>emb|AL662982.3|OSJN00184 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0083I11,
              complete sequence
          Length = 149085

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/44 (95%), Gaps = 1/44 (2%)
 Strand = Plus / Minus

                                                          
Query: 482    actgaacatttgcagacagcagtcagttcctaatgtacatgtca 525
              |||||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 125169 actgaacatttgcagaca-cagtcagttcctaatgtacaggtca 125127

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/44 (95%), Gaps = 1/44 (2%)
 Strand = Plus / Minus

                                                           
Query: 482     actgaacatttgcagacagcagtcagttcctaatgtacatgtca 525
               |||||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 7478816 actgaacatttgcagaca-cagtcagttcctaatgtacaggtca 7478774

>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22,
            complete sequence
          Length = 181498

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/44 (95%), Gaps = 1/44 (2%)
 Strand = Plus / Minus

                                                        
Query: 482  actgaacatttgcagacagcagtcagttcctaatgtacatgtca 525
            |||||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 1289 actgaacatttgcagaca-cagtcagttcctaatgtacaggtca 1247

>gb|AY112431.1| Zea mays CL7452_1 mRNA sequence
          Length = 610

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 477 ccaccactgaacatttgcagacagcagtcagttcctaatgtaca 520
           |||||| |||||||||  |||||  |||||||||||||||||||
Sbjct: 531 ccaccattgaacatttatagacatgagtcagttcctaatgtaca 574

>gb|AC155898.15| Medicago truncatula clone mth2-109f1, complete sequence
          Length = 93173

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 439   cagtgatgtctttgataactt 459
             |||||||||||||||||||||
Sbjct: 28871 cagtgatgtctttgataactt 28851

>emb|AL627088.7| Zebrafish DNA sequence from clone RP71-1D6 in linkage group 18 Contains
             a CpG island, complete sequence
          Length = 151446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 455   aacttcacatttaccatatttacca 479
             ||||||| |||||||||||||||||
Sbjct: 72848 aacttcaaatttaccatatttacca 72872

>gb|AC124127.12| Mus musculus chromosome 19, clone RP23-150N4, complete sequence
          Length = 194548

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 453    ataacttcacatttaccatattta 476
              ||||||||| ||||||||||||||
Sbjct: 118442 ataacttcatatttaccatattta 118419

>gb|AC010124.6| Drosophila melanogaster clone BACR06O03, complete sequence
          Length = 193483

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 360   acgtagtaattcattgccat 379
             ||||||||||||||||||||
Sbjct: 52910 acgtagtaattcattgccat 52929

>gb|AC166167.2| Mus musculus BAC clone RP23-211D22 from chromosome 13, complete
             sequence
          Length = 200448

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 129   aagaatgggccgtgctgccg 148
             ||||||||||||||||||||
Sbjct: 29039 aagaatgggccgtgctgccg 29058

>emb|CR388412.9| Zebrafish DNA sequence from clone CH211-69G13 in linkage group 5,
             complete sequence
          Length = 158289

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 415   tacctgcttaggattttatgccaa 438
             |||||||| |||||||||||||||
Sbjct: 63591 tacctgctgaggattttatgccaa 63568

>emb|CR394556.10| Zebrafish DNA sequence from clone DKEY-79P17 in linkage group 9,
             complete sequence
          Length = 136863

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   ccaacatctaaccaatatca 206
             ||||||||||||||||||||
Sbjct: 68434 ccaacatctaaccaatatca 68453

>gb|AC126263.4| Mus musculus BAC clone RP23-359P12 from chromosome 8, complete sequence
          Length = 223991

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 483    ctgaacatttgcagacagca 502
              ||||||||||||||||||||
Sbjct: 146450 ctgaacatttgcagacagca 146431

>gb|AC105950.11| Mus musculus chromosome 12, clone RP24-386J17, complete sequence
          Length = 192207

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 506    agttcctaatgtacatgtca 525
              ||||||||||||||||||||
Sbjct: 176631 agttcctaatgtacatgtca 176650

>gb|AC163993.3| Mus musculus chromosome 19, clone RP24-78O14, complete sequence
          Length = 177411

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 453   ataacttcacatttaccatattta 476
             ||||||||| ||||||||||||||
Sbjct: 85761 ataacttcatatttaccatattta 85784

>gb|AC159210.2| Mus musculus BAC clone RP23-54F9 from chromosome 13, complete sequence
          Length = 228429

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 129    aagaatgggccgtgctgccg 148
              ||||||||||||||||||||
Sbjct: 112372 aagaatgggccgtgctgccg 112353

>ref|NM_141705.1| Drosophila melanogaster CG12419-RA (CG12419), mRNA
          Length = 396

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 360 acgtagtaattcattgccat 379
           ||||||||||||||||||||
Sbjct: 275 acgtagtaattcattgccat 256

>dbj|AK144138.1| Mus musculus kidney CCL-142 RAG cDNA, RIKEN full-length enriched
            library, clone:G430034I10 product:Hypothetical G-protein
            beta WD-40 repeats containing protein, full insert
            sequence
          Length = 3724

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 506  agttcctaatgtacatgtca 525
            ||||||||||||||||||||
Sbjct: 1556 agttcctaatgtacatgtca 1537

>gb|AC087821.5| Homo sapiens chromosome 8, clone RP11-108A14, complete sequence
          Length = 167949

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 46     acaggaacaagatacaatcg 65
              ||||||||||||||||||||
Sbjct: 119483 acaggaacaagatacaatcg 119464

>gb|AC022839.8| Homo sapiens, clone RP11-191D5, complete sequence
          Length = 158004

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     caattacttattactgcact 21
             ||||||||||||||||||||
Sbjct: 83456 caattacttattactgcact 83437

>dbj|AK052482.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched
            library, clone:D430033N04 product:hypothetical G-protein
            beta WD-40 repeats containing protein, full insert
            sequence
          Length = 3181

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 506  agttcctaatgtacatgtca 525
            ||||||||||||||||||||
Sbjct: 1520 agttcctaatgtacatgtca 1501

>gb|AC005476.4|AC005476 Homo sapiens PAC clone RP1-261D10 from 14q24.3, complete sequence
          Length = 107731

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 160   caggttccttctatggctcctctatacc 187
             |||||||||||| |||||||||| ||||
Sbjct: 73780 caggttccttctgtggctcctctttacc 73753

>gb|AC009183.5|AC009183 Drosophila melanogaster, chromosome 3R, region 85F-85F, BAC clone
            BACR39F04, complete sequence
          Length = 192055

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 360  acgtagtaattcattgccat 379
            ||||||||||||||||||||
Sbjct: 3488 acgtagtaattcattgccat 3469

>gb|AC079988.6| Homo sapiens BAC clone RP11-795C1 from 2, complete sequence
          Length = 211305

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 470    atatttaccaccactgaaca 489
              ||||||||||||||||||||
Sbjct: 207064 atatttaccaccactgaaca 207083

>gb|AC104832.8| Mus Musculus Strain C57BL6/J Chromosome 12 BAC, RP23-38P6, complete
              sequence
          Length = 179216

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 506    agttcctaatgtacatgtca 525
              ||||||||||||||||||||
Sbjct: 108133 agttcctaatgtacatgtca 108152

>gb|AC067904.14| Homo sapiens chromosome 8, clone RP11-613H2, complete sequence
          Length = 173262

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    caattacttattactgcact 21
            ||||||||||||||||||||
Sbjct: 1667 caattacttattactgcact 1686

>ref|XM_234706.3| PREDICTED: Rattus norvegicus similar to hypothetical protein FLJ10300
            (predicted) (LOC314523), mRNA
          Length = 3735

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 506  agttcctaatgtacatgtca 525
            ||||||||||||||||||||
Sbjct: 2131 agttcctaatgtacatgtca 2112

>gb|AC013399.6| Homo sapiens BAC clone RP11-69O6 from 2, complete sequence
          Length = 171812

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 470    atatttaccaccactgaaca 489
              ||||||||||||||||||||
Sbjct: 106767 atatttaccaccactgaaca 106786

>gb|AE003685.5| Drosophila melanogaster chromosome 3R, section 23 of 118 of the
             complete sequence
          Length = 241476

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 360   acgtagtaattcattgccat 379
             ||||||||||||||||||||
Sbjct: 62103 acgtagtaattcattgccat 62084

>emb|AL929120.7| Mouse DNA sequence from clone RP23-457H10 on chromosome 2, complete
             sequence
          Length = 178517

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    aataacacactgcaccaaaa 112
             ||||||||||||||||||||
Sbjct: 55372 aataacacactgcaccaaaa 55353

>emb|AL589873.11| Mouse DNA sequence from clone RP23-120P1 on chromosome 2, complete
              sequence
          Length = 170936

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    atgtctgtcaggttccttct 171
              ||||||||||||||||||||
Sbjct: 152573 atgtctgtcaggttccttct 152554


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,433,943
Number of Sequences: 3902068
Number of extensions: 4433943
Number of successful extensions: 74402
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74329
Number of HSP's gapped (non-prelim): 70
length of query: 528
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 505
effective length of database: 17,143,297,704
effective search space: 8657365340520
effective search space used: 8657365340520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)