggcggccaccatagatcttctggaagcca 315

                                                                       
Query: 404 ccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcagccctgatgtag 463
           || |  ||||| |||||||| ||||||||||||||||| ||||||||||||||  |||||
Sbjct: 314 cctacaccaataccctgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtag 255

             
Query: 464 ta 465
           ||
Sbjct: 254 ta 253
to top
>gb|BT016991.1| Zea mays clone EK07D2305A08.c mRNA sequence
          Length = 737

 Score =  258 bits (130), Expect = 1e-65
 Identities = 222/253 (87%)
 Strand = Plus / Minus

                                                                       
Query: 213 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 272
           ||||||| |||||||| ||||||||||||||||||||||||| | ||| |||||||||||
Sbjct: 488 ttccagccacctggtccagatcacgccttccctgggaggtgaggcgccgtccacccttgg 429

                                                                       
Query: 273 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 332
           | |||||||||||||||||||||| ||||| || ||| ||||||||||| ||||  ||||
Sbjct: 428 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 369

                                                                       
Query: 333 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 392
           ||||||||||||||||||| || |||||||| || |||||||| ||||||||||| ||||
Sbjct: 368 cactgctcttgcagaagtgaggtgggcgtgagccattcctctggcggccaccataaatct 309

                                                                       
Query: 393 tctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcag 452
           ||||||| |||||||  ||||| || || || | ||||||||||||||| |  || ||||
Sbjct: 308 tctggaagccaccaacaccaatgccttgtctcaagtagatcttccttgctacagatgcag 249

                        
Query: 453 ccctgatgtagta 465
           |||||||||||||
Sbjct: 248 ccctgatgtagta 236
to top
>gb|AY110589.1| Zea mays CL4331_3 mRNA sequence
          Length = 860

 Score =  258 bits (130), Expect = 1e-65
 Identities = 222/253 (87%)
 Strand = Plus / Plus

                                                                       
Query: 213 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 272
           ||||||| |||||||| ||||||||||||||||||||||||||| ||| |||||||||||
Sbjct: 387 ttccagccacctggtccagatcacgccttccctgggaggtgatgcgccgtccacccttgg 446

                                                                       
Query: 273 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 332
           | |||||||||||||||||||||| ||||| || ||| ||||||||||| ||||  ||||
Sbjct: 447 gatcgacatcaatgatgcccatctcctgcagctgctggaggatgttgcgtgaaatggcac 506

                                                                       
Query: 333 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 392
           ||||||||||||||||||| || ||||| || || |||||||| ||||||||||| ||||
Sbjct: 507 cactgctcttgcagaagtgaggtgggcgggagccattcctctggcggccaccataaatct 566

                                                                       
Query: 393 tctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcag 452
           ||||||| |||||||  ||||| || || || | ||||||||||||||| |  || ||||
Sbjct: 567 tctggaagccaccaacaccaatgccttgtctcaagtagatcttccttgctacagatgcag 626

                        
Query: 453 ccctgatgtagta 465
           |||||||||||||
Sbjct: 627 ccctgatgtagta 639
to top
>gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0032H19
             map E30331S, complete sequence
          Length = 164820

 Score =  226 bits (114), Expect = 5e-56
 Identities = 167/185 (90%)
 Strand = Plus / Plus

                                                                         
Query: 266   cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 325
             ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 23077 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 23136

                                                                         
Query: 326   acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 385
             | ||| || ||||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 23137 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 23196

                                                                         
Query: 386   tagatcttctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatc 445
             |||||||||||||| ||||| |  ||||| |||||||| ||||||||||||||||| |||
Sbjct: 23197 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 23256

                  
Query: 446   gaggc 450
             |||||
Sbjct: 23257 gaggc 23261



 Score =  210 bits (106), Expect = 3e-51
 Identities = 165/185 (89%)
 Strand = Plus / Plus

                                                                         
Query: 266   cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 325
             ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 35214 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 35273

                                                                         
Query: 326   acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 385
             | ||| || ||||||||||||||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 35274 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 35333

                                                                         
Query: 386   tagatcttctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatc 445
             |||||||||||||| ||||| |  ||||| |||||||| ||||||||||||||||| |||
Sbjct: 35334 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 35393

                  
Query: 446   gaggc 450
             |||||
Sbjct: 35394 gaggc 35398



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                        
Query: 224   tggtcaagatcacgccttccctgggaggtgatgagccttccac 266
             ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 22951 tggtccagatcacgccttccctgggaggtgatgagtcttccac 22993



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                      
Query: 224   tggtcaagatcacgccttccctgggaggtgatgagccttcc 264
             ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 35094 tggtccagatcacgccttccctgggaggtgatgagtcttcc 35134
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  226 bits (114), Expect = 5e-56
 Identities = 167/185 (90%)
 Strand = Plus / Minus

                                                                            
Query: 266      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 325
                ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17540666 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17540607

                                                                            
Query: 326      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 385
                | ||| || ||||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 17540606 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 17540547

                                                                            
Query: 386      tagatcttctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatc 445
                |||||||||||||| ||||| |  ||||| |||||||| ||||||||||||||||| |||
Sbjct: 17540546 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17540487

                     
Query: 446      gaggc 450
                |||||
Sbjct: 17540486 gaggc 17540482



 Score =  210 bits (106), Expect = 3e-51
 Identities = 165/185 (89%)
 Strand = Plus / Minus

                                                                            
Query: 266      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 325
                ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17528529 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17528470

                                                                            
Query: 326      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 385
                | ||| || ||||||||||||||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 17528469 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 17528410

                                                                            
Query: 386      tagatcttctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatc 445
                |||||||||||||| ||||| |  ||||| |||||||| ||||||||||||||||| |||
Sbjct: 17528409 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17528350

                     
Query: 446      gaggc 450
                |||||
Sbjct: 17528349 gaggc 17528345



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                           
Query: 224      tggtcaagatcacgccttccctgggaggtgatgagccttccac 266
                ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 17540792 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17540750



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 224      tggtcaagatcacgccttccctgggaggtgatgagccttcc 264
                ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 17528649 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17528609
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  226 bits (114), Expect = 5e-56
 Identities = 167/185 (90%)
 Strand = Plus / Minus

                                                                            
Query: 266      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 325
                ||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17534207 cccttcgggtcgacatcaatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17534148

                                                                            
Query: 326      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 385
                | ||| || ||||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 17534147 atagcgccgctgctcttgcagaagtgcggggggcgtgagccgttcctctggcggccacca 17534088

                                                                            
Query: 386      tagatcttctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatc 445
                |||||||||||||| ||||| |  ||||| |||||||| ||||||||||||||||| |||
Sbjct: 17534087 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17534028

                     
Query: 446      gaggc 450
                |||||
Sbjct: 17534027 gaggc 17534023



 Score =  210 bits (106), Expect = 3e-51
 Identities = 165/185 (89%)
 Strand = Plus / Minus

                                                                            
Query: 266      cccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaa 325
                ||||||||||||||||| ||||||||||||||||||| || ||||||||||||||| || 
Sbjct: 17522070 cccttggggtcgacatcgatgatgcccatcttctgcagctgctgaaggatgttgcgtgag 17522011

                                                                            
Query: 326      acagcaccactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccacca 385
                | ||| || ||||||||||||||||| ||||| ||||| || |||||||| |||||||||
Sbjct: 17522010 atagcgccgctgctcttgcagaagtgcgggggacgtgagccattcctctggcggccacca 17521951

                                                                            
Query: 386      tagatcttctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatc 445
                |||||||||||||| ||||| |  ||||| |||||||| ||||||||||||||||| |||
Sbjct: 17521950 tagatcttctggaagccacctacaccaataccctgcctcaggtagatcttccttgcaatc 17521891

                     
Query: 446      gaggc 450
                |||||
Sbjct: 17521890 gaggc 17521886



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                           
Query: 224      tggtcaagatcacgccttccctgggaggtgatgagccttccac 266
                ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 17534333 tggtccagatcacgccttccctgggaggtgatgagtcttccac 17534291



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 224      tggtcaagatcacgccttccctgggaggtgatgagccttcc 264
                ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 17522190 tggtccagatcacgccttccctgggaggtgatgagtcttcc 17522150
to top
>gb|AY109388.1| Zea mays CL4331_2 mRNA sequence
          Length = 1008

 Score =  226 bits (114), Expect = 5e-56
 Identities = 218/253 (86%)
 Strand = Plus / Plus

                                                                       
Query: 213 ttccagcaacctggtcaagatcacgccttccctgggaggtgatgagccttccacccttgg 272
           ||||||| || ||||| ||||||||||||||||||  ||||||||| | |||||||||||
Sbjct: 223 ttccagccacttggtccagatcacgccttccctggttggtgatgaggcgtccacccttgg 282

                                                                       
Query: 273 ggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcac 332
           | |||||||| |||||||||||  |||||| || ||| ||||||||||| ||||  ||||
Sbjct: 283 gatcgacatcgatgatgcccataatctgcagctgctgcaggatgttgcgtgaaatggcac 342

                                                                       
Query: 333 cactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagatct 392
           |||||||||||||||||||||| ||||| || || |||||||| |||||||| |||||||
Sbjct: 343 cactgctcttgcagaagtgtggtgggcgggagccattcctctggcggccaccgtagatct 402

                                                                       
Query: 393 tctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatcgaggcag 452
           |||| || ||||| |  || || || ||||| ||||||||||||||||| || || ||||
Sbjct: 403 tctgaaagccacccacaccgatgccttgccttaggtagatcttccttgcaatggatgcag 462

                        
Query: 453 ccctgatgtagta 465
           |||||||||||||
Sbjct: 463 ccctgatgtagta 475
to top
>dbj|D29730.1|RICYK44 Oryza sativa mRNA, partial homologous to ribosomal protein S19 gene
          Length = 314

 Score =  127 bits (64), Expect = 3e-26
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                       
Query: 359 cgtgaaccgttcctctgacggccaccatagatcttctggaatccaccaatcccaattccc 418
           ||||| ||||||||||| ||||||||||||||||||||||| ||||| |  ||||| |||
Sbjct: 314 cgtgagccgttcctctggcggccaccatagatcttctggaagccacctacaccaataccc 255

                                                          
Query: 419 tgcctnaggtagatcttccttgccatcgaggcagccctgatgtagta 465
           ||||| ||||||||||||||||| ||||||||||||||  |||||||
Sbjct: 254 tgcctcaggtagatcttccttgcaatcgaggcagccctcgtgtagta 208
to top
>gb|AY496117.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete sequence
          Length = 672

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 318
           ||||||||||||||| || |  || ||||||  |||  |||||| || ||||||||||| 
Sbjct: 417 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 358

                                         
Query: 319 gcgggaaacagcaccactgctcttgcagaa 348
           ||| | ||| | ||||||||||||||||||
Sbjct: 357 gcgtgcaactgaaccactgctcttgcagaa 328
to top
>gb|AY496133.1| Capsicum annuum 40S ribosomal protein S19 mRNA, complete cds
          Length = 398

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 ccttccacccttggggtcgacatcaatgatgcccatcttctgcaactcctgaaggatgtt 318
           ||||||||||||||| || |  || ||||||  |||  |||||| || ||||||||||| 
Sbjct: 119 ccttccacccttgggttcaaagtcgatgatgttcatggtctgcagctgctgaaggatgtg 60

                                         
Query: 319 gcgggaaacagcaccactgctcttgcagaa 348
           ||| | ||| | ||||||||||||||||||
Sbjct: 59  gcgtgcaactgaaccactgctcttgcagaa 30
to top
>emb|AJ012684.1|CAR012684 Cicer arietinum mRNA for 40S ribosomal protein S19, partial
          Length = 550

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 98/123 (79%)
 Strand = Plus / Minus

                                                                       
Query: 331 accactgctcttgcagaagtgtggggggcgtgaaccgttcctctgacggccaccatagat 390
           |||||||||||||||||| || || || ||   |||||||||||| |  |||||||| ||
Sbjct: 181 accactgctcttgcagaaatgaggtggccgactaccgttcctctggctcccaccataaat 122

                                                                       
Query: 391 cttctggaatccaccaatcccaattccctgcctnaggtagatcttccttgccatcgaggc 450
           | |||||||  ||||||  |||| |||   ||| | ||||||||| |||||||| || ||
Sbjct: 121 cctctggaaagcaccaacaccaagtcctcccctcaagtagatctttcttgccattgaagc 62

              
Query: 451 agc 453
           |||
Sbjct: 61  agc 59
to top
>gb|DQ241845.1| Solanum tuberosum clone 186F02 40S ribosomal protein S19-like mRNA,
           complete cds
          Length = 759

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 297 tctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaa 348
           ||||||| | ||||||||||| ||| | ||| | ||||||||||||||||||
Sbjct: 380 tctgcaattgctgaaggatgtggcgtgcaactgaaccactgctcttgcagaa 329



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 428 tagatcttccttgccatcgaggcagccctgatgtagta 465
           |||||||| || ||||| ||||| ||||||||||||||
Sbjct: 249 tagatctttctggccatagaggctgccctgatgtagta 212
to top
>gb|DQ104695.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7277b allele, partial cds
          Length = 1409

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104694.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7277a allele, partial cds
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 716 ttgcaaaagtg 706
to top
>gb|DQ104693.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7276b allele, partial cds
          Length = 1411

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 777 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 718

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 717 ttgcaaaagtg 707
to top
>gb|DQ104692.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7276a allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104691.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7275b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104690.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7275a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104689.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7274b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104688.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7274a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104687.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7272b allele, partial cds
          Length = 1412

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104686.1| Lycopersicon pimpinellifolium 40S ribosomal protein S19 (CT189)
           gene, CT189-7272a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104675.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7223b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104674.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7223a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104673.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7219b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104672.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7219a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104671.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7216b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104670.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7216a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104669.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7215b allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104668.1| Lycopersicon hirsutum 40S ribosomal protein S19 (CT189) gene,
           CT189-7215a allele, partial cds
          Length = 1398

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104667.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7184b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104666.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7184a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104665.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7183b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104664.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7183a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104663.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7180b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104662.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7180a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104661.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7179b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104660.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7179a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104659.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7177b allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104658.1| Lycopersicon chilense 40S ribosomal protein S19 (CT189) gene,
           CT189-7177a allele, partial cds
          Length = 1413

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 778 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 719

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 718 ttgcaaaagtg 708
to top
>gb|DQ104657.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7236b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104656.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7236a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104655.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7235b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104654.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7235a allele, partial cds
          Length = 1411

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 781 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 722

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 721 ttgcaaaagtg 711
to top
>gb|DQ104653.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7234b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104652.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7234a allele, partial cds
          Length = 1402

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 779 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 720

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 719 ttgcaaaagtg 709
to top
>gb|DQ104651.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7233b allele, partial cds
          Length = 1410

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104650.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7233a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104649.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7232b allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104648.1| Lycopersicon peruvianum 40S ribosomal protein S19 (CT189) gene,
           CT189-7232a allele, partial cds
          Length = 1408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 775 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 716

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 715 ttgcaaaagtg 705
to top
>gb|DQ104647.1| Solanum ochranthum 40S ribosomal protein S19 (CT189) gene, partial
           cds
          Length = 1543

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcaatgatgcccatcttctgcaactcctgaaggatgttgcgggaaacagcaccactgctc 340
           |||||||||  ||| ||||||||||  ||||| |||| ||| | ||| | ||||||||||
Sbjct: 776 tcaatgatgttcatgttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctc 717

                      
Query: 341 ttgcagaagtg 351
           ||||| |||||
Sbjct: 716 ttgcaaaagtg 706
to top
>ref|NM_111074.2| Arabidopsis thaliana structural constituent of ribosome AT3G02080
           mRNA, complete cds
          Length = 746

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 421 cctnaggtagatcttccttgccatcgaggcagccctgatgtagta 465
           ||| ||||| | |||||||||||| || ||||| |||||||||||
Sbjct: 291 cctcaggtaaaccttccttgccatagatgcagctctgatgtagta 247
to top
>gb|AY063012.1| Arabidopsis thaliana putative 40S ribosomal protein S19 (At3g02080)
           mRNA, complete cds
          Length = 463

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 421 cctnaggtagatcttccttgccatcgaggcagccctgatgtagta 465
           ||| ||||| | |||||||||||| || ||||| |||||||||||
Sbjct: 204 cctcaggtaaaccttccttgccatagatgcagctctgatgtagta 160
to top
>gb|AF370277.1| Arabidopsis thaliana putative 40S ribosomal protein S19 (At3g02080)
           mRNA, complete cds
          Length = 670

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 421 cctnaggtagatcttccttgccatcgaggcagccctgatgtagta 465
           ||| ||||| | |||||||||||| || ||||| |||||||||||
Sbjct: 287 cctcaggtaaaccttccttgccatagatgcagctctgatgtagta 243
to top
>emb|BX822422.1|CNS0A71W Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB36ZG05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 649

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 421 cctnaggtagatcttccttgccatcgaggcagccctgatgtagta 465
           ||| ||||| | |||||||||||| || ||||| |||||||||||
Sbjct: 283 cctcaggtaaaccttccttgccatagatgcagctctgatgtagta 239
to top
>emb|BX825648.1|CNS0A6BC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL53ZD11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 641

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 421 cctnaggtagatcttccttgccatcgaggcagccctgatgtagta 465
           ||| ||||| | |||||||||||| || ||||| |||||||||||
Sbjct: 273 cctcaggtaaaccttccttgccatagatgcagctctgatgtagta 229
to top
>gb|AY088134.1| Arabidopsis thaliana clone 41619 mRNA, complete sequence
          Length = 694

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 421 cctnaggtagatcttccttgccatcgaggcagccctgatgtagta 465
           ||| ||||| | |||||||||||| || ||||| |||||||||||
Sbjct: 291 cctcaggtaaaccttccttgccatagatgcagctctgatgtagta 247
to top
>gb|AC149197.13| Medicago truncatula clone mth2-33p18, complete sequence
          Length = 115362

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 328   agcaccactgctcttgcagaa 348
             |||||||||||||||||||||
Sbjct: 53651 agcaccactgctcttgcagaa 53671
to top
>emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on chromosome 20 Contains the
             PPIP11 gene for peptidylprolyl isomerase (cyclophilin)
             pseudogene 11 and a CpG island, complete sequence
          Length = 81304

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 129   ataattcaaaactgtagccaa 149
             |||||||||||||||||||||
Sbjct: 34162 ataattcaaaactgtagccaa 34142
to top
>gb|AC148395.12| Medicago truncatula clone mth2-28d22, complete sequence
          Length = 116174

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 328   agcaccactgctcttgcagaa 348
             |||||||||||||||||||||
Sbjct: 62524 agcaccactgctcttgcagaa 62504
to top
>gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete sequence
          Length = 184471

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 38     taattaaaaactcagacaatt 58
              |||||||||||||||||||||
Sbjct: 160083 taattaaaaactcagacaatt 160063
to top
>gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, complete sequence
          Length = 172705

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 334  actgctcttgcagaagtgtgg 354
            |||||||||||||||||||||
Sbjct: 2468 actgctcttgcagaagtgtgg 2488
to top
>ref|NM_125510.3| Arabidopsis thaliana structural constituent of ribosome AT5G61170
           mRNA, complete cds
          Length = 645

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 aacagcaccactgctcttgcagaa 348
           |||| |||||||||||||||||||
Sbjct: 359 aacaccaccactgctcttgcagaa 336
to top
>ref|XM_535846.2| PREDICTED: Canis familiaris similar to HRAS-like suppressor
           (LOC478677), mRNA
          Length = 694

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 299 tgcaactcctgaaggatgttgcgggaaa 326
           ||||||| ||||||||||||| ||||||
Sbjct: 244 tgcaactgctgaaggatgttgtgggaaa 271
to top
>emb|Z81054.1|CEF01D4 Caenorhabditis elegans Cosmid F01D4, complete sequence
          Length = 37845

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 32   gcagtataattaaaaactca 51
            ||||||||||||||||||||
Sbjct: 6324 gcagtataattaaaaactca 6343
to top
>gb|BT010524.1| Arabidopsis thaliana At5g61170 gene, complete cds
          Length = 432

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 aacagcaccactgctcttgcagaa 348
           |||| |||||||||||||||||||
Sbjct: 300 aacaccaccactgctcttgcagaa 277
to top
>emb|AL358134.11| Human DNA sequence from clone RP11-306O13 on chromosome 6, complete
             sequence
          Length = 144828

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    ttaaaaactcagacaattaa 60
             ||||||||||||||||||||
Sbjct: 46411 ttaaaaactcagacaattaa 46430
to top
>gb|BC054381.1| Mus musculus cDNA clone IMAGE:6468809, partial cds
          Length = 7392

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 328  agcaccactgctcttgcaga 347
            ||||||||||||||||||||
Sbjct: 2817 agcaccactgctcttgcaga 2798
to top
>gb|AC092999.3| Homo sapiens 3 BAC RP11-170K4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 167084

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     taaaaactcagacaattaac 61
              ||||||||||||||||||||
Sbjct: 126331 taaaaactcagacaattaac 126350
to top
>emb|BX784026.17| Zebrafish DNA sequence from clone CH211-66P13 in linkage group 3,
              complete sequence
          Length = 162371

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     gcagtataattaaaaactca 51
              ||||||||||||||||||||
Sbjct: 138962 gcagtataattaaaaactca 138943
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 105      cataacaaacacagggaggg 124
                ||||||||||||||||||||
Sbjct: 28400536 cataacaaacacagggaggg 28400555
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 330     caccactgctcttgcagaag 349
               ||||||||||||||||||||
Sbjct: 3306778 caccactgctcttgcagaag 3306759
to top
>emb|BX832341.1|CNS09ZKD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH66ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 645

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 aacagcaccactgctcttgcagaa 348
           |||| |||||||||||||||||||
Sbjct: 359 aacaccaccactgctcttgcagaa 336
to top
>emb|BX664619.13| Mouse DNA sequence from clone RP23-349B9 on chromosome 11, complete
             sequence
          Length = 154608

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   cataacaaacacagggaggg 124
             ||||||||||||||||||||
Sbjct: 27471 cataacaaacacagggaggg 27452
to top
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0015I14
          Length = 150650

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 330   caccactgctcttgcagaag 349
             ||||||||||||||||||||
Sbjct: 94141 caccactgctcttgcagaag 94122
to top
>dbj|AK175989.1| Arabidopsis thaliana mRNA for 40S ribosomal protein S19 - like,
           complete cds, clone: RAFL22-68-D20
          Length = 737

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 aacagcaccactgctcttgcagaa 348
           |||| |||||||||||||||||||
Sbjct: 370 aacaccaccactgctcttgcagaa 347
to top
>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0044E16
          Length = 153296

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    cataacaaacacagggaggg 124
              ||||||||||||||||||||
Sbjct: 129342 cataacaaacacagggaggg 129361
to top
>dbj|AP006848.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
            fosmid clone:OSJNOa199K18
          Length = 39582

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 105  cataacaaacacagggaggg 124
            ||||||||||||||||||||
Sbjct: 5338 cataacaaacacagggaggg 5357
to top
>dbj|AB006696.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19
          Length = 78379

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 325   aacagcaccactgctcttgcagaa 348
             |||| |||||||||||||||||||
Sbjct: 60721 aacaccaccactgctcttgcagaa 60698
to top
>gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, complete sequence
          Length = 196053

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    ccctgggaggtgatgagcct 261
              ||||||||||||||||||||
Sbjct: 127161 ccctgggaggtgatgagcct 127180
to top
>gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome 17, complete sequence
          Length = 213263

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   agcaccactgctcttgcaga 347
             ||||||||||||||||||||
Sbjct: 85787 agcaccactgctcttgcaga 85768
to top
>emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chromosome 16, complete
              sequence
          Length = 257276

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 328    agcaccactgctcttgcaga 347
              ||||||||||||||||||||
Sbjct: 168365 agcaccactgctcttgcaga 168384
to top
>gb|DQ104685.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7206b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104684.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7206a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104683.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7205b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104682.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7205a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104681.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7204b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104680.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7204a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104679.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7203b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104678.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7203a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104677.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7201b allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>gb|DQ104676.1| Lycopersicon chmielewskii 40S ribosomal protein S19 (CT189) gene,
           CT189-7201a allele, partial cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 296 ttctgcaactcctgaaggatgttgcgggaaacagcaccactgctcttgcagaagtg 351
           ||||||||||  ||||| |||| ||| | ||| | ||||||||||||||| |||||
Sbjct: 763 ttctgcaactgttgaagaatgtggcgtgcaactgaaccactgctcttgcaaaagtg 708
to top
>emb|AL808017.4| Mouse DNA sequence from clone RP23-145G21 on chromosome X, complete
              sequence
          Length = 183291

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     ttaaaaactcagacaattaa 60
              ||||||||||||||||||||
Sbjct: 165612 ttaaaaactcagacaattaa 165631
to top
>gb|M20244.1|CELMEC3 C.elegans mec-3 gene encoding differentiation of the six touch
            receptor neurons, complete cds
          Length = 5660

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 32   gcagtataattaaaaactca 51
            ||||||||||||||||||||
Sbjct: 5610 gcagtataattaaaaactca 5591


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,997,873
Number of Sequences: 3902068
Number of extensions: 3997873
Number of successful extensions: 78787
Number of sequences better than 10.0: 98
Number of HSP's better than 10.0 without gapping: 97
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 78528
Number of HSP's gapped (non-prelim): 257
length of query: 465
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 443
effective length of database: 17,147,199,772
effective search space: 7596209498996
effective search space used: 7596209498996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top