Clone Name	rbags26h07
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B15...	603	e-169
2	emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B	547	e-152
3	dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8,...	541	e-151
4	dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6,...	531	e-148
5	gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full i...	468	e-129
6	gb|BT016519.1| Zea mays clone Contig352 mRNA sequence	456	e-125
7	gb|BT016429.1| Zea mays clone Contig262 mRNA sequence	456	e-125
8	gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence	456	e-125
9	emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221)	456	e-125
10	gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full...	452	e-124
11	ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA	444	e-121
12	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	444	e-121
13	dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic D...	444	e-121
14	dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic D...	444	e-121
15	ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predic...	440	e-120
16	gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome...	440	e-120
17	gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome...	440	e-120
18	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	440	e-120
19	emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214)	438	e-120
20	ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA	436	e-119
21	dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D...	436	e-119
22	gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds	436	e-119
23	emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3)	432	e-118
24	ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA	430	e-117
25	ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA	428	e-117
26	ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA	428	e-117
27	dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complet...	428	e-117
28	ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA	426	e-116
29	ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA	426	e-116
30	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	426	e-116
31	dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic D...	426	e-116
32	ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA	420	e-114
33	gb|BT016885.1| Zea mays clone Contig718 mRNA sequence	418	e-114
34	emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4)	416	e-113
35	gb|BT016478.1| Zea mays clone Contig311 mRNA sequence	414	e-112
36	gb|BT016350.1| Zea mays clone Contig183 mRNA sequence	414	e-112
37	gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence	404	e-109
38	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	383	e-103
39	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	383	e-103
40	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	383	e-103
41	ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predic...	369	6e-99
42	dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D...	369	6e-99
43	dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D...	369	6e-99
44	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	337	2e-89
45	ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predic...	321	1e-84
46	dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D...	319	5e-84
47	dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B12...	297	2e-77
48	emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B	281	1e-72
49	gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds	274	2e-70
50	gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partia...	268	2e-68
51	gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, parti...	264	2e-67
52	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	254	2e-64
53	gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),...	254	2e-64
54	gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partia...	252	9e-64
55	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	238	1e-59
56	gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partia...	236	5e-59
57	gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial...	226	5e-56
58	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	218	1e-53
59	gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partia...	216	5e-53
60	ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B hist...	200	3e-48
61	ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone ...	200	3e-48
62	ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B hist...	200	3e-48
63	ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B hist...	200	3e-48
64	ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B hist...	200	3e-48
65	ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B hist...	200	3e-48
66	dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clon...	190	3e-45
67	gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c...	184	2e-43
68	gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes,...	180	3e-42
69	ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260...	176	4e-41
70	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	176	4e-41
71	ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA	176	4e-41
72	gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MG...	176	4e-41
73	ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-s...	174	2e-40
74	emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr...	172	7e-40
75	emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2...	172	7e-40
76	ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudo...	172	7e-40
77	ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudo...	172	7e-40
78	gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, ...	172	7e-40
79	gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, ...	172	7e-40
80	gb|BC106916.1| Homo sapiens similar to histone H2B histone famil...	172	7e-40
81	gb|BC073925.1| Homo sapiens similar to histone H2B histone famil...	172	7e-40
82	ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3...	168	1e-38
83	ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA	168	1e-38
84	ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone...	168	1e-38
85	ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone...	168	1e-38
86	ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone...	168	1e-38
87	ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ...	168	1e-38
88	ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
89	ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
90	ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
91	ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
92	ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B hist...	168	1e-38
93	ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B hist...	168	1e-38
94	ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B hist...	168	1e-38
95	ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
96	ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B hist...	168	1e-38
97	ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
98	ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B hist...	168	1e-38
99	ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-s...	168	1e-38
100	ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
101	ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
102	ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B hist...	168	1e-38
103	ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B hist...	168	1e-38
104	ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
105	ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone ...	168	1e-38
106	ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ...	168	1e-38
107	ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone ...	168	1e-38
108	ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ...	168	1e-38
109	ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone ...	168	1e-38
110	emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq...	168	1e-38
111	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	168	1e-38
112	dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN f...	168	1e-38
113	dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN f...	168	1e-38
114	dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIK...	168	1e-38
115	gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp...	168	1e-38
116	gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds	168	1e-38
117	emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0)	167	4e-38
118	ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone ...	165	2e-37
119	emb|X14731.1|CMHIST2B Duck H2B histone gene	163	6e-37
120	emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3)	163	6e-37
121	gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks	163	6e-37
122	ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone...	161	3e-36
123	ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone...	161	3e-36
124	gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MG...	161	3e-36
125	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	161	3e-36
126	ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone ...	161	3e-36
127	ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B ...	161	3e-36
128	ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B ...	161	3e-36
129	ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA	161	3e-36
130	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	161	3e-36
131	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	161	3e-36
132	emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b	161	3e-36
133	gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG...	161	3e-36
134	dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-le...	161	3e-36
135	gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MG...	161	3e-36
136	ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA	161	3e-36
137	gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp...	161	3e-36
138	gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, comp...	161	3e-36
139	gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, comp...	161	3e-36
140	emb|X05098.1|GGH2B5 Chicken histone H2B gene (pBBA-3.0)	161	3e-36
141	emb|X05096.1|GGH2B3 Chicken histone H2B gene (pRR3c-3.5)	161	3e-36
142	emb|X05095.1|GGH2B2 Chicken histone H2B gene (pRR2e-3.5)	161	3e-36
143	ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA	161	3e-36
144	dbj|D70896.1| Gallus gallus DNA for histone H2B, complete cds	161	3e-36
145	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	159	1e-35
146	gb|AY158931.1| Mus musculus histone protein Hist1h2bk gene, comp...	159	1e-35
147	ref|NM_175665.1| Mus musculus histone 1, H2bk (Hist1h2bk), mRNA	159	1e-35
148	ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H...	153	6e-34
149	ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H...	153	6e-34
150	ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA	153	6e-34
151	gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IM...	153	6e-34
152	ref|XM_988254.1| PREDICTED: Mus musculus similar to Histone H2B ...	153	6e-34
153	gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MG...	153	6e-34
154	gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG...	153	6e-34
155	emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	153	6e-34
156	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	153	6e-34
157	gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MG...	153	6e-34
158	dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	153	6e-34
159	dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RI...	153	6e-34
160	ref|NM_178198.1| Mus musculus histone 1, H2bj (Hist1h2bj), mRNA	153	6e-34
161	ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA	153	6e-34
162	ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA	153	6e-34
163	ref|NM_178202.1| Mus musculus histone 1, H2bp (Hist1h2bp), mRNA	153	6e-34
164	gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, comp...	153	6e-34
165	gb|AY158932.1| Mus musculus histone protein Hist1h2bj gene, comp...	153	6e-34
166	gb|AY158930.1| Mus musculus histone protein Hist1h2bp gene, comp...	153	6e-34
167	gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, comp...	153	6e-34
168	gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, comp...	153	6e-34
169	gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, compl...	153	6e-34
170	emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4)	153	6e-34
171	emb|X05097.1|GGH2B4 Chicken histone H2B gene (pPP2d-2.3)	153	6e-34
172	emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV	153	6e-34
173	gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H...	153	6e-34
174	gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	153	6e-34
175	emb|Z80779.1|HSH2BG H.sapiens H2B/g gene	153	6e-34
176	gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds	151	2e-33
177	gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, comp...	151	2e-33
178	gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing...	151	2e-33
179	gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing...	151	2e-33
180	emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq...	151	2e-33
181	ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone ...	151	2e-33
182	ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudo...	151	2e-33
183	ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudo...	151	2e-33
184	gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, ...	151	2e-33
185	gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, ...	151	2e-33
186	ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal...	145	1e-31
187	gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MG...	145	1e-31
188	ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA	145	1e-31
189	gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	145	1e-31
190	gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	145	1e-31
191	gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	145	1e-31
192	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	145	1e-31
193	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	145	1e-31
194	ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA	145	1e-31
195	ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA	145	1e-31
196	gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IM...	145	1e-31
197	gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, comple...	145	1e-31
198	gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, comple...	145	1e-31
199	gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, comple...	145	1e-31
200	gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	145	1e-31
201	gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM...	145	1e-31
202	emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o...	145	1e-31
203	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	145	1e-31
204	emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene	145	1e-31
205	emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2...	145	1e-31
206	gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG...	145	1e-31
207	gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG...	145	1e-31
208	dbj|AK158416.1| Mus musculus adult inner ear cDNA, RIKEN full-le...	145	1e-31
209	emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (...	145	1e-31
210	dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501	145	1e-31
211	gb|M25487.1|MUSHIS2B Mus musculus histone H2b mRNA, 3' end	145	1e-31
212	emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC...	141	2e-30
213	dbj|AP006674.1| Lotus japonicus genomic DNA, chromosome 3, clone...	141	2e-30
214	emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F0...	141	2e-30
215	ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 29...	139	9e-30
216	gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDN...	139	9e-30
217	ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC1...	139	9e-30
218	ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histo...	137	4e-29
219	ref|XM_608099.2| PREDICTED: Bos taurus similar to Histone H2B 29...	137	4e-29
220	ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 29...	137	4e-29
221	gb|AY271238.1| Homo sapiens clone RM2-A03 putative promoter sequ...	135	1e-28
222	ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B...	133	6e-28
223	ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B...	133	6e-28
224	ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone fa...	129	9e-27
225	ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), trans...	129	9e-27
226	ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), trans...	129	9e-27
227	gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, comple...	129	9e-27
228	emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro...	129	9e-27
229	emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone...	129	9e-27
230	gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant ...	129	9e-27
231	gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant ...	129	9e-27
232	gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds	129	9e-27
233	gb|AC092896.9| Homo sapiens 3 BAC RP11-274J15 (Roswell Park Canc...	127	4e-26
234	dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone ...	127	4e-26
235	ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG1...	125	1e-25
236	ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H...	121	2e-24
237	ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 29...	121	2e-24
238	ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA	121	2e-24
239	gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, comple...	121	2e-24
240	gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	121	2e-24
241	gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	121	2e-24
242	gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	121	2e-24
243	gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	121	2e-24
244	emb|BX072512.1|CNS09S44 Single read from an extremity of a full-...	117	3e-23
245	emb|BX072414.1|CNS09S1E Single read from an extremity of a full-...	117	3e-23
246	emb|BX051496.1|CNS09BWC Single read from an extremity of a full-...	117	3e-23
247	emb|BX051495.1|CNS09BWB Single read from an extremity of a full-...	117	3e-23
248	emb|BX047440.1|CNS098RO Single read from an extremity of a full-...	117	3e-23
249	emb|BX038423.1|CNS091T7 Single read from an extremity of a full-...	117	3e-23
250	emb|BX032827.1|CNS08XHR Single read from an extremity of a full-...	117	3e-23
251	emb|BX031663.1|CNS08WLF Single read from an extremity of a full-...	117	3e-23
252	emb|BX021771.1|CNS08OYN Single read from an extremity of a full-...	117	3e-23
253	emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-...	117	3e-23
254	emb|BX012776.1|CNS08I0S Single read from an extremity of a full-...	117	3e-23
255	emb|BX012380.1|CNS08HPS Single read from an extremity of a full-...	117	3e-23
256	emb|BX009211.1|CNS08F9R Single read from an extremity of a full-...	117	3e-23
257	emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B	117	3e-23
258	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	117	3e-23
259	dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-1317...	117	3e-23
260	ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582 ...	117	3e-23
261	ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097 ...	117	3e-23
262	ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080 ...	117	3e-23
263	ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674 ...	117	3e-23
264	ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043 ...	117	3e-23
265	ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106 ...	117	3e-23
266	ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003 ...	117	3e-23
267	gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:...	117	3e-23
268	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	117	3e-23
269	gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG...	115	1e-22
270	gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG...	115	1e-22
271	ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261...	115	1e-22
272	gb|BC051921.1| Mus musculus histone 3, H2ba, mRNA (cDNA clone MG...	115	1e-22
273	emb|BX008531.1|CNS08EQV Single read from an extremity of a full-...	115	1e-22
274	dbj|AK018765.1| Mus musculus adult male cerebellum cDNA, RIKEN f...	115	1e-22
275	ref|NM_030082.1| Mus musculus histone 3, H2ba (Hist3h2ba), mRNA	115	1e-22
276	gb|AY158942.1| Mus musculus histone protein Hist3h2ba gene, comp...	115	1e-22
277	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	115	1e-22
278	gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM...	113	5e-22
279	ref|XM_518288.1| PREDICTED: Pan troglodytes similar to Histone H...	113	5e-22
280	ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 29...	113	5e-22
281	ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA	113	5e-22
282	gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IM...	113	5e-22
283	gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA ...	113	5e-22
284	gb|AF531288.1| Homo sapiens histone H2B (HIST1H2BE) gene, comple...	113	5e-22
285	gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, comple...	113	5e-22
286	emb|Z80781.1|HSH2BJ H.sapiens H2B/j gene	113	5e-22
287	emb|Z80780.1|HSH2BH H.sapiens H2B/h gene	113	5e-22
288	gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosome 5 l...	113	5e-22
289	gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromosome 5...	113	5e-22
290	gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome 5 loc...	113	5e-22
291	gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosome 5 l...	113	5e-22
292	gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosome 5 l...	113	5e-22
293	gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosome 5 l...	113	5e-22
294	gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome 5 lo...	113	5e-22
295	gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosome 5 l...	113	5e-22
296	gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosome 5 l...	113	5e-22
297	gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosome 5 l...	113	5e-22
298	gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosome 5 l...	113	5e-22
299	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	113	5e-22
300	emb|Z80783.1|HSH2BL H.sapiens H2B/l gene	113	5e-22
301	gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 ...	111	2e-21
302	gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
303	gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
304	ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477...	111	2e-21
305	ref|NM_175664.1| Mus musculus histone 1, H2bb (Hist1h2bb), mRNA	111	2e-21
306	gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
307	gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IM...	111	2e-21
308	ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA	111	2e-21
309	ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA	111	2e-21
310	gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds	111	2e-21
311	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	111	2e-21
312	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	111	2e-21
313	emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A	111	2e-21
314	emb|CR541895.1| Homo sapiens full open reading frame cDNA clone ...	111	2e-21
315	gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
316	emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from cl...	111	2e-21
317	dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU20115...	111	2e-21
318	dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG20083...	111	2e-21
319	ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudo...	111	2e-21
320	gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, comple...	111	2e-21
321	gb|AY131980.1| Homo sapiens histone H2B (HIST3H2BA) pseudogene, ...	111	2e-21
322	gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, comple...	111	2e-21
323	gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870....	111	2e-21
324	emb|AJ329611.1|HSA329611 Homo sapiens genomic sequence surroundi...	111	2e-21
325	gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	111	2e-21
326	gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	111	2e-21
327	gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end	111	2e-21
328	emb|AJ343028.1|HSA343028 Homo sapiens genomic sequence surroundi...	111	2e-21
329	emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-...	109	8e-21
330	emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-...	109	8e-21
331	emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-...	109	8e-21
332	emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09	109	8e-21
333	gb|M84798.1|TIGH2B2A Tigriopus californicus histone H2B-2 gene, ...	109	8e-21
334	ref|XM_868522.1| PREDICTED: Bos taurus similar to Histone H2B 29...	107	3e-20
335	emb|BX034441.1|CNS08YQL Single read from an extremity of a full-...	107	3e-20
336	emb|BX014617.1|CNS08JFX Single read from an extremity of a full-...	107	3e-20
337	ref|XM_527258.1| PREDICTED: Pan troglodytes similar to histone H...	105	1e-19
338	emb|X90778.1|MMTSHIS2B M.musculus H2B gene	105	1e-19
339	emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones	105	1e-19
340	emb|X02621.1|MMHISH2B Mouse gene for histone H2b	105	1e-19
341	emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr...	105	1e-19
342	gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosome 5 l...	105	1e-19
343	gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome 5 lo...	105	1e-19
344	gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosome 5 l...	105	1e-19
345	gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosome 5 l...	105	1e-19
346	gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromosome ...	105	1e-19
347	gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromosome 5...	105	1e-19
348	gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosome 5 l...	105	1e-19
349	gb|AF471814.1| Arabidopsis thaliana ecotype SU-0 chromosome 5 lo...	105	1e-19
350	gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome 5 lo...	105	1e-19
351	gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome 5 lo...	105	1e-19
352	gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosome 5 l...	105	1e-19
353	gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome 5 lo...	105	1e-19
354	gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome 5 lo...	105	1e-19
355	gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosome 5 l...	105	1e-19
356	gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome 5 lo...	105	1e-19
357	gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome 5 lo...	105	1e-19
358	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	105	1e-19
359	emb|CR353801.1| Gallus gallus finished cDNA, clone ChEST919h3	105	1e-19
360	ref|NM_022647.1| Rattus norvegicus histone 1, H2bl (Hist1h2bl), ...	105	1e-19
361	ref|NM_175663.1| Mus musculus histone 1, H2ba (Hist1h2ba), mRNA	105	1e-19
362	ref|NM_178195.1| Mus musculus histone 1, H2bf (Hist1h2bf), mRNA	105	1e-19
363	ref|XM_214483.3| PREDICTED: Rattus norvegicus histone 1, H2bn (p...	105	1e-19
364	gb|AY158939.1| Mus musculus histone protein Hist1h2ba gene, comp...	105	1e-19
365	gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, comp...	105	1e-19
366	gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	103	5e-19
367	ref|XM_518295.1| PREDICTED: Pan troglodytes similar to H2B histo...	103	5e-19
368	ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BF...	103	5e-19
369	gb|BC067486.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG...	103	5e-19
370	gb|BC067489.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG...	103	5e-19
371	gb|BC067488.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG...	103	5e-19
372	gb|BC067487.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG...	103	5e-19
373	gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	103	5e-19
374	ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 29...	103	5e-19
375	ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA	103	5e-19
376	ref|NM_003521.2| Homo sapiens histone 1, H2bm (HIST1H2BM), mRNA	103	5e-19
377	gb|AF531296.1| Homo sapiens histone H2B (HIST1H2BM) gene, comple...	103	5e-19
378	gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, comple...	103	5e-19
379	emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA	103	5e-19
380	emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA	103	5e-19
381	ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus simila...	103	5e-19
382	emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A...	103	5e-19
383	emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o...	103	5e-19
384	emb|BX014618.1|CNS08JFY Single read from an extremity of a full-...	103	5e-19
385	emb|Z83738.1|HSZ83738 H.sapiens hH2B/e gene	103	5e-19
386	emb|X07762.1|GGH2AB7 Chicken DNA for pCH22.0B histone H2A/H2B se...	103	5e-19
387	emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)	103	5e-19
388	emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, c...	103	5e-19
389	gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	103	5e-19
390	gb|BC067485.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone IM...	103	5e-19
391	ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA	103	5e-19
392	ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (p...	103	5e-19
393	gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, comp...	103	5e-19
394	gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp...	103	5e-19
395	gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp...	103	5e-19
396	dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family p...	103	5e-19
397	gb|BC066244.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MG...	103	5e-19
398	dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	103	5e-19
399	ref|NG_000827.2| Homo sapiens genomic histone family microcluste...	103	5e-19
400	gb|BC108737.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	103	5e-19
401	gb|DQ268853.1| Solanum tuberosum clone 167E08 histone H2B-like p...	103	5e-19
402	dbj|AP001051.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	103	5e-19
403	dbj|AP001050.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	103	5e-19
404	gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA cl...	101	2e-18
405	ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (N...	101	2e-18
406	ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (N...	101	2e-18
407	emb|BX013308.1|CNS08IFK Single read from an extremity of a full-...	101	2e-18
408	emb|BX008532.1|CNS08EQW Single read from an extremity of a full-...	101	2e-18
409	ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2b...	101	2e-18
410	gb|AF471834.1| Arabidopsis thaliana ecotype BLA-10 chromosome 5 ...	100	8e-18
411	gb|AF471833.1| Arabidopsis thaliana ecotype PLA-0 chromosome 5 l...	100	8e-18
412	emb|Z59559.1|HS163A6R H.sapiens CpG island DNA genomic Mse1 frag...	100	8e-18
413	ref|XM_518889.1| PREDICTED: Pan troglodytes similar to histone H...	98	3e-17
414	ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histo...	98	3e-17
415	ref|NM_003519.3| Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA	98	3e-17
416	gb|AF531295.1| Homo sapiens histone H2B (HIST1H2BL) gene, comple...	98	3e-17
417	ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus simila...	98	3e-17
418	ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus simila...	98	3e-17
419	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	98	3e-17
420	emb|Z83740.1|HSZ83740 H.sapiens hH2B/c gene	98	3e-17
421	emb|CR859861.1| Pongo pygmaeus mRNA; cDNA DKFZp469M064 (from clo...	98	3e-17
422	gb|BC093761.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG...	98	3e-17
423	gb|BC093759.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG...	98	3e-17
424	emb|Z57636.1|HS187F7F H.sapiens CpG island DNA genomic Mse1 frag...	98	3e-17
425	ref|XM_527282.1| PREDICTED: Pan troglodytes similar to HIST1H2BM...	96	1e-16
426	ref|XM_868693.1| PREDICTED: Bos taurus similar to H2B histone fa...	96	1e-16
427	ref|XM_866923.1| PREDICTED: Bos taurus similar to testis-specifi...	96	1e-16
428	dbj|AB220463.1| Macaca fascicularis mRNA, clone QflA-14990: simi...	96	1e-16
429	gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp...	96	1e-16
430	emb|Z58592.1|HS45C9F H.sapiens CpG island DNA genomic Mse1 fragm...	96	1e-16
431	gb|BC111653.1| Bos taurus cDNA clone MGC:137516 IMAGE:8026091, c...	96	1e-16
432	ref|XM_532763.2| PREDICTED: Canis familiaris similar to testis-s...	94	5e-16
433	emb|BX026873.1|CNS08SWD Single read from an extremity of a full-...	94	5e-16
434	emb|BX022107.1|CNS08P7Z Single read from an extremity of a full-...	94	5e-16
435	emb|BX021770.1|CNS08OYM Single read from an extremity of a full-...	94	5e-16
436	emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes	94	5e-16
437	emb|AJ306724.1|PPI306724 Pinus pinaster mRNA for putative histon...	94	5e-16
438	ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p...	94	5e-16
439	dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, c...	94	5e-16
440	ref|NM_122194.2| Arabidopsis thaliana DNA binding AT5G22880 mRNA...	92	2e-15
441	gb|BT025507.1| Arabidopsis thaliana At5g22880 mRNA, complete cds	92	2e-15
442	ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo...	92	2e-15
443	emb|BX038797.1|CNS0923L Single read from an extremity of a full-...	92	2e-15
444	emb|Y07745.1|ATHISH2BL A.thaliana mRNA histone H2B like protein	92	2e-15
445	emb|AJ556871.1|XLA556871 Expression vector pET3-H2B H2B gene for...	92	2e-15
446	emb|AJ494852.1|ODI494852 Oikopleura dioica partial H2A.4 gene fo...	92	2e-15
447	gb|AF471843.1| Arabidopsis thaliana ecotype MA-0 chromosome 5 lo...	92	2e-15
448	gb|AF471842.1| Arabidopsis thaliana ecotype DI-0 chromosome 5 lo...	92	2e-15
449	gb|AF471841.1| Arabidopsis thaliana ecotype AA-0 chromosome 5 lo...	92	2e-15
450	gb|AF471840.1| Arabidopsis thaliana ecotype GY-0 chromosome 5 lo...	92	2e-15
451	gb|AF471839.1| Arabidopsis thaliana ecotype AG-0 chromosome 5 lo...	92	2e-15
452	gb|AF471838.1| Arabidopsis thaliana ecotype COL-0 chromosome 5 l...	92	2e-15
453	gb|AF471837.1| Arabidopsis thaliana ecotype MT-0 chromosome 5 lo...	92	2e-15
454	gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2...	92	2e-15
455	emb|BX833190.1|CNS0A0CG Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
456	gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp...	92	2e-15
457	gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene...	92	2e-15
458	dbj|AB005243.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	92	2e-15
459	dbj|AK108119.1| Oryza sativa (japonica cultivar-group) cDNA clon...	92	2e-15
460	gb|J00981.1|XELHIS2BL xenopus laevis h2b histone gene & flanks	92	2e-15
461	gb|K01888.1|HUMH2BPS2 Human histone H2B pseudogene (lambda-HHG55)	92	2e-15
462	ref|XM_868231.1| PREDICTED: Bos taurus similar to testis-specifi...	90	8e-15
463	ref|XM_865948.1| PREDICTED: Bos taurus similar to Histone H2B 29...	90	8e-15
464	gb|BT014560.1| Lycopersicon esculentum clone 134013R, mRNA sequence	90	8e-15
465	ref|NM_021058.3| Homo sapiens histone 1, H2bj (HIST1H2BJ), mRNA	90	8e-15
466	gb|AF531293.1| Homo sapiens histone H2B (HIST1H2BJ) gene, comple...	90	8e-15
467	ref|NM_022643.1| Rattus norvegicus histone 1, H2ba (Hist1h2ba), ...	90	8e-15
468	ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus simila...	90	8e-15
469	ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus simila...	90	8e-15
470	emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	90	8e-15
471	emb|X00088.1|HSHISH2B Human histone H2b gene	90	8e-15
472	emb|AJ297301.1|PPI297301 Pinus pinaster partial mRNA for histone...	90	8e-15
473	emb|AJ224934.1|LEA224934 Lycopersicon esculentum H2B-1 mRNA for ...	90	8e-15
474	gb|BC109769.1| Bos taurus cDNA clone MGC:133753 IMAGE:8062200, c...	90	8e-15
475	gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp...	90	8e-15
476	gb|M18046.1|RATHISTSA Rat testis-specific histone H2B mRNA, comp...	90	8e-15
477	gb|M18045.1|RATHISTS Rat testis-specific histone TH2B mRNA, comp...	90	8e-15
478	gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds	90	8e-15
479	ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ...	88	3e-14
480	ref|XM_581429.2| PREDICTED: Bos taurus similar to Histone H2B 29...	88	3e-14
481	ref|NM_021062.2| Homo sapiens histone 1, H2bb (HIST1H2BB), mRNA	88	3e-14
482	gb|AF531285.1| Homo sapiens histone H2B (HIST1H2BB) gene, comple...	88	3e-14
483	emb|CR719344.2|CNS0GHZQ Tetraodon nigroviridis full-length cDNA	88	3e-14
484	emb|CR714031.2|CNS0GDWB Tetraodon nigroviridis full-length cDNA	88	3e-14
485	emb|CR706884.2|CNS0G8DS Tetraodon nigroviridis full-length cDNA	88	3e-14
486	emb|CR706301.2|CNS0G7XL Tetraodon nigroviridis full-length cDNA	88	3e-14
487	emb|CR698920.2|CNS0G28K Tetraodon nigroviridis full-length cDNA	88	3e-14
488	emb|CR689567.2|CNS0FV0R Tetraodon nigroviridis full-length cDNA	88	3e-14
489	emb|CR686222.2|CNS0FSFU Tetraodon nigroviridis full-length cDNA	88	3e-14
490	ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus simila...	88	3e-14
491	ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus simila...	88	3e-14
492	emb|X57127.1|HSH2B1 H.sapiens H2B.1 gene for H2B histone	88	3e-14
493	emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone ...	88	3e-14
494	emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone ...	88	3e-14
495	emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi...	88	3e-14
496	gb|DQ118972.1| Toxoplasma gondii histone 2B variant 2 mRNA, comp...	88	3e-14
497	gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:1122...	88	3e-14
498	gb|BC058562.1| Mus musculus cDNA clone IMAGE:6389884	88	3e-14
499	gb|BC047137.1| Mus musculus histone 2, H2be, mRNA (cDNA clone MG...	88	3e-14
500	dbj|AK143398.1| Mus musculus 2 days pregnant adult female ovary ...	88	3e-14

---

>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds
          Length = 3209

 Score =  603 bits (304), Expect = e-169
 Identities = 360/378 (95%), Gaps = 3/378 (0%)
 Strand = Plus / Minus

                                                                        
Query: 93   aggcagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagct 152
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1703 aggcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagct 1644

                                                                        
Query: 153  cgccagggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttct 212
            |||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1643 cgcctgggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttct 1584

                                                                        
Query: 213  tgttgtaccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatga 272
            |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 1583 tgttgtaccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatga 1524

                                                                        
Query: 273  aggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttga 332
            |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct: 1523 aggagttcgtgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttca 1464

                                                                        
Query: 333  gcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccct 392
            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||
Sbjct: 1463 gcaccttgaagatgtagatcttgtacgtctccatgctcttcttggacttcttcttcccct 1404

                                                                        
Query: 393  tcttgtcgccgccgccctccttggacgccggcaccttcttctccgccttgggcttcttgc 452
            |||| |   |||||||||||||||||| ||||||||||||||||||||||||||||||| 
Sbjct: 1403 tcttct---cgccgccctccttggacgtcggcaccttcttctccgccttgggcttcttga 1347

                              
Query: 453  ccgccggggtcttctcca 470
            |||| |||||||||||||
Sbjct: 1346 ccgcgggggtcttctcca 1329

---

>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B
          Length = 712

 Score =  547 bits (276), Expect = e-152
 Identities = 300/308 (97%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 516 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 457

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 397

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           ||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||
Sbjct: 396 taccgcgccagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 337

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 336 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcagcacc 277

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 276 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttgcccttcttg 217

                   
Query: 398 tcgccgcc 405
           ||||||||
Sbjct: 216 tcgccgcc 209



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctcc 469
           ||||||||||||||||||||| || || || |||||||||
Sbjct: 175 cttctccgccttgggcttcttcccggcgggcgtcttctcc 136

---

>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds
          Length = 592

 Score =  541 bits (273), Expect = e-151
 Identities = 347/371 (93%), Gaps = 3/371 (0%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 472 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 413

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 412 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 353

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || || || |||||||| |||||||||||||||||||| |||||||||||||||||||||
Sbjct: 352 tagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 293

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 292 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 233

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 232 ttgaagatgtagatcttgtacgtctccacgctcttcttcgacttcttcttccccttcttg 173

                                                                       
Query: 398 tcgccgccgccctccttggacgccggcaccttcttctccgccttgggcttcttgcccgcc 457
           |   |||||||||||||||||||||||  |  |||||| ||||||| ||||||  |||||
Sbjct: 172 t---cgccgccctccttggacgccggcggccgcttctcggccttggtcttcttcgccgcc 116

                      
Query: 458 ggggtcttctc 468
           |  ||||||||
Sbjct: 115 gtcgtcttctc 105

---

>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds
          Length = 564

 Score =  531 bits (268), Expect = e-148
 Identities = 306/318 (96%), Gaps = 3/318 (0%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 407 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 348

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||
Sbjct: 347 gggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggcttcttgttg 288

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 287 tagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgatgaaggag 228

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 168

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||||||||| ||||||||||||| |||||||||   |||||||
Sbjct: 167 ttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttctt---cttcttg 111

                             
Query: 398 tcgccgccgccctccttg 415
           ||| ||||||| ||||||
Sbjct: 110 tcggcgccgccgtccttg 93

---

>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA
           sequence
          Length = 940

 Score =  468 bits (236), Expect = e-129
 Identities = 269/280 (96%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 772 gaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggcgagctcgccg 713

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 712 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 653

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || || || |||||||| ||||| || ||||||||||| |||||||||||||||||||||
Sbjct: 652 tagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgttgatgaaggag 593

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 592 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 533

                                                   
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttgg 377
           ||||||||||||||||||||||||||||||| ||||||||
Sbjct: 532 ttgaagatgtagatcttgtacgtctccacgcccttcttgg 493



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 411 ccttggacgccggcaccttcttctccgccttgggctt 447
           |||||||||||||| ||  ||||||||||||||||||
Sbjct: 443 ccttggacgccggcgcccgcttctccgccttgggctt 407

---

>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence
          Length = 789

 Score =  456 bits (230), Expect = e-125
 Identities = 287/306 (93%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||
Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
           ||| || ||||| || | |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 342 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacctt 283

                                                                       
Query: 340 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtc 399
           |||||||||||| ||||| ||||||||||||||||||| ||||||||| |||||||| ||
Sbjct: 282 gaagatgtagattttgtaggtctccacgctcttcttggccttcttcttccccttcttctc 223

                 
Query: 400 gccgcc 405
           ||||||
Sbjct: 222 gccgcc 217

---

>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence
          Length = 564

 Score =  456 bits (230), Expect = e-125
 Identities = 296/318 (93%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 397 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 338

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 337 gggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggcttcttgttg 278

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           |||||||| |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 277 taccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 218

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 217 ttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctgcttcagcacc 158

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||| ||||||||||||||||||  |||||||  |||| |||| 
Sbjct: 157 ttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttccggcccctcttt 98

                             
Query: 398 tcgccgccgccctccttg 415
            |  ||||||||||||||
Sbjct: 97  ccctcgccgccctccttg 80



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| || ||||| | ||||||
Sbjct: 53  cttctccgccttgggcttcttcccggccggcgccttctc 15

---

>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence
          Length = 574

 Score =  456 bits (230), Expect = e-125
 Identities = 284/302 (94%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 519 gaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttggcgagctcgccg 460

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           || || |||||||| ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 459 ggtagaacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 400

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || || || |||||||||| |||||||||||||||||| ||||||||||||||||| |||
Sbjct: 399 tagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtcgttgatgaatgag 340

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 339 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttcagcacc 280

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||||||||||||||||||||||| |||||||   |||||||||
Sbjct: 279 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttccgccccttcttg 220

             
Query: 398 tc 399
           ||
Sbjct: 219 tc 218



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctcc 469
           |||||||||||| |||||||| || || |||| |||||||
Sbjct: 175 cttctccgccttcggcttcttcccagcgggggccttctcc 136

---

>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221)
          Length = 653

 Score =  456 bits (230), Expect = e-125
 Identities = 296/318 (93%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 463 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccg 404

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 403 gggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggcttcttgttg 344

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           |||||||| |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 343 taccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 284

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 283 ttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctgcttcagcacc 224

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||| ||||||||||||||||||  |||||||  |||| |||| 
Sbjct: 223 ttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttccggcccctcttt 164

                             
Query: 398 tcgccgccgccctccttg 415
            |  ||||||||||||||
Sbjct: 163 ccctcgccgccctccttg 146



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| || ||||| | ||||||
Sbjct: 119 cttctccgccttgggcttcttcccggccggcgccttctc 81

---

>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA
           sequence
          Length = 764

 Score =  452 bits (228), Expect = e-124
 Identities = 288/308 (93%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 545 gaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcgccg 486

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 485 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 426

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           ||||| || |||||||| | |||  ||||||||||||| |||||||||||||||||||||
Sbjct: 425 taccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggag 366

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 365 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacc 306

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||| ||||||||||||||||| | ||||||| | |||||||||
Sbjct: 305 ttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttcctacccttcttg 246

                   
Query: 398 tcgccgcc 405
           ||||||||
Sbjct: 245 tcgccgcc 238



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctcc 469
           ||||||||||||||||||||| ||||| |||| |||||||
Sbjct: 204 cttctccgccttgggcttcttccccgcgggggccttctcc 165

---

>ref|NM_184399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  444 bits (224), Expect = e-121
 Identities = 272/288 (94%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 455 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 336

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || ||||| |||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 335 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 216

                                                           
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
           |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| |||||| ||| ||||||
Sbjct: 111 cttctccgccttgggcttcttccccgccagggccttctc 73

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  444 bits (224), Expect = e-121
 Identities = 272/288 (94%)
 Strand = Plus / Plus

                                                                           
Query: 98      gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
               |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 2819242 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 2819301

                                                                           
Query: 158     gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
               |||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 2819302 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 2819361

                                                                           
Query: 218     taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
               || ||||| |||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 2819362 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2819421

                                                                           
Query: 278     ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2819422 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2819481

                                                               
Query: 338     ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
               |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 2819482 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2819529



 Score =  436 bits (220), Expect = e-119
 Identities = 271/288 (94%)
 Strand = Plus / Minus

                                                                           
Query: 98      gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 2673933 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 2673874

                                                                           
Query: 158     gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
               |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 2673873 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2673814

                                                                           
Query: 218     taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
               || || || |||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 2673813 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2673754

                                                                           
Query: 278     ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
               ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 2673753 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 2673694

                                                               
Query: 338     ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
               |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 2673693 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2673646



 Score =  430 bits (217), Expect = e-117
 Identities = 268/285 (94%)
 Strand = Plus / Plus

                                                                           
Query: 101     gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
               ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2837056 gtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 2837115

                                                                           
Query: 161     aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
               ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 2837116 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 2837175

                                                                           
Query: 221     cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
               ||||| |||||||| ||||| |||||||||||||| ||||| || |||||||||||||||
Sbjct: 2837176 cgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgatgaaggagttc 2837235

                                                                           
Query: 281     atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 2837236 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 2837295

                                                            
Query: 341     aagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
               ||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 2837296 aagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2837340



 Score =  428 bits (216), Expect = e-117
 Identities = 258/272 (94%)
 Strand = Plus / Plus

                                                                           
Query: 104     aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagg 163
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 2843672 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 2843731

                                                                           
Query: 164     acgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgc 223
               |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 2843732 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 2843791

                                                                           
Query: 224     gccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatg 283
               || |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2843792 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 2843851

                                                                           
Query: 284     atggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttgaag 343
               |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 2843852 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 2843911

                                               
Query: 344     atgtagatcttgtacgtctccacgctcttctt 375
               |||||||||||||| ||||| |||||||||||
Sbjct: 2843912 atgtagatcttgtaggtctcgacgctcttctt 2843943



 Score =  428 bits (216), Expect = e-117
 Identities = 270/288 (93%)
 Strand = Plus / Minus

                                                                           
Query: 98      gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
               |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 2686256 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 2686197

                                                                           
Query: 158     gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
               |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 2686196 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 2686137

                                                                           
Query: 218     taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
               || || || |||||||| ||||| |||||||||||||| |||||||| ||||||||||||
Sbjct: 2686136 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 2686077

                                                                           
Query: 278     ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2686076 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 2686017

                                                               
Query: 338     ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
               |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 2686016 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2685969



 Score =  426 bits (215), Expect = e-116
 Identities = 260/275 (94%)
 Strand = Plus / Plus

                                                                           
Query: 101     gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
               ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 2856608 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 2856667

                                                                           
Query: 161     aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
               ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 2856668 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 2856727

                                                                           
Query: 221     cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
               || || |||||||| | |||| ||||||||||||| ||||||||||||||||||||||||
Sbjct: 2856728 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 2856787

                                                                           
Query: 281     atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 2856788 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 2856847

                                                  
Query: 341     aagatgtagatcttgtacgtctccacgctcttctt 375
               ||||||||||||||||| ||||| |||||||||||
Sbjct: 2856848 aagatgtagatcttgtaggtctcgacgctcttctt 2856882



 Score =  420 bits (212), Expect = e-114
 Identities = 269/288 (93%)
 Strand = Plus / Minus

                                                                           
Query: 98      gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
               |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 2871648 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 2871589

                                                                           
Query: 158     gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
               |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 2871588 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2871529

                                                                           
Query: 218     taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
               || || || |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 2871528 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 2871469

                                                                           
Query: 278     ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 2871468 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2871409

                                                               
Query: 338     ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
               |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 2871408 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2871361



 Score =  369 bits (186), Expect = 6e-99
 Identities = 309/350 (88%)
 Strand = Plus / Plus

                                                                            
Query: 101      gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
                ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 36007442 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 36007501

                                                                            
Query: 161      aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
                |||||||||||||| |||||||||||||| ||||| |||||||| |||||||||||||| 
Sbjct: 36007502 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 36007561

                                                                            
Query: 221      cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
                || || ||   ||| | |||   |||||||||||| ||||| ||||||||||| ||||||
Sbjct: 36007562 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 36007621

                                                                            
Query: 281      atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
                ||||| |||||||||||||| || || ||||| ||||| |||||||||||||| ||||||
Sbjct: 36007622 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 36007681

                                                                            
Query: 341      aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtcg 400
                || ||||||||||| || || || ||||||||||||| ||||||||| |||||||| |||
Sbjct: 36007682 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 36007741

                                                                  
Query: 401      ccgccgccctccttggacgccggcaccttcttctccgccttgggcttctt 450
                ||||||||||||||||   ||||||||  |||||| ||||||||||||||
Sbjct: 36007742 ccgccgccctccttggcgcccggcacccgcttctcggccttgggcttctt 36007791



 Score =  319 bits (161), Expect = 5e-84
 Identities = 282/323 (87%), Gaps = 12/323 (3%)
 Strand = Plus / Plus

                                                                            
Query: 100      ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793

                                                                            
Query: 160      gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
                |||||||||||| |||||||||| |||||| ||||| |||  | ||||||||||||||||
Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853

                                                                            
Query: 220      ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                 || || || | ||| | |||    ||||||||||| |||||||||||||||||||||||
Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913

                                                                            
Query: 280      catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
                |||||| ||||||||||||||||||||||||||||| |||||||||||||| || |||||
Sbjct: 17421914 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 17421973

                                                                            
Query: 340      gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtc 399
                ||||||||||||         ||| ||||||||||| | ||||||| | |||||||||||
Sbjct: 17421974 gaagatgtagat---------ctcgacgctcttcttcgccttcttcctccccttcttgtc 17422024

                                       
Query: 400      gc---cgccgccctccttggacg 419
                ||   ||||||||||||||||||
Sbjct: 17422025 gccggcgccgccctccttggacg 17422047



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                      
Query: 430     cttctccgccttgggcttcttgcccgccggggtcttctc 468
               ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 2856949 cttctccgccttgggcttcttccccgccggggccttctc 2856987



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                      
Query: 430     cttctccgccttgggcttcttgcccgccggggtcttctc 468
               ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 2837397 cttctccgccttgggcttcttccccgccggggccttctc 2837435



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                 
Query: 248      agcttctcaaagatgtcgttgatgaaggagttcatgatggacatggcct 296
                |||||||| || | ||||||||||||||| |||||||| ||||||||||
Sbjct: 30942127 agcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                      
Query: 430     cttctccgccttgggcttcttgcccgccggggtcttctc 468
               ||||||||||||||||||||| || ||||||| ||||||
Sbjct: 2871298 cttctccgccttgggcttcttcccggccggggccttctc 2871260



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                      
Query: 430     cttctccgccttgggcttcttgcccgccggggtcttctc 468
               ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 2844010 cttctccgccttgggcttcttccccgcgggggccttctc 2844048



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                      
Query: 430     cttctccgccttgggcttcttgcccgccggggtcttctc 468
               ||||||||||||||||||||| |||||| ||| ||||||
Sbjct: 2819586 cttctccgccttgggcttcttccccgccagggccttctc 2819624



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                      
Query: 430     cttctccgccttgggcttcttgcccgccggggtcttctc 468
               ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 2685912 cttctccgccttgggcttcttccccgcgggggccttctc 2685874



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                      
Query: 430     cttctccgccttgggcttcttgcccgccggggtcttctc 468
               ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 2673589 cttctccgccttgggcttcttccccgcgggggccttctc 2673551



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 333      gcaccttgaagatgtagatcttgtac 358
                ||||||||||||||| ||||||||||
Sbjct: 30476512 gcaccttgaagatgttgatcttgtac 30476487



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 341      aagatgtagatcttgtacgtctccacgctc 370
                |||||||||||||||||| | |||||||||
Sbjct: 19885823 aagatgtagatcttgtacatttccacgctc 19885852



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 332      agcaccttgaagatgtagatcttgta 357
                |||||||||||||| |||||||||||
Sbjct: 12269803 agcaccttgaagatatagatcttgta 12269778



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 430      cttctccgccttgggcttctt 450
                |||||||||||||||||||||
Sbjct: 17422070 cttctccgccttgggcttctt 17422090



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 379      cttcttcttgcccttcttgtcgccgccgc 407
                ||||||||||| ||||||| |||||||||
Sbjct: 12628930 cttcttcttgcgcttcttggcgccgccgc 12628958



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 334      caccttgaagatgtagatct 353
                ||||||||||||||||||||
Sbjct: 20051339 caccttgaagatgtagatct 20051320

---

>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0030H07
          Length = 168253

 Score =  444 bits (224), Expect = e-121
 Identities = 272/288 (94%)
 Strand = Plus / Plus

                                                                         
Query: 98    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
             |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 26240 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 26299

                                                                         
Query: 158   gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
             |||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 26300 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 26359

                                                                         
Query: 218   taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
             || ||||| |||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 26360 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 26419

                                                                         
Query: 278   ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 26420 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 26479

                                                             
Query: 338   ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
             |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 26480 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 26527



 Score =  430 bits (217), Expect = e-117
 Identities = 268/285 (94%)
 Strand = Plus / Plus

                                                                         
Query: 101   gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
             ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 44054 gtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 44113

                                                                         
Query: 161   aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
             ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 44114 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 44173

                                                                         
Query: 221   cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
             ||||| |||||||| ||||| |||||||||||||| ||||| || |||||||||||||||
Sbjct: 44174 cgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgatgaaggagttc 44233

                                                                         
Query: 281   atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 44234 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 44293

                                                          
Query: 341   aagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
             ||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 44294 aagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 44338



 Score =  428 bits (216), Expect = e-117
 Identities = 258/272 (94%)
 Strand = Plus / Plus

                                                                         
Query: 104   aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagg 163
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 50670 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 50729

                                                                         
Query: 164   acgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgc 223
             |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 50730 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 50789

                                                                         
Query: 224   gccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatg 283
             || |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 50790 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 50849

                                                                         
Query: 284   atggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttgaag 343
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 50850 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 50909

                                             
Query: 344   atgtagatcttgtacgtctccacgctcttctt 375
             |||||||||||||| ||||| |||||||||||
Sbjct: 50910 atgtagatcttgtaggtctcgacgctcttctt 50941



 Score =  426 bits (215), Expect = e-116
 Identities = 260/275 (94%)
 Strand = Plus / Plus

                                                                         
Query: 101   gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
             ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 63606 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 63665

                                                                         
Query: 161   aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
             ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 63666 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 63725

                                                                         
Query: 221   cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
             || || |||||||| | |||| ||||||||||||| ||||||||||||||||||||||||
Sbjct: 63726 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 63785

                                                                         
Query: 281   atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 63786 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 63845

                                                
Query: 341   aagatgtagatcttgtacgtctccacgctcttctt 375
             ||||||||||||||||| ||||| |||||||||||
Sbjct: 63846 aagatgtagatcttgtaggtctcgacgctcttctt 63880



 Score =  420 bits (212), Expect = e-114
 Identities = 269/288 (93%)
 Strand = Plus / Minus

                                                                         
Query: 98    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
             |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 78646 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 78587

                                                                         
Query: 158   gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
             |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 78586 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 78527

                                                                         
Query: 218   taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
             || || || |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 78526 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 78467

                                                                         
Query: 278   ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 78466 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 78407

                                                             
Query: 338   ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
             |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 78406 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 78359



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                    
Query: 430   cttctccgccttgggcttcttgcccgccggggtcttctc 468
             ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 63947 cttctccgccttgggcttcttccccgccggggccttctc 63985



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                    
Query: 430   cttctccgccttgggcttcttgcccgccggggtcttctc 468
             ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 44395 cttctccgccttgggcttcttccccgccggggccttctc 44433



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 430   cttctccgccttgggcttcttgcccgccggggtcttctc 468
             ||||||||||||||||||||| || ||||||| ||||||
Sbjct: 78296 cttctccgccttgggcttcttcccggccggggccttctc 78258



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 430   cttctccgccttgggcttcttgcccgccggggtcttctc 468
             ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 51008 cttctccgccttgggcttcttccccgcgggggccttctc 51046



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 430   cttctccgccttgggcttcttgcccgccggggtcttctc 468
             ||||||||||||||||||||| |||||| ||| ||||||
Sbjct: 26584 cttctccgccttgggcttcttccccgccagggccttctc 26622

---

>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0009G03
          Length = 163526

 Score =  444 bits (224), Expect = e-121
 Identities = 272/288 (94%)
 Strand = Plus / Plus

                                                                          
Query: 98     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
              |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 124919 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 124978

                                                                          
Query: 158    gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
              |||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 124979 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 125038

                                                                          
Query: 218    taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
              || ||||| |||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 125039 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 125098

                                                                          
Query: 278    ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 125099 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 125158

                                                              
Query: 338    ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
              |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 125159 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 125206



 Score =  430 bits (217), Expect = e-117
 Identities = 268/285 (94%)
 Strand = Plus / Plus

                                                                          
Query: 101    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
              ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 142733 gtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 142792

                                                                          
Query: 161    aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
              ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 142793 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 142852

                                                                          
Query: 221    cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
              ||||| |||||||| ||||| |||||||||||||| ||||| || |||||||||||||||
Sbjct: 142853 cgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgatgaaggagttc 142912

                                                                          
Query: 281    atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 142913 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 142972

                                                           
Query: 341    aagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
              ||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 142973 aagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 143017



 Score =  428 bits (216), Expect = e-117
 Identities = 258/272 (94%)
 Strand = Plus / Plus

                                                                          
Query: 104    aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagg 163
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 149349 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 149408

                                                                          
Query: 164    acgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgc 223
              |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 149409 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 149468

                                                                          
Query: 224    gccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatg 283
              || |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 149469 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 149528

                                                                          
Query: 284    atggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttgaag 343
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 149529 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 149588

                                              
Query: 344    atgtagatcttgtacgtctccacgctcttctt 375
              |||||||||||||| ||||| |||||||||||
Sbjct: 149589 atgtagatcttgtaggtctcgacgctcttctt 149620



 Score =  426 bits (215), Expect = e-116
 Identities = 260/275 (94%)
 Strand = Plus / Plus

                                                                          
Query: 101    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
              ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 162285 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 162344

                                                                          
Query: 161    aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
              ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 162345 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 162404

                                                                          
Query: 221    cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
              || || |||||||| | |||| ||||||||||||| ||||||||||||||||||||||||
Sbjct: 162405 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 162464

                                                                          
Query: 281    atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 162465 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 162524

                                                 
Query: 341    aagatgtagatcttgtacgtctccacgctcttctt 375
              ||||||||||||||||| ||||| |||||||||||
Sbjct: 162525 aagatgtagatcttgtaggtctcgacgctcttctt 162559



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                     
Query: 430    cttctccgccttgggcttcttgcccgccggggtcttctc 468
              ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 162626 cttctccgccttgggcttcttccccgccggggccttctc 162664



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                     
Query: 430    cttctccgccttgggcttcttgcccgccggggtcttctc 468
              ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 143074 cttctccgccttgggcttcttccccgccggggccttctc 143112



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                     
Query: 430    cttctccgccttgggcttcttgcccgccggggtcttctc 468
              ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 149687 cttctccgccttgggcttcttccccgcgggggccttctc 149725



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                     
Query: 430    cttctccgccttgggcttcttgcccgccggggtcttctc 468
              ||||||||||||||||||||| |||||| ||| ||||||
Sbjct: 125263 cttctccgccttgggcttcttccccgccagggccttctc 125301

---

>ref|XM_475912.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  440 bits (222), Expect = e-120
 Identities = 264/278 (94%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 452 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 393

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 392 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || || || |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 332 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 273

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 272 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 213

                                                 
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttctt 375
           |||||||||||||||||||| |||||||||||||||||
Sbjct: 212 ttgaagatgtagatcttgtaggtctccacgctcttctt 175



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 430 cttctccgccttgggcttcttgcccgccg 458
           ||||||||||||||||||||| |||||||
Sbjct: 105 cttctccgccttgggcttcttccccgccg 77

---

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score =  440 bits (222), Expect = e-120
 Identities = 264/278 (94%)
 Strand = Plus / Minus

                                                                          
Query: 98     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 176400 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 176341

                                                                          
Query: 158    gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
              |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 176340 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 176281

                                                                          
Query: 218    taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
              || || || |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 176280 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 176221

                                                                          
Query: 278    ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
              |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 176220 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 176161

                                                    
Query: 338    ttgaagatgtagatcttgtacgtctccacgctcttctt 375
              |||||||||||||||||||| |||||||||||||||||
Sbjct: 176160 ttgaagatgtagatcttgtaggtctccacgctcttctt 176123



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 430    cttctccgccttgggcttcttgcccgccg 458
              ||||||||||||||||||||| |||||||
Sbjct: 176053 cttctccgccttgggcttcttccccgccg 176025

---

>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08,
             complete sequence
          Length = 119500

 Score =  440 bits (222), Expect = e-120
 Identities = 264/278 (94%)
 Strand = Plus / Minus

                                                                         
Query: 98    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 27082 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 27023

                                                                         
Query: 158   gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
             |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 27022 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 26963

                                                                         
Query: 218   taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
             || || || |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 26962 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 26903

                                                                         
Query: 278   ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
             |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 26902 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 26843

                                                   
Query: 338   ttgaagatgtagatcttgtacgtctccacgctcttctt 375
             |||||||||||||||||||| |||||||||||||||||
Sbjct: 26842 ttgaagatgtagatcttgtaggtctccacgctcttctt 26805



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 430   cttctccgccttgggcttcttgcccgccg 458
             ||||||||||||||||||||| |||||||
Sbjct: 26735 cttctccgccttgggcttcttccccgccg 26707

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  440 bits (222), Expect = e-120
 Identities = 264/278 (94%)
 Strand = Plus / Minus

                                                                            
Query: 98       gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 28392158 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 28392099

                                                                            
Query: 158      gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
                |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 28392098 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 28392039

                                                                            
Query: 218      taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
                || || || |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 28392038 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 28391979

                                                                            
Query: 278      ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
                |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 28391978 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 28391919

                                                      
Query: 338      ttgaagatgtagatcttgtacgtctccacgctcttctt 375
                |||||||||||||||||||| |||||||||||||||||
Sbjct: 28391918 ttgaagatgtagatcttgtaggtctccacgctcttctt 28391881



 Score =  337 bits (170), Expect = 2e-89
 Identities = 310/356 (87%), Gaps = 3/356 (0%)
 Strand = Plus / Minus

                                                                            
Query: 98       gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
                |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 22480464 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 22480405

                                                                            
Query: 158      gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
                ||||||||||| || || |||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 22480404 gggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttgttg 22480345

                                                                            
Query: 218      taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
                ||||  || ||| | || | |||     |||||||||| || |||||||||| |||||| 
Sbjct: 22480344 tacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaaggaa 22480285

                                                                            
Query: 278      ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
                ||||||||||||||||||||||||||||| || ||||| || ||||||||||||||||||
Sbjct: 22480284 ttcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttgagcacc 22480225

                                                                            
Query: 338      ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
                |||||||||||||| || || ||||||||||| ||||| | ||||||||| |||||||||
Sbjct: 22480224 ttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttccccttcttg 22480165

                                                                        
Query: 398      tcgcc---gccgccctccttggacgccggcaccttcttctccgccttgggcttctt 450
                || ||   ||| |||| |||||||| ||| | || ||||||||||||||| |||||
Sbjct: 22480164 tcaccggtgccaccctacttggacgtcggtagctgcttctccgccttgggtttctt 22480109



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                    
Query: 324     cctgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttg 376
               |||||||  ||||||||||||||||||| ||||| |||||||  |||||||||
Sbjct: 6896155 cctgcttctgcaccttgaagatgtagatattgtaggtctccatactcttcttg 6896207



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 430      cttctccgccttgggcttcttgcccgccg 458
                ||||||||||||||||||||| |||||||
Sbjct: 28391811 cttctccgccttgggcttcttccccgccg 28391783



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 334      caccttgaagatgtagatcttgt 356
                |||||||||||||||||||||||
Sbjct: 25447111 caccttgaagatgtagatcttgt 25447133



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 247     gagcttctcaaagatgtcgttgatgaa 273
               ||||||||| |||||||||||||||||
Sbjct: 3720743 gagcttctcgaagatgtcgttgatgaa 3720769



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 429     tcttctccgccttgggcttcttgcc 453
               |||||||||||||| ||||||||||
Sbjct: 5703949 tcttctccgccttgcgcttcttgcc 5703973



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 379     cttcttcttgcccttcttgtcgccgccgc 407
               ||||||||||| ||||||| |||||||||
Sbjct: 3475265 cttcttcttgcgcttcttggcgccgccgc 3475237



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 246      cgagcttctcaaagatgtcgttgatgaa 273
                ||||||||||  ||||||||||||||||
Sbjct: 29356934 cgagcttctcggagatgtcgttgatgaa 29356961



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 382      cttcttgcccttcttgtcgccgcc 405
                |||||||||||||||| |||||||
Sbjct: 29314077 cttcttgcccttcttgccgccgcc 29314100



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 246      cgagcttctcaaagatgtcgttgatgaa 273
                |||||||||| ||||||||||| |||||
Sbjct: 18422090 cgagcttctcgaagatgtcgttaatgaa 18422063

---

>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214)
          Length = 580

 Score =  438 bits (221), Expect = e-120
 Identities = 296/321 (92%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           ||||||||||| || |||||||| |||||||||||||||||||||||||||||||| || 
Sbjct: 452 gaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcgagctccccg 393

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           ||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 392 gggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || |||||||||||||| |||||| | ||||||||||| |||||||||||||||||||||
Sbjct: 332 tagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaaggag 273

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 272 ttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcacc 213

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||| |||||||||  |||||| | |||||| || |||||||||
Sbjct: 212 ttgaagatgtagatcttgtaggtctccacggacttcttcgccttctttttccccttcttg 153

                                
Query: 398 tcgccgccgccctccttggac 418
            |  |||||||||||||||||
Sbjct: 152 ccctcgccgccctccttggac 132

---

>ref|NM_184371.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  436 bits (220), Expect = e-119
 Identities = 271/288 (94%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 455 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || || || |||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 216

                                                           
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
           |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 111 cttctccgccttgggcttcttccccgcgggggccttctc 73

---

>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0434B04
          Length = 167029

 Score =  436 bits (220), Expect = e-119
 Identities = 271/288 (94%)
 Strand = Plus / Minus

                                                                          
Query: 98     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 123708 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 123649

                                                                          
Query: 158    gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
              |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 123648 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 123589

                                                                          
Query: 218    taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
              || || || |||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 123588 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 123529

                                                                          
Query: 278    ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
              ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 123528 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 123469

                                                              
Query: 338    ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
              |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 123468 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 123421



 Score =  428 bits (216), Expect = e-117
 Identities = 270/288 (93%)
 Strand = Plus / Minus

                                                                          
Query: 98     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
              |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 136031 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 135972

                                                                          
Query: 158    gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
              |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 135971 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 135912

                                                                          
Query: 218    taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
              || || || |||||||| ||||| |||||||||||||| |||||||| ||||||||||||
Sbjct: 135911 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 135852

                                                                          
Query: 278    ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 135851 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 135792

                                                              
Query: 338    ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
              |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 135791 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 135744



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 430    cttctccgccttgggcttcttgcccgccggggtcttctc 468
              ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 135687 cttctccgccttgggcttcttccccgcgggggccttctc 135649



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 430    cttctccgccttgggcttcttgcccgccggggtcttctc 468
              ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 123364 cttctccgccttgggcttcttccccgcgggggccttctc 123326

---

>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds
          Length = 678

 Score =  436 bits (220), Expect = e-119
 Identities = 286/308 (92%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 478 gaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcgccg 419

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 418 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 359

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           ||||| || |||||||| | |||  ||||||||||||| |||||||||||||||||||||
Sbjct: 358 taccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggag 299

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||
Sbjct: 298 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcaggacc 239

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||||||||| ||||||||||||||||| | ||||||| | |||||||||
Sbjct: 238 ttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttcctacccttcttg 179

                   
Query: 398 tcgccgcc 405
           || |||||
Sbjct: 178 tccccgcc 171



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctcc 469
           ||||||||||||||||||||| ||||| |||| |||||||
Sbjct: 137 cttctccgccttgggcttcttccccgcgggggccttctcc 98

---

>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3)
          Length = 1728

 Score =  432 bits (218), Expect = e-118
 Identities = 293/318 (92%)
 Strand = Plus / Minus

                                                                       
Query: 97  agaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 156
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 490 agaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgcc 431

                                                                       
Query: 157 agggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgtt 216
            ||||||||||||||||| |||||||||||||| ||||| |||| |||||||||||||||
Sbjct: 430 ggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttcttgtt 371

                                                                       
Query: 217 gtaccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaagga 276
            || |||||||||||||| |||||| | ||||||||||| ||||||||||||||||||||
Sbjct: 370 atagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaagga 311

                                                                       
Query: 277 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcac 336
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 310 gttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcac 251

                                                                       
Query: 337 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttctt 396
           ||||||||||||||||||||| |||||||||  |||||| |  ||||| || ||||||||
Sbjct: 250 cttgaagatgtagatcttgtaggtctccacggacttcttcgctttctttttccccttctt 191

                             
Query: 397 gtcgccgccgccctcctt 414
           | |  |||||||||||||
Sbjct: 190 gccctcgccgccctcctt 173



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctcc 469
           |||||| |||||||||||||| |||||||| | |||||||
Sbjct: 145 cttctcggccttgggcttcttccccgccggagccttctcc 106

---

>ref|NM_184403.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  430 bits (217), Expect = e-117
 Identities = 268/285 (94%)
 Strand = Plus / Minus

                                                                       
Query: 101 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 452 gtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 393

                                                                       
Query: 161 aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
           ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 392 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 333

                                                                       
Query: 221 cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
           ||||| |||||||| ||||| |||||||||||||| ||||| || |||||||||||||||
Sbjct: 332 cgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgatgaaggagttc 273

                                                                       
Query: 281 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 272 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 213

                                                        
Query: 341 aagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
           ||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 212 aagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 111 cttctccgccttgggcttcttccccgccggggccttctc 73

---

>ref|NM_184405.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  428 bits (216), Expect = e-117
 Identities = 258/272 (94%)
 Strand = Plus / Minus

                                                                       
Query: 104 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagg 163
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 449 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 390

                                                                       
Query: 164 acgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgc 223
           |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 389 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 330

                                                                       
Query: 224 gccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatg 283
           || |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 329 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 270

                                                                       
Query: 284 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttgaag 343
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 269 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 210

                                           
Query: 344 atgtagatcttgtacgtctccacgctcttctt 375
           |||||||||||||| ||||| |||||||||||
Sbjct: 209 atgtagatcttgtaggtctcgacgctcttctt 178



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 111 cttctccgccttgggcttcttccccgcgggggccttctc 73

---

>ref|NM_184374.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  428 bits (216), Expect = e-117
 Identities = 270/288 (93%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 455 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || || || |||||||| ||||| |||||||||||||| |||||||| ||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 276

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 216

                                                           
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
           |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 111 cttctccgccttgggcttcttccccgcgggggccttctc 73

---

>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds
          Length = 552

 Score =  428 bits (216), Expect = e-117
 Identities = 258/272 (94%)
 Strand = Plus / Minus

                                                                       
Query: 104 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagg 163
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 465 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 406

                                                                       
Query: 164 acgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgc 223
           |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 405 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 346

                                                                       
Query: 224 gccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatg 283
           || |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 345 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 286

                                                                       
Query: 284 atggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttgaag 343
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 285 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 226

                                           
Query: 344 atgtagatcttgtacgtctccacgctcttctt 375
           |||||||||||||| ||||| |||||||||||
Sbjct: 225 atgtagatcttgtaggtctcgacgctcttctt 194



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 127 cttctccgccttgggcttcttccccgcgggggccttctc 89

---

>ref|NM_184407.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  426 bits (215), Expect = e-116
 Identities = 260/275 (94%)
 Strand = Plus / Minus

                                                                       
Query: 101 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
           ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 452 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 393

                                                                       
Query: 161 aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
           ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 392 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 333

                                                                       
Query: 221 cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
           || || |||||||| | |||| ||||||||||||| ||||||||||||||||||||||||
Sbjct: 332 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 273

                                                                       
Query: 281 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 272 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 213

                                              
Query: 341 aagatgtagatcttgtacgtctccacgctcttctt 375
           ||||||||||||||||| ||||| |||||||||||
Sbjct: 212 aagatgtagatcttgtaggtctcgacgctcttctt 178



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| |||||||||| ||||||
Sbjct: 111 cttctccgccttgggcttcttccccgccggggccttctc 73

---

>ref|XM_483094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 453

 Score =  426 bits (215), Expect = e-116
 Identities = 272/291 (93%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 444 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 385

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           |||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 384 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 325

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
           ||  || |||||||| | |||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 324 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 265

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 264 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 205

                                                              
Query: 340 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcc 390
           ||||||||| |||||||| ||||| ||||||||||||| ||||||| ||||
Sbjct: 204 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttcctgcc 154

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  426 bits (215), Expect = e-116
 Identities = 272/291 (93%)
 Strand = Plus / Minus

                                                                            
Query: 100      ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 24254615 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 24254556

                                                                            
Query: 160      gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
                |||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 24254555 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 24254496

                                                                            
Query: 220      ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                ||  || |||||||| | |||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 24254495 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 24254436

                                                                            
Query: 280      catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
                |||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 24254435 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 24254376

                                                                   
Query: 340      gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcc 390
                ||||||||| |||||||| ||||| ||||||||||||| ||||||| ||||
Sbjct: 24254375 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttcctgcc 24254325



 Score =  178 bits (90), Expect = 1e-41
 Identities = 141/158 (89%)
 Strand = Plus / Minus

                                                                            
Query: 101      gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
                |||||||||||||||||||| |  |||||||||||||| |||||||||||||||||  ||
Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054

                                                                            
Query: 161      aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
                ||||||||||| || |||||||||||||||| ||| ||||||||||||||||||||||||
Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994

                                                      
Query: 221      cgcgccagcttggccgactcgccggcgagcttctcaaa 258
                || || |||||||| | ||| ||| | |||||||||||
Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagcttctcaaa 24250956



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                            
Query: 248      agcttctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 307
                |||||||  |||||| ||||||||||||||||||| |||||||||||||| ||||| |||
Sbjct: 21802131 agcttcttgaagatgccgttgatgaaggagttcataatggacatggccttagaggatatg 21802072

                                                                            
Query: 308      ccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacg 367
                || ||||     || | || ||| || |||||||| || ||||||||||| |||||||| 
Sbjct: 21802071 ccaatgttcatatgtatctacttcagtaccttgaacatatagatcttgtatgtctccaca 21802012

                     
Query: 368      ctctt 372
                |||||
Sbjct: 21802011 ctctt 21802007



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                            
Query: 266      ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacc 325
                ||||||||||||||||||||||||||| ||||||| || ||||| || ||  | |||| |
Sbjct: 11770145 ttgatgaaggagttcatgatggacatgaccttggacgatatgccaatatccagatgcatc 11770204

                                                                   
Query: 326      tgcttgagcaccttgaagatgtagatcttgtacgtctccacgctcttcttg 376
                | ||  || |||||||| |||| ||||||||| ||||| |  |||||||||
Sbjct: 11770205 tactccagtaccttgaatatgtcgatcttgtatgtctcaatactcttcttg 11770255



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                            
Query: 251      ttctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 310
                ||||||||||| |  |||||||||||||||||||||||| |  |||||| ||| |||| |
Sbjct: 17523204 ttctcaaagatatatttgatgaaggagttcatgatggacgtaaccttgggggatatgctg 17523263

                     
Query: 311      atgtc 315
                |||||
Sbjct: 17523264 atgtc 17523268



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 341      aagatgtagatcttgtacgtctccacgctc 370
                ||||||||||||||||||||||||| ||||
Sbjct: 13970925 aagatgtagatcttgtacgtctccatgctc 13970954



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 344      atgtagatcttgtacgtctccacgctc 370
                ||||||||||||||||| |||||||||
Sbjct: 19095973 atgtagatcttgtacgtttccacgctc 19095999



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 336     ccttgaagatgtagatcttgtacgtctccacgctc 370
               |||| ||||||||||||||||| ||||| ||||||
Sbjct: 2876125 cctttaagatgtagatcttgtaggtctctacgctc 2876159



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 247      gagcttctcaaagatgtcgttgatgaaggagttcatg 283
                ||||||||| ||||||| | ||| |||||||||||||
Sbjct: 11729269 gagcttctcgaagatgttgatgaagaaggagttcatg 11729305



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 424     caccttcttctccgccttgg 443
               ||||||||||||||||||||
Sbjct: 1716630 caccttcttctccgccttgg 1716649

---

>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0605H02
          Length = 175547

 Score =  426 bits (215), Expect = e-116
 Identities = 272/291 (93%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 120954 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 120895

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              |||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 120894 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 120835

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              ||  || |||||||| | |||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 120834 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 120775

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 120774 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 120715

                                                                 
Query: 340    gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcc 390
              ||||||||| |||||||| ||||| ||||||||||||| ||||||| ||||
Sbjct: 120714 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttcctgcc 120664



 Score =  178 bits (90), Expect = 1e-41
 Identities = 141/158 (89%)
 Strand = Plus / Minus

                                                                          
Query: 101    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
              |||||||||||||||||||| |  |||||||||||||| |||||||||||||||||  ||
Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393

                                                                          
Query: 161    aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
              ||||||||||| || |||||||||||||||| ||| ||||||||||||||||||||||||
Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333

                                                    
Query: 221    cgcgccagcttggccgactcgccggcgagcttctcaaa 258
              || || |||||||| | ||| ||| | |||||||||||
Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagcttctcaaa 117295

---

>ref|NM_184409.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 468

 Score =  420 bits (212), Expect = e-114
 Identities = 269/288 (93%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 461 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 402

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 401 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 342

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           || || || |||||||| | |||| ||||||||||||| |||||||||||||||||||||
Sbjct: 341 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 282

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 281 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 222

                                                           
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 385
           |||||||||||||||||||| ||||| ||||||||||| | |||||||
Sbjct: 221 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 174



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctc 468
           ||||||||||||||||||||| || ||||||| ||||||
Sbjct: 111 cttctccgccttgggcttcttcccggccggggccttctc 73

---

>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence
          Length = 568

 Score =  418 bits (211), Expect = e-114
 Identities = 280/303 (92%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||
Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggg 267

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||||||||||
Sbjct: 266 gaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggcttcttgttgta 207

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
           ||||||||||||||||| |||  | || |||||||| |||||||||||||||||||||||
Sbjct: 206 ccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttgatgaaggagtt 147

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||||||||||||||||| |||||||| ||||| |||||||||||||| ||||||||
Sbjct: 146 catgatggacatggccttggacgagatgccaatgtccgggtgcacctgcttcagcacctt 87

                                                                       
Query: 340 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtc 399
           |||||||||||||||||||||||||||   |||||| | ||||||||| |||||||| ||
Sbjct: 86  gaagatgtagatcttgtacgtctccaccgacttctttgccttcttcttccccttcttctc 27

              
Query: 400 gcc 402
           |||
Sbjct: 26  gcc 24

---

>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4)
          Length = 2361

 Score =  416 bits (210), Expect = e-113
 Identities = 279/302 (92%)
 Strand = Plus / Minus

                                                                        
Query: 104  aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagg 163
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1365 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 1306

                                                                        
Query: 164  acgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgc 223
            ||||||||||| || ||||||||||||||||| || |||||||||||||||||||| || 
Sbjct: 1305 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 1246

                                                                        
Query: 224  gccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatg 283
            || |||||||| | |||| | || |||||||| |||||||||||||||||||||||||||
Sbjct: 1245 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 1186

                                                                        
Query: 284  atggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttgaag 343
            ||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 1185 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 1126

                                                                        
Query: 344  atgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtcgccg 403
            |||||||||||||||||||| ||||||||||||| ||||||||| |||||||| ||||||
Sbjct: 1125 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgccg 1066

              
Query: 404  cc 405
            ||
Sbjct: 1065 cc 1064

---

>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence
          Length = 836

 Score =  414 bits (209), Expect = e-112
 Identities = 275/297 (92%)
 Strand = Plus / Minus

                                                                       
Query: 101 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
           |||||||||||||| ||||| ||||| || |||||||||||||||||||||||||| || 
Sbjct: 542 gtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggt 483

                                                                       
Query: 161 aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
           ||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| 
Sbjct: 482 aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 423

                                                                       
Query: 221 cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
           || || |||||||| | |||  ||||||||||||| |||||||||||||||||||| |||
Sbjct: 422 cgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattc 363

                                                                       
Query: 281 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 362 atgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttg 303

                                                                    
Query: 341 aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           ||||||||||||||||| |||||||||||||||||||  ||||||||||||||||||
Sbjct: 302 aagatgtagatcttgtaggtctccacgctcttcttggctttcttcttgcccttcttg 246

---

>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence
          Length = 706

 Score =  414 bits (209), Expect = e-112
 Identities = 296/325 (91%)
 Strand = Plus / Minus

                                                                       
Query: 92  taggcagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 151
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 513 taggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 454

                                                                       
Query: 152 tcgccagggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttc 211
           || || || ||||||||||||||||||||||||||||| ||||| |||||||| ||||||
Sbjct: 453 tccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggcttc 394

                                                                       
Query: 212 ttgttgtaccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatg 271
           ||||| || ||||| |||||||| | |||  | ||||||||||| ||||| ||||| |||
Sbjct: 393 ttgttatagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgttaatg 334

                                                                       
Query: 272 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttg 331
           |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 333 aaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctgcttc 274

                                                                       
Query: 332 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccc 391
           |||||||||||||||||||||||||| ||||||||||||||||||  |||||||||||||
Sbjct: 273 agcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttcttgccc 214

                                    
Query: 392 ttcttgtcgccgccgccctccttgg 416
            ||||| |  |||||||||||||||
Sbjct: 213 ctcttgccctcgccgccctccttgg 189

---

>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence
          Length = 574

 Score =  404 bits (204), Expect = e-109
 Identities = 273/296 (92%)
 Strand = Plus / Minus

                                                                       
Query: 92  taggcagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 151
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 305 taggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 246

                                                                       
Query: 152 tcgccagggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttc 211
           || || || ||||||||||||||||||||||||||||| ||||| |||||||| ||||||
Sbjct: 245 tccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggcttc 186

                                                                       
Query: 212 ttgttgtaccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatg 271
           ||||| || |||||||||||||| | |||  | ||||||||||| ||||| ||||| |||
Sbjct: 185 ttgttatagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgttaatg 126

                                                                       
Query: 272 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttg 331
           |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 125 aaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctgcttc 66

                                                                   
Query: 332 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttctt 387
           |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||
Sbjct: 65  agcaccttgaagatgtagatcttgtaggtctccacgctcttcttggccttcttctt 10

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  383 bits (193), Expect = e-103
 Identities = 291/323 (90%), Gaps = 3/323 (0%)
 Strand = Plus / Minus

                                                                           
Query: 100     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265

                                                                           
Query: 160     gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205

                                                                           
Query: 220     ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                || || ||   ||| | |||    ||||||||||| |||||||||||||||||||||||
Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145

                                                                           
Query: 280     catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
               |||||| |||||||||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 9465144 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9465085

                                                                           
Query: 340     gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtc 399
               |||||||||||||||||| ||||| ||||||||||| | ||||||| | |||||||||||
Sbjct: 9465084 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccccttcttgtc 9465025

                                      
Query: 400     gc---cgccgccctccttggacg 419
               ||   ||||||||||||||||||
Sbjct: 9465024 gccggcgccgccctccttggacg 9465002



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                            
Query: 257      aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
                ||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| ||||| 
Sbjct: 11567069 aagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgccaatgtcc 11567128

                                                                  
Query: 317      gggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccac 366
                 | |  | ||  || || |||||||| ||||||||||| |||||||||||
Sbjct: 11567129 agatttatctatttcagtaccttgaatatgtagatcttatacgtctccac 11567178



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                          
Query: 411     ccttggacgccggcaccttcttctccgccttgggcttcttgcccgccggggtcttctcc 469
               |||| |||||||||| |  ||||||||||||||||||||| |||||||| | |||||||
Sbjct: 9464998 ccttcgacgccggcagccgcttctccgccttgggcttcttccccgccggcgccttctcc 9464940



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                            
Query: 335      accttgaagatgtagatcttgtacgtct 362
                ||||||||||||||||||||||||||||
Sbjct: 25627644 accttgaagatgtagatcttgtacgtct 25627671



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                      
Query: 246      cgagcttctcaaagatgtcgttgatgaaggagttcatg 283
                |||||||||| |||||||||  ||||||||||||||||
Sbjct: 25627557 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25627594



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 244      ggcgagcttctcaaagatgtcgttgatgaa 273
                ||||||||||||||||||||| ||||||||
Sbjct: 23486139 ggcgagcttctcaaagatgtctttgatgaa 23486110



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 334      caccttgaagatgtagatcttgtacgtct 362
                ||||||||| |||||||||||||| ||||
Sbjct: 28216459 caccttgaaaatgtagatcttgtaggtct 28216431



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 338      ttgaagatgtagatcttgtacgtct 362
                |||||||||||||||||||| ||||
Sbjct: 27003474 ttgaagatgtagatcttgtaggtct 27003450



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 337      cttgaagatgtagatcttgtacgtc 361
                |||||||||||||||||| ||||||
Sbjct: 24070005 cttgaagatgtagatcttatacgtc 24069981



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 334      caccttgaagatgtagatct 353
                ||||||||||||||||||||
Sbjct: 27003565 caccttgaagatgtagatct 27003546

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  383 bits (193), Expect = e-103
 Identities = 291/323 (90%), Gaps = 3/323 (0%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               || || ||   ||| | |||    ||||||||||| |||||||||||||||||||||||
Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||| |||||||||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 162544 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 162485

                                                                          
Query: 340    gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtc 399
              |||||||||||||||||| ||||| ||||||||||| | ||||||| | |||||||||||
Sbjct: 162484 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccccttcttgtc 162425

                                     
Query: 400    gc---cgccgccctccttggacg 419
              ||   ||||||||||||||||||
Sbjct: 162424 gccggcgccgccctccttggacg 162402



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                         
Query: 411    ccttggacgccggcaccttcttctccgccttgggcttcttgcccgccggggtcttctcc 469
              |||| |||||||||| |  ||||||||||||||||||||| |||||||| | |||||||
Sbjct: 162398 ccttcgacgccggcagccgcttctccgccttgggcttcttccccgccggcgccttctcc 162340

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  383 bits (193), Expect = e-103
 Identities = 291/323 (90%), Gaps = 3/323 (0%)
 Strand = Plus / Minus

                                                                           
Query: 100     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386

                                                                           
Query: 160     gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326

                                                                           
Query: 220     ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                || || ||   ||| | |||    ||||||||||| |||||||||||||||||||||||
Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266

                                                                           
Query: 280     catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
               |||||| |||||||||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 9463265 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9463206

                                                                           
Query: 340     gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtc 399
               |||||||||||||||||| ||||| ||||||||||| | ||||||| | |||||||||||
Sbjct: 9463205 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccccttcttgtc 9463146

                                      
Query: 400     gc---cgccgccctccttggacg 419
               ||   ||||||||||||||||||
Sbjct: 9463145 gccggcgccgccctccttggacg 9463123



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                            
Query: 257      aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
                ||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| ||||| 
Sbjct: 11563832 aagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgccaatgtcc 11563891

                                                                  
Query: 317      gggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccac 366
                 | |  | ||  || || |||||||| ||||||||||| |||||||||||
Sbjct: 11563892 agatttatctatttcagtaccttgaatatgtagatcttatacgtctccac 11563941



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                          
Query: 411     ccttggacgccggcaccttcttctccgccttgggcttcttgcccgccggggtcttctcc 469
               |||| |||||||||| |  ||||||||||||||||||||| |||||||| | |||||||
Sbjct: 9463119 ccttcgacgccggcagccgcttctccgccttgggcttcttccccgccggcgccttctcc 9463061



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                            
Query: 335      accttgaagatgtagatcttgtacgtct 362
                ||||||||||||||||||||||||||||
Sbjct: 25718953 accttgaagatgtagatcttgtacgtct 25718980



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                      
Query: 246      cgagcttctcaaagatgtcgttgatgaaggagttcatg 283
                |||||||||| |||||||||  ||||||||||||||||
Sbjct: 25718866 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25718903



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 244      ggcgagcttctcaaagatgtcgttgatgaa 273
                ||||||||||||||||||||| ||||||||
Sbjct: 23479167 ggcgagcttctcaaagatgtctttgatgaa 23479138



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 334      caccttgaagatgtagatcttgtacgtct 362
                ||||||||| |||||||||||||| ||||
Sbjct: 28307783 caccttgaaaatgtagatcttgtaggtct 28307755



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 338      ttgaagatgtagatcttgtacgtct 362
                |||||||||||||||||||| ||||
Sbjct: 27094797 ttgaagatgtagatcttgtaggtct 27094773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 337      cttgaagatgtagatcttgtacgtc 361
                |||||||||||||||||| ||||||
Sbjct: 23987474 cttgaagatgtagatcttatacgtc 23987450



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 334      caccttgaagatgtagatct 353
                ||||||||||||||||||||
Sbjct: 27094888 caccttgaagatgtagatct 27094869

---

>ref|NM_190523.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 420

 Score =  369 bits (186), Expect = 6e-99
 Identities = 309/350 (88%)
 Strand = Plus / Minus

                                                                       
Query: 101 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 410 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 351

                                                                       
Query: 161 aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
           |||||||||||||| |||||||||||||| ||||| |||||||| |||||||||||||| 
Sbjct: 350 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 291

                                                                       
Query: 221 cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
           || || ||   ||| | |||   |||||||||||| ||||| ||||||||||| ||||||
Sbjct: 290 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 231

                                                                       
Query: 281 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||||| |||||||||||||| || || ||||| ||||| |||||||||||||| ||||||
Sbjct: 230 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 171

                                                                       
Query: 341 aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtcg 400
           || ||||||||||| || || || ||||||||||||| ||||||||| |||||||| |||
Sbjct: 170 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 111

                                                             
Query: 401 ccgccgccctccttggacgccggcaccttcttctccgccttgggcttctt 450
           ||||||||||||||||   ||||||||  |||||| ||||||||||||||
Sbjct: 110 ccgccgccctccttggcgcccggcacccgcttctcggccttgggcttctt 61

---

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  369 bits (186), Expect = 6e-99
 Identities = 309/350 (88%)
 Strand = Plus / Plus

                                                                         
Query: 101   gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
             ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 20167 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 20226

                                                                         
Query: 161   aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
             |||||||||||||| |||||||||||||| ||||| |||||||| |||||||||||||| 
Sbjct: 20227 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 20286

                                                                         
Query: 221   cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
             || || ||   ||| | |||   |||||||||||| ||||| ||||||||||| ||||||
Sbjct: 20287 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 20346

                                                                         
Query: 281   atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             ||||| |||||||||||||| || || ||||| ||||| |||||||||||||| ||||||
Sbjct: 20347 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 20406

                                                                         
Query: 341   aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtcg 400
             || ||||||||||| || || || ||||||||||||| ||||||||| |||||||| |||
Sbjct: 20407 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 20466

                                                               
Query: 401   ccgccgccctccttggacgccggcaccttcttctccgccttgggcttctt 450
             ||||||||||||||||   ||||||||  |||||| ||||||||||||||
Sbjct: 20467 ccgccgccctccttggcgcccggcacccgcttctcggccttgggcttctt 20516

---

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  369 bits (186), Expect = 6e-99
 Identities = 309/350 (88%)
 Strand = Plus / Plus

                                                                          
Query: 101    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 106120 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 106179

                                                                          
Query: 161    aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
              |||||||||||||| |||||||||||||| ||||| |||||||| |||||||||||||| 
Sbjct: 106180 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 106239

                                                                          
Query: 221    cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
              || || ||   ||| | |||   |||||||||||| ||||| ||||||||||| ||||||
Sbjct: 106240 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 106299

                                                                          
Query: 281    atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
              ||||| |||||||||||||| || || ||||| ||||| |||||||||||||| ||||||
Sbjct: 106300 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 106359

                                                                          
Query: 341    aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtcg 400
              || ||||||||||| || || || ||||||||||||| ||||||||| |||||||| |||
Sbjct: 106360 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 106419

                                                                
Query: 401    ccgccgccctccttggacgccggcaccttcttctccgccttgggcttctt 450
              ||||||||||||||||   ||||||||  |||||| ||||||||||||||
Sbjct: 106420 ccgccgccctccttggcgcccggcacccgcttctcggccttgggcttctt 106469

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  337 bits (170), Expect = 2e-89
 Identities = 310/356 (87%), Gaps = 3/356 (0%)
 Strand = Plus / Minus

                                                                         
Query: 98    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 69871 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 69812

                                                                         
Query: 158   gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
             ||||||||||| || || |||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 69811 gggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttgttg 69752

                                                                         
Query: 218   taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
             ||||  || ||| | || | |||     |||||||||| || |||||||||| |||||| 
Sbjct: 69751 tacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaaggaa 69692

                                                                         
Query: 278   ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
             ||||||||||||||||||||||||||||| || ||||| || ||||||||||||||||||
Sbjct: 69691 ttcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttgagcacc 69632

                                                                         
Query: 338   ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
             |||||||||||||| || || ||||||||||| ||||| | ||||||||| |||||||||
Sbjct: 69631 ttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttccccttcttg 69572

                                                                     
Query: 398   tcgcc---gccgccctccttggacgccggcaccttcttctccgccttgggcttctt 450
             || ||   ||| |||| |||||||| ||| | || ||||||||||||||| |||||
Sbjct: 69571 tcaccggtgccaccctacttggacgtcggtagctgcttctccgccttgggtttctt 69516

---

>ref|XM_475367.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 375

 Score =  321 bits (162), Expect = 1e-84
 Identities = 267/302 (88%)
 Strand = Plus / Minus

                                                                       
Query: 98  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 368 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 309

                                                                       
Query: 158 gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
           ||||||||||| || || |||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 308 gggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttcttgttg 249

                                                                       
Query: 218 taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
           ||||  || ||| | || | |||     |||||||||| || |||||||||| |||||| 
Sbjct: 248 tacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacgaaggaa 189

                                                                       
Query: 278 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
           ||||||||||||||||||||||||||||| || ||||| || ||||||||||||||||||
Sbjct: 188 ttcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttgagcacc 129

                                                                       
Query: 338 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttg 397
           |||||||||||||| || || ||||||||||| ||||| | ||||||||| |||||||||
Sbjct: 128 ttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttccccttcttg 69

             
Query: 398 tc 399
           ||
Sbjct: 68  tc 67

---

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  319 bits (161), Expect = 5e-84
 Identities = 282/323 (87%), Gaps = 12/323 (3%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             |||||||||||| |||||||||| |||||| ||||| |||  | ||||||||||||||||
Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              || || || | ||| | |||    ||||||||||| |||||||||||||||||||||||
Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||| ||||||||||||||||||||||||||||| |||||||||||||| || |||||
Sbjct: 75306 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 75365

                                                                         
Query: 340   gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcccttcttgtc 399
             ||||||||||||         ||| ||||||||||| | ||||||| | |||||||||||
Sbjct: 75366 gaagatgtagat---------ctcgacgctcttcttcgccttcttcctccccttcttgtc 75416

                                    
Query: 400   gc---cgccgccctccttggacg 419
             ||   ||||||||||||||||||
Sbjct: 75417 gccggcgccgccctccttggacg 75439



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 430   cttctccgccttgggcttctt 450
             |||||||||||||||||||||
Sbjct: 75462 cttctccgccttgggcttctt 75482

---

>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds
          Length = 2901

 Score =  297 bits (150), Expect = 2e-77
 Identities = 249/282 (88%)
 Strand = Plus / Minus

                                                                        
Query: 108  tggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggaggacga 167
            |||| ||||||||||| ||||||||||||||||||||||| |||||||| || | ||| |
Sbjct: 1985 tggtaacggccttggttccctcggagacggcgtgcttggcaagctcgcctggaaagacaa 1926

                                                                        
Query: 168  ggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcgcca 227
            |||||||||  |||||||||||||| || ||||||||||||||||||||||| || || |
Sbjct: 1925 ggcgcacggcagtctggatctcccgagaggtgatggtgggcttcttgttgtagcgtgcga 1866

                                                                        
Query: 228  gcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatgatgg 287
            |||| |||||||| |||||||||||||| |||||||||||||||| |||||| |||||||
Sbjct: 1865 gctttgccgactctccggcgagcttctcgaagatgtcgttgatgatggagttgatgatgg 1806

                                                                        
Query: 288  acatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttgaagatgt 347
            |||| |  ||||||||||| || ||||  ||||  | |||||||||||||||||||||||
Sbjct: 1805 acattgatttggaggagatacccatgttcgggtcaatctgcttgagcaccttgaagatgt 1746

                                                      
Query: 348  agatcttgtacgtctccacgctcttcttggacttcttcttgc 389
            ||||||||||||||||   ||||||||||| |||||||||||
Sbjct: 1745 agatcttgtacgtctcgttgctcttcttggccttcttcttgc 1704

---

>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B
          Length = 492

 Score =  281 bits (142), Expect = 1e-72
 Identities = 241/274 (87%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           ||||||||| |  ||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
            || |||||   ||  | |||   ||| |||||||| ||||||||||||||||| |||||
Sbjct: 332 gcgggccaggcgggaggcctcctgggccagcttctcgaagatgtcgttgatgaacgagtt 273

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| ||||||   ||||| |||||||| ||||| |||||||| || |||||
Sbjct: 272 catgatccccatcgccttgctcgagatcccgatgtccgggtggacctgcttcaggacctt 213

                                             
Query: 340 gaagatgtagatcttgtacgtctccacgctcttc 373
           ||||||||||||||||||||||||||||||||||
Sbjct: 212 gaagatgtagatcttgtacgtctccacgctcttc 179



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 430 cttctccgccttgggcttcttgcccgccggggtcttctcc 469
           |||||||||||| |||||||| ||||| |||| |||||||
Sbjct: 110 cttctccgccttcggcttcttccccgcgggggccttctcc 71

---

>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds
          Length = 627

 Score =  274 bits (138), Expect = 2e-70
 Identities = 240/274 (87%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||
Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           ||| ||||| |  ||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
            || |||||    |  |||||   |||||||||||| |||||||||||||||||||||||
Sbjct: 399 gcgggccaggcgagaggactcctgggcgagcttctcgaagatgtcgttgatgaaggagtt 340

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||||||||||   ||||| || ||||| ||||| |||||||| ||||||||
Sbjct: 339 catgatccccatggccttgctcgagatccctatgtccgggtggacctgcttcagcacctt 280

                                             
Query: 340 gaagatgtagatcttgtacgtctccacgctcttc 373
           ||| ||||||||||||||||||||||||| ||||
Sbjct: 279 gaatatgtagatcttgtacgtctccacgcccttc 246



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 418 cgccggcaccttcttctccgccttgggcttcttgcccgccgggg 461
           ||||||||  ||||||||||||||||||||||| |||| |||||
Sbjct: 198 cgccggcagtttcttctccgccttgggcttctttcccggcgggg 155

---

>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds
          Length = 410

 Score =  268 bits (135), Expect = 2e-68
 Identities = 186/203 (91%)
 Strand = Plus / Minus

                                                                       
Query: 101 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
           ||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||
Sbjct: 203 gtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgagctcgccgggg 144

                                                                       
Query: 161 aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
           ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 143 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 84

                                                                       
Query: 221 cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
           |  || |||||||| ||||| || || |  ||||| ||||||||| ||||||||||||||
Sbjct: 83  ctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgatgaaggagttc 24

                                  
Query: 281 atgatggacatggccttggagga 303
           ||||||||||||||| |||||||
Sbjct: 23  atgatggacatggccctggagga 1

---

>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds
          Length = 427

 Score =  264 bits (133), Expect = 2e-67
 Identities = 139/141 (98%)
 Strand = Plus / Minus

                                                                       
Query: 245 gcgagcttctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggag 304
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 144 gcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggag 85

                                                                       
Query: 305 atgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcc 364
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 84  atgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcc 25

                                
Query: 365 acgctcttcttggacttcttc 385
           ||||||||||||| |||||||
Sbjct: 24  acgctcttcttggccttcttc 4



 Score =  190 bits (96), Expect = 3e-45
 Identities = 114/120 (95%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           ||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||
Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           ||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  254 bits (128), Expect = 2e-64
 Identities = 264/308 (85%), Gaps = 6/308 (1%)
 Strand = Plus / Plus

                                                                        
Query: 98   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
            |||||||||||||| ||||||||||||||||| || || ||||||||||| |||||||||
Sbjct: 3040 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcca 3099

                                                                        
Query: 158  gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
            || || || |||||||||| |||||||||||| ||||| || | ||||||||||||||||
Sbjct: 3100 ggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgttg 3159

                                                                        
Query: 218  taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
            || ||   ||||||||  | ||||  ||| | |||||||||||||||||||||||||  |
Sbjct: 3160 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 3219

                                                                        
Query: 278  ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
            |||||||| ||||||||||||  |  ||||||| ||||||||||||||||||||||||||
Sbjct: 3220 ttcatgatagacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3279

                                                                        
Query: 338  ttgaagatgtagatcttgtacgtctcca---cgctcttcttggacttcttcttgcccttc 394
            ||| ||||||| | |||||| |||||||   ||||||||||   |||||||||| |||||
Sbjct: 3280 ttgtagatgtacagcttgtaggtctccacggcgctcttctt---cttcttcttgtccttc 3336

                    
Query: 395  ttgtcgcc 402
            || |||||
Sbjct: 3337 ttctcgcc 3344

---

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score =  254 bits (128), Expect = 2e-64
 Identities = 264/308 (85%), Gaps = 6/308 (1%)
 Strand = Plus / Minus

                                                                        
Query: 98   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
            |||||||||||||| ||||||||||||||||| || || ||||||||||| |||||||| 
Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152

                                                                        
Query: 158  gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
            || || || |||||||||| |||||||||||| ||||| || | ||||||||||||||||
Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092

                                                                        
Query: 218  taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
            || ||   ||||||||  | ||||  ||| | |||||||||||||||||||||||||  |
Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032

                                                                        
Query: 278  ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
            |||||||||||||||||||||  |  ||||||| ||||||||||||||||||||||||||
Sbjct: 4031 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3972

                                                                        
Query: 338  ttgaagatgtagatcttgtacgtctcca---cgctcttcttggacttcttcttgcccttc 394
            ||| ||||||| | |||||| |||||||   ||||||||||   |||||||||| |||||
Sbjct: 3971 ttgtagatgtacagcttgtaggtctccacggcgctcttctt---cttcttcttgtccttc 3915

                    
Query: 395  ttgtcgcc 402
            || |||||
Sbjct: 3914 ttctcgcc 3907

---

>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds
          Length = 375

 Score =  252 bits (127), Expect = 9e-64
 Identities = 148/155 (95%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 310
           ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 359 ttctcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggagatgccg 300

                                                                       
Query: 311 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacgctc 370
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |
Sbjct: 299 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacggac 240

                                              
Query: 371 ttcttggacttcttcttgcccttcttgtcgccgcc 405
           ||||| | |||||||||||||||||| ||||||||
Sbjct: 239 ttctttgccttcttcttgcccttcttctcgccgcc 205



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 429 tcttctccgccttgggcttcttgcccgccggggtcttct 467
           ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 172 tcttccccgccttgggcttcttggcggcgggggtcttct 134

---

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  238 bits (120), Expect = 1e-59
 Identities = 268/316 (84%), Gaps = 6/316 (1%)
 Strand = Plus / Plus

                                                                        
Query: 98   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
            |||||||||||||| ||||||||||||||||| || || ||||||||||| |||||||| 
Sbjct: 2338 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 2397

                                                                        
Query: 158  gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
            || || || |||||||| | |||||||||||| ||||| || | ||||||||||||||||
Sbjct: 2398 ggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgttg 2457

                                                                        
Query: 218  taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
            || ||   ||||||||  | |||   ||| | |||||||||||||||||||||||||  |
Sbjct: 2458 tagcggctcagcttggaggcctcagtggccaccttctcaaagatgtcgttgatgaagctg 2517

                                                                        
Query: 278  ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
            |||||||||||||||||||||  |  ||||||| ||||||||||||||||||||||||||
Sbjct: 2518 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2577

                                                                        
Query: 338  ttgaagatgtagatcttgtacgtctcca---cgctcttcttggacttcttcttgcccttc 394
            ||| ||||||| | |||||| |||||||   ||||||||||   |||||||||  |||||
Sbjct: 2578 ttgtagatgtacagcttgtaggtctccacggcgctcttctt---cttcttcttatccttc 2634

                            
Query: 395  ttgtcgccgccgccct 410
            || |||||| ||||||
Sbjct: 2635 ttctcgccgtcgccct 2650

---

>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds
          Length = 402

 Score =  236 bits (119), Expect = 5e-59
 Identities = 157/169 (92%), Gaps = 3/169 (1%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 310
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 386 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 327

                                                                       
Query: 311 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacgctc 370
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||  |
Sbjct: 326 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacggac 267

                                                            
Query: 371 ttcttggacttcttcttgcccttcttgt---cgccgccgccctccttgg 416
           ||||||  |||||||||   ||||||||   ||||||||||||||||||
Sbjct: 266 ttcttgttcttcttcttcgacttcttgtccacgccgccgccctccttgg 218

---

>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds
          Length = 478

 Score =  226 bits (114), Expect = 5e-56
 Identities = 234/274 (85%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           ||||||||| || ||||||||||| || || || || ||||||||||||||||| |||||
Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           ||| ||||| | ||||||||||||||| |||||||| ||||| || || |||||||||||
Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
           || ||| ||| ||| ||||||   |||||||||||| || |||||||||||||||  |||
Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||||||||||  |||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 94  catgattcccatggccttgctggagatcccgatgtcagggtggacctgcttcagcacctt 35

                                             
Query: 340 gaagatgtagatcttgtacgtctccacgctcttc 373
           ||| ||||| |||||||| ||||| |||||||||
Sbjct: 34  gaaaatgtaaatcttgtaggtctcaacgctcttc 1

---

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  218 bits (110), Expect = 1e-53
 Identities = 230/270 (85%)
 Strand = Plus / Plus

                                                                        
Query: 98   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcca 157
            |||||||||||||| ||||||||||||||||| || || |||||||| || ||||| || 
Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515

                                                                        
Query: 158  gggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 217
            || || || |||||||||| |||||||||||| || || || | ||||||||||||||||
Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575

                                                                        
Query: 218  taccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggag 277
            || ||   ||||||||  | ||||  ||| | |||||||||||||||||||||||||  |
Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635

                                                                        
Query: 278  ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacc 337
            |||||||||||||||||||||  |  ||||||| ||||||||||||||||||||||||||
Sbjct: 2636 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2695

                                          
Query: 338  ttgaagatgtagatcttgtacgtctccacg 367
            ||| | ||||| | |||||| |||||||||
Sbjct: 2696 ttgtatatgtacagcttgtaggtctccacg 2725

---

>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds
          Length = 397

 Score =  216 bits (109), Expect = 5e-53
 Identities = 133/141 (94%)
 Strand = Plus / Minus

                                                                       
Query: 251 ttctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 310
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 322

                                                                       
Query: 311 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacgctc 370
           ||||||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||||
Sbjct: 321 atgtcggggtggacctgcttgagcaccttgaaaatgtagatcttgtaggtctcgacgctc 262

                                
Query: 371 ttcttggacttcttcttgccc 391
           ||||||  ||||||| |||||
Sbjct: 261 ttcttgcccttcttcctgccc 241

---

>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC483173), mRNA
          Length = 2193

 Score =  200 bits (101), Expect = 3e-48
 Identities = 206/241 (85%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 266

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 265 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 206

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 205 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 146

            
Query: 340 g 340
           |
Sbjct: 145 g 145

---

>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC483164), mRNA
          Length = 659

 Score =  200 bits (101), Expect = 3e-48
 Identities = 206/241 (85%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 332 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 273

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 272 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 213

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 212 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 153

            
Query: 340 g 340
           |
Sbjct: 152 g 152

---

>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 1 (LOC483169), mRNA
          Length = 432

 Score =  200 bits (101), Expect = 3e-48
 Identities = 206/241 (85%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 320

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 319 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 260

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 259 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 200

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 199 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 140

            
Query: 340 g 340
           |
Sbjct: 139 g 139

---

>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 2 (LOC483169), mRNA
          Length = 516

 Score =  200 bits (101), Expect = 3e-48
 Identities = 206/241 (85%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 237 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 178

            
Query: 340 g 340
           |
Sbjct: 177 g 177

---

>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 5 (LOC483170), mRNA
          Length = 415

 Score =  200 bits (101), Expect = 3e-48
 Identities = 206/241 (85%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 4 (LOC483170), mRNA
          Length = 597

 Score =  200 bits (101), Expect = 3e-48
 Identities = 206/241 (85%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| ||||||||||    |||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgta 298

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 297 atgcgccaggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 238

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 237 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 178

            
Query: 340 g 340
           |
Sbjct: 177 g 177

---

>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full
           insert sequence
          Length = 288

 Score =  190 bits (96), Expect = 3e-45
 Identities = 111/116 (95%)
 Strand = Plus / Minus

                                                                       
Query: 101 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 124 gtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 65

                                                                   
Query: 161 aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgtt 216
           ||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||
Sbjct: 64  aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgtt 9

---

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score =  184 bits (93), Expect = 2e-43
 Identities = 228/273 (83%)
 Strand = Plus / Minus

                                                                        
Query: 91   ttaggcagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 150
            |||||| || |||||||||||||| ||||||||||||||||| |||||||||||||| ||
Sbjct: 1593 ttaggccgacgtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccag 1534

                                                                        
Query: 151  ctcgccagggaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggctt 210
            |||||| || || || |||||||| |  ||||| || || || ||||| | |||||||||
Sbjct: 1533 ctcgcccggaagaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggctt 1474

                                                                        
Query: 211  cttgttgtaccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgat 270
            ||||||||| ||   ||||||||  | ||||  ||| | |||||||||||||||||||||
Sbjct: 1473 cttgttgtagcggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgat 1414

                                                                        
Query: 271  gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 330
            ||||  |||||| || ||||||||||| |||  ||||||| | |||||||||||||||||
Sbjct: 1413 gaagctgttcataatcgacatggccttcgagctgatgccggtatcggggtgcacctgctt 1354

                                             
Query: 331  gagcaccttgaagatgtagatcttgtacgtctc 363
             | ||||||| | ||||| | |||||| |||||
Sbjct: 1353 caacaccttgtaaatgtaaagcttgtaggtctc 1321

---

>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds
          Length = 1442

 Score =  180 bits (91), Expect = 3e-42
 Identities = 220/263 (83%)
 Strand = Plus / Minus

                                                                        
Query: 101  gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggg 160
            |||||||||||||| |||||||| |||||||| || ||||||||||| |||||||| || 
Sbjct: 1264 gtgaacttggtgacagccttggttccctcggacacagcgtgcttggccagctcgcctggc 1205

                                                                        
Query: 161  aggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtac 220
            ||||| ||||||||||  |||||||| || || ||||||| ||| |||||||||||||| 
Sbjct: 1204 aggacaaggcgcacggcagtctggatttcgcgagacgtgacggtcggcttcttgttgtaa 1145

                                                                        
Query: 221  cgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttc 280
            ||    ||||| |  | ||||  ||||| ||||||||| |||||||||||||||  ||||
Sbjct: 1144 cggctaagctttgaagcctcggtggcgaccttctcaaatatgtcgttgatgaagctgttc 1085

                                                                        
Query: 281  atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
            ||||||  ||| |||||||||  ||||||| |||| |||||||||||||| |||||||| 
Sbjct: 1084 atgatgctcatcgccttggagctgatgccggtgtcagggtgcacctgcttcagcacctta 1025

                                   
Query: 341  aagatgtagatcttgtacgtctc 363
             ||||||| | |||||| |||||
Sbjct: 1024 tagatgtacagcttgtaggtctc 1002

---

>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA
          Length = 753

 Score =  176 bits (89), Expect = 4e-41
 Identities = 203/241 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 325

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 324 cagcagcaggcgcacggccgtctggatctcgcgggaggtgatggtggagcgcttgttgta 265

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 264 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 205

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 204 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacctt 145

            
Query: 340 g 340
           |
Sbjct: 144 g 144

---

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
             (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
             IgG, high affinity Ia, receptor for (CD64), a novel gene
             similar to histone 2, H2be (HIST2H2BE), a novel gene
             similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
             histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
             HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
             pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
             (HIST2H2BC), a novel gene similar to histone 2, H2aa
             (HIST2H2AA), a novel gene similar to histone 2, H3c
             (HIST2H3C), a novel gene similar to histone 1, H4
             (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
             HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
             histone 2, H2ab, a novel protein similar to histone 2, a
             novel gene, the SV2A gene for synaptic vesicle
             glycoprotein 2A, the 3' end of the SF3B4 gene for splicing
             factor 3b, subunit 4, 49kDa and five CpG islands, complete
             sequence
          Length = 188956

 Score =  176 bits (89), Expect = 4e-41
 Identities = 203/241 (84%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 73729

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 73730 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 73789

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 73790 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 73849

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 73850 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacctt 73909

              
Query: 340   g 340
             |
Sbjct: 73910 g 73910



 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Plus

                                                                          
Query: 105    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
              |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 112197

                                                                          
Query: 165    cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
                ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 112198 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 112256

                                                                          
Query: 225    ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
              ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 112257 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 112316

                                                                      
Query: 285    tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
              ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 112317 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 112372



 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                          
Query: 105    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
              |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 105069

                                                                          
Query: 165    cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
                ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 105068 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 105010

                                                                          
Query: 225    ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
              ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 105009 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 104950

                                                                      
Query: 285    tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
              ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 104949 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 104894



 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                          
Query: 257    aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
              ||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |||||
Sbjct: 148139 aagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggtgtcg 148198

                                      
Query: 317    gggtgcacctgcttgagcaccttg 340
              ||||| |||||||| |||||||||
Sbjct: 148199 gggtggacctgcttcagcaccttg 148222



 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 148041

                                                             
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
               || |  ||||||||||  ||||||||||| ||||| ||||||||||
Sbjct: 148042 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 148088

---

>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA
          Length = 1858

 Score =  176 bits (89), Expect = 4e-41
 Identities = 203/241 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 283

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 282 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 223

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 222 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacctt 163

            
Query: 340 g 340
           |
Sbjct: 162 g 162

---

>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639
           IMAGE:5224812), complete cds
          Length = 1858

 Score =  176 bits (89), Expect = 4e-41
 Identities = 203/241 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtggagcgcttgttgta 283

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 282 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 223

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 222 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacctt 163

            
Query: 340 g 340
           |
Sbjct: 162 g 162

---

>ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488253), mRNA
          Length = 384

 Score =  174 bits (88), Expect = 2e-40
 Identities = 211/252 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 253

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 252 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 193

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 192 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 133

                       
Query: 340 gaagatgtagat 351
             ||||||||||
Sbjct: 132 atagatgtagat 121

---

>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four
              novel genes, a novel gene (MGC57827), a ribosomal protein
              L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C)
              pseudogene, the HIST2H2BB gene for histone 2 H2bb, the
              FCGR1B gene for Fc fragment of IgG high affinity Ib
              receptor for (CD64) and three CpG islands, complete
              sequence
          Length = 189539

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 159196

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 159195 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 159136

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 159135 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 159076

                                                                         
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
              |||||||  |||||||||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 159075 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacct 159017

---

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 68592 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 68651

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 68652 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtggagcgcttgttgta 68711

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 68712 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 68771

                                                                        
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
             |||||||  ||||| |||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 68772 catgatgcccatggtcttggacgagatgccggtgtcggggtggacctgcttcagcacct 68830

---

>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1
          Length = 1137

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                                                      
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 568 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacct 510

---

>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1
          Length = 1137

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                                                      
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 568 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacct 510

---

>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence
          Length = 1137

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                                                      
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 568 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacct 510

---

>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence
          Length = 1137

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 629

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 628 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 569

                                                                      
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 568 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacct 510

---

>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:126031 IMAGE:40032208), complete cds
          Length = 520

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 378 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 319

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||| ||||||||||    |||||||||
Sbjct: 318 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtggagcgcttgttgta 259

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 258 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 199

                                                                      
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 198 catgatgcccatggccttggacgagatgccggtgtcggggtggacctgcttcagcacct 140

---

>gb|BC073925.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:90432 IMAGE:5190019), complete cds
          Length = 2221

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 350 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 291

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||| ||||||||||||||||    |||||||||
Sbjct: 290 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtggagcgcttgttgta 231

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||||| |||||||||
Sbjct: 230 gtgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 171

                                                                      
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
           |||||||  ||||| |||||| ||||||||| |||||||||| |||||||| |||||||
Sbjct: 170 catgatgcccatggtcttggacgagatgccggtgtcggggtggacctgcttcagcacct 112

---

>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701),
           mRNA
          Length = 399

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 387 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccagg 328

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||| |  || ||||||||||||||||    |||||||||
Sbjct: 327 cagcagcaggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgta 268

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | ||||| |||||    ||| |||||||| |||| |||||||||
Sbjct: 267 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 208

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 207 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 148

            
Query: 340 g 340
           |
Sbjct: 147 g 147

---

>ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA
          Length = 730

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 285

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 284 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 225

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 224 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 165

            
Query: 340 g 340
           |
Sbjct: 164 g 164

---

>ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427894), mRNA
          Length = 381

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427888), mRNA
          Length = 381

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC427883), mRNA
          Length = 381

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955),
           mRNA
          Length = 1220

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 267 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 326

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 327 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 386

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 387 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 446

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 447 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 506

            
Query: 340 g 340
           |
Sbjct: 507 g 507

---

>ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC478743), mRNA
          Length = 1047

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 274

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 273 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 214

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 213 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 154

            
Query: 340 g 340
           |
Sbjct: 153 g 153

---

>ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC478743), mRNA
          Length = 487

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 274

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 273 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 214

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 213 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 154

            
Query: 340 g 340
           |
Sbjct: 153 g 153

---

>ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611482), mRNA
          Length = 386

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 374 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 315

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 314 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 255

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 254 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 195

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 194 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 135

            
Query: 340 g 340
           |
Sbjct: 134 g 134

---

>ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611465), mRNA
          Length = 388

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 257

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 256 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 197

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 196 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 137

            
Query: 340 g 340
           |
Sbjct: 136 g 136

---

>ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC488290), mRNA
          Length = 421

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 257

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 256 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 197

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 196 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 137

            
Query: 340 g 340
           |
Sbjct: 136 g 136

---

>ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B histone family, member R
           (LOC488288), mRNA
          Length = 384

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 253

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 252 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 193

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 192 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 133

            
Query: 340 g 340
           |
Sbjct: 132 g 132

---

>ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC488279), mRNA
          Length = 513

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 438 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 379

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 378 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 319

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 318 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 259

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 258 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 199

            
Query: 340 g 340
           |
Sbjct: 198 g 198

---

>ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488276), mRNA
          Length = 438

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 257

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 256 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 197

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 196 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 137

            
Query: 340 g 340
           |
Sbjct: 136 g 136

---

>ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC611158), mRNA
          Length = 883

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 304

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 303 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 244

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 243 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 184

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 183 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 124

            
Query: 340 g 340
           |
Sbjct: 123 g 123

---

>ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488296), mRNA
          Length = 381

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC611089), mRNA
          Length = 381

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488252), mRNA
          Length = 384

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 253

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 252 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 193

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 192 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 133

            
Query: 340 g 340
           |
Sbjct: 132 g 132

---

>ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC608682), mRNA
          Length = 342

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 330 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 271

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 270 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 211

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 210 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 151

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 150 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 91

            
Query: 340 g 340
           |
Sbjct: 90  g 90

---

>ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC608682), mRNA
          Length = 383

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 371 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 312

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 311 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 252

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 251 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 192

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 191 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 132

            
Query: 340 g 340
           |
Sbjct: 131 g 131

---

>ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 3 (LOC488303), mRNA
          Length = 651

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 326

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 266

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 265 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 206

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 205 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 146

            
Query: 340 g 340
           |
Sbjct: 145 g 145

---

>ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 2 (LOC488303), mRNA
          Length = 442

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC488267), mRNA
          Length = 440

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 258

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 257 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 198

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 197 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 138

            
Query: 340 g 340
           |
Sbjct: 137 g 137

---

>ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC488267), mRNA
          Length = 1108

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 258

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 257 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 198

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 197 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 138

            
Query: 340 g 340
           |
Sbjct: 137 g 137

---

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 649

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 648 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 589

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 588 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 529

            
Query: 340 g 340
           |
Sbjct: 528 g 528

---

>ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 2 (LOC480760), mRNA
          Length = 487

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 274

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 273 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 214

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 213 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 154

            
Query: 340 g 340
           |
Sbjct: 153 g 153

---

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 649

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 648 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 589

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 588 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 529

            
Query: 340 g 340
           |
Sbjct: 528 g 528

---

>ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone 3, H2ba (LOC482202),
           mRNA
          Length = 459

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| || ||||||||||| |||||||| ||
Sbjct: 384 ggtgtacttggtgacggccttggtgccctcggacaccgcgtgcttggccagctcgccggg 325

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||| | ||| |||||||||||||| |    |||||||||
Sbjct: 324 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 265

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | ||||| |||||    ||||||||||||||||| ||| |||||
Sbjct: 264 atgcgccaggcgggaggcctcgctggcgatgcgctcaaagatgtcgttgacgaacgagtt 205

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 204 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 145

            
Query: 340 g 340
           |
Sbjct: 144 g 144

---

>emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B sequence
          Length = 1113

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 990 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 931

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 930 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 871

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 870 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 811

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 810 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 751

            
Query: 340 g 340
           |
Sbjct: 750 g 750

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 165015 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 164956

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 164955 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 164896

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 164895 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 164836

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 164835 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 164776

               
Query: 340    g 340
              |
Sbjct: 164775 g 164775



 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 52407 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 52348

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 52347 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 52288

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 52287 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 52228

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 52227 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 52168

              
Query: 340   g 340
             |
Sbjct: 52167 g 52167



 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 23586 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 23645

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 23646 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 23705

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 23706 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 23765

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||| ||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 23766 catgatgcccatggctttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 23825

              
Query: 340   g 340
             |
Sbjct: 23826 g 23826



 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 66003 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 66062

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 66063 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 66122

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 66123 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 66182

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 66183 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 66242

              
Query: 340   g 340
             |
Sbjct: 66243 g 66243



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 54428 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 54487

                                                          
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
              || |  ||||||||||  ||||||||||||||||||||||||||
Sbjct: 54488 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 54532



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                         
Query: 257   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
             ||||||||||| |  || ||||||||||||  |||||||||||||||||||||| |||||
Sbjct: 54585 aagatgtcgttcacaaacgagttcatgatgcccatggccttggaggagatgccggtgtcg 54644

                                     
Query: 317   gggtgcacctgcttgagcaccttg 340
             |||||||| ||||| |||||||||
Sbjct: 54645 gggtgcacttgcttcagcaccttg 54668

---

>dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500010J12 product:histone 1, H2bc, full
           insert sequence
          Length = 724

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 279

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 278 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 219

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 218 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 159

            
Query: 340 g 340
           |
Sbjct: 158 g 158

---

>dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched
           library, clone:1600009N02 product:H2B histone family,
           member S, full insert sequence
          Length = 723

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 338

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 337 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 278

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 277 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 218

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 217 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 158

            
Query: 340 g 340
           |
Sbjct: 157 g 157

---

>dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610022J01 product:H2B histone
           family, member S, full insert sequence
          Length = 730

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 404 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 345

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 344 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 285

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 284 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 225

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 224 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 165

            
Query: 340 g 340
           |
Sbjct: 164 g 164

---

>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds
          Length = 1401

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 952 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 893

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 892 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 833

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 832 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 773

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 772 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 713

            
Query: 340 g 340
           |
Sbjct: 712 g 712

---

>gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds
          Length = 1298

 Score =  168 bits (85), Expect = 1e-38
 Identities = 202/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 791 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 732

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 731 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 672

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 671 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 612

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 611 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 552

            
Query: 340 g 340
           |
Sbjct: 551 g 551

---

>emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0)
          Length = 374

 Score =  167 bits (84), Expect = 4e-38
 Identities = 198/236 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| |||||||||||||||||||| ||||||||||| |||||||| || || |
Sbjct: 258 acttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagca 199

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             || |||||||  |||||||||||||| ||||||||||| |    |||||||||  |||
Sbjct: 198 gcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcg 139

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||    | || |||||||||||    ||| ||||||||||||| ||| ||||||||||
Sbjct: 138 ccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatga 79

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||||| ||||||||  ||||||||||||||||||| |||||||||
Sbjct: 78  tgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 23

---

>ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488309), partial mRNA
          Length = 705

 Score =  165 bits (83), Expect = 2e-37
 Identities = 197/235 (83%)
 Strand = Plus / Minus

                                                                       
Query: 106 cttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggaggac 165
           ||||||||||||||||||||||||||| |||||||||||||| ||||| || || || | 
Sbjct: 363 cttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcag 304

                                                                       
Query: 166 gaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcgc 225
            ||||||||||  ||||||||||||| |||||||||||| |    |||||||||  ||||
Sbjct: 303 caggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgtaatgcgc 244

                                                                       
Query: 226 cagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatgat 285
           |||    | || |||||| ||||    ||| ||||||||||||| ||| |||||||||||
Sbjct: 243 caggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagttcatgat 184

                                                                  
Query: 286 ggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           |  |||||||||||| ||||||||  ||||||||||||||||||| |||||||||
Sbjct: 183 gcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 129

---

>emb|X14731.1|CMHIST2B Duck H2B histone gene
          Length = 1179

 Score =  163 bits (82), Expect = 6e-37
 Identities = 204/242 (84%), Gaps = 2/242 (0%)
 Strand = Plus / Minus

                                                                        
Query: 100  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
            |||| |||||||||| |||||||||||||||||||||||||||||||| |||||||| ||
Sbjct: 1042 ggtgtacttggtgaccgccttggtgccctcggagacggcgtgcttggccagctcgccggg 983

                                                                        
Query: 160  gagga-cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgt 218
             || | |||  |||||||  |||||||||||||| || |||||||| |    ||||||||
Sbjct: 982  cagcagcgac-cgcacggccgtctggatctcccgcgaggtgatggtcgagcgcttgttgt 924

                                                                        
Query: 219  accgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagt 278
            |  |||||||    | || |||||||||||    ||| ||||||||||||| ||||||||
Sbjct: 923  agtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaaggagt 864

                                                                        
Query: 279  tcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacct 338
            ||||||||  |||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 863  tcatgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacct 804

              
Query: 339  tg 340
            ||
Sbjct: 803  tg 802

---

>emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3)
          Length = 1467

 Score =  163 bits (82), Expect = 6e-37
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                        
Query: 100  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
            |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 1188 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 1129

                                                                        
Query: 160  gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             || |  || |||||||   ||||||||||||| ||||||||||| |    |||||||||
Sbjct: 1128 cagcagcagccgcacggccntctggatctcccgcgacgtgatggtcgagcgcttgttgta 1069

                                                                        
Query: 220  ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 1068 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 1009

                                                                        
Query: 280  catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
            |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 1008 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 949

             
Query: 340  g 340
            |
Sbjct: 948  g 948

---

>gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks
          Length = 766

 Score =  163 bits (82), Expect = 6e-37
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 490 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 431

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||   ||||||||||||| ||||||||||| |    |||||||||
Sbjct: 430 cagcagcagccgcacggccntctggatctcccgcgacgtgatggtcgagcgcttgttgta 371

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 370 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 311

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 310 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 251

            
Query: 340 g 340
           |
Sbjct: 250 g 250

---

>ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC417957), mRNA
          Length = 833

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 576 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 517

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 516 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 457

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 456 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 397

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 396 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 337

            
Query: 340 g 340
           |
Sbjct: 336 g 336

---

>ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone family, member F
           (LOC417956), mRNA
          Length = 841

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 576 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 517

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 516 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 457

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| |||||||||||||  || |||||
Sbjct: 456 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacaaacgagtt 397

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 396 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 337

            
Query: 340 g 340
           |
Sbjct: 336 g 336

---

>gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MGC:70229
           IMAGE:4217587), complete cds
          Length = 661

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 310

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 309 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 250

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 249 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 190

            
Query: 340 g 340
           |
Sbjct: 189 g 189

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 92394 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 92335

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 92334 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 92275

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 92274 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 92215

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||| ||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 92214 catgatgcccatggctttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 92155

              
Query: 340   g 340
             |
Sbjct: 92154 g 92154



 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 63577 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 63636

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 63637 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 63696

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 63697 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 63756

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 63757 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 63816

              
Query: 340   g 340
             |
Sbjct: 63817 g 63817



 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 49790 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 49731

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 49730 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 49671

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 49670 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 49611

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 49610 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 49551

              
Query: 340   g 340
             |
Sbjct: 49550 g 49550



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 61556 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 61497

                                                          
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
              || |  ||||||||||  ||||||||||||||||||||||||||
Sbjct: 61496 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 61452



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                         
Query: 257   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
             ||||||||||| |  || ||||||||||||  |||||||||||||||||||||| |||||
Sbjct: 61399 aagatgtcgttcacaaacgagttcatgatgcccatggccttggaggagatgccggtgtcg 61340

                                     
Query: 317   gggtgcacctgcttgagcaccttg 340
             |||||||| ||||| |||||||||
Sbjct: 61339 gggtgcacttgcttcagcaccttg 61316

---

>ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611126), mRNA
          Length = 751

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 395 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccggg 336

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| |||||||||||| |    |||||||||
Sbjct: 335 cagcagcaggcgcacggccgtctggatctccctggacgtgatggtcgagcgcttgttgta 276

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| ||| |||||
Sbjct: 275 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaacgagtt 216

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 215 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 156

            
Query: 340 g 340
           |
Sbjct: 155 g 155

---

>ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A)
           (LOC665622), mRNA
          Length = 2266

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 331

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 330 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 271

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 270 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 211

            
Query: 340 g 340
           |
Sbjct: 210 g 210

---

>ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A)
           (LOC665596), mRNA
          Length = 2266

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 331

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 330 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 271

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 270 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 211

            
Query: 340 g 340
           |
Sbjct: 210 g 210

---

>ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA
          Length = 381

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcagagaccgcgtgcttggccagctcgccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 309 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 249 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 34306 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 34247

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 34246 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 34187

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 34186 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 34127

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 34126 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 34067

              
Query: 340   g 340
             |
Sbjct: 34066 g 34066



 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 9970  ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 10029

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 10030 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 10089

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 10090 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 10149

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 10150 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 10209

              
Query: 340   g 340
             |
Sbjct: 10210 g 10210

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Plus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||||||||| |||||||| || |||||||||||||| ||||| || ||
Sbjct: 141215 ggtgtacttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccggg 141274

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 141275 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 141334

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 141335 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 141394

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 141395 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 141454

               
Query: 340    g 340
              |
Sbjct: 141455 g 141455

---

>emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b
          Length = 842

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||
Sbjct: 563 ggtgtacttggtgaccgccttggtaccctcggagaccgcgtgcttggccagctcgccggg 504

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 503 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 444

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 443 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 384

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 383 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 324

            
Query: 340 g 340
           |
Sbjct: 323 g 323

---

>gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:30336
           IMAGE:3993954), complete cds
          Length = 740

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 385 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 326

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 266

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 265 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 206

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 205 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 146

            
Query: 340 g 340
           |
Sbjct: 145 g 145

---

>dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
           library, clone:9830004G03 product:H2B histone family,
           member S, full insert sequence
          Length = 1257

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 398 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 339

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 338 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 279

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 278 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 219

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 218 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 159

            
Query: 340 g 340
           |
Sbjct: 158 g 158

---

>gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MGC:106612
           IMAGE:30613720), complete cds
          Length = 457

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 317

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 257

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 256 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 197

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||| ||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 196 catgatgcccatggctttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 137

            
Query: 340 g 340
           |
Sbjct: 136 g 136

---

>ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA
          Length = 661

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 429 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 370

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 369 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 310

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 309 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 250

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 249 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 190

            
Query: 340 g 340
           |
Sbjct: 189 g 189

---

>gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, complete cds
          Length = 1378

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| |||||||| || |||||||||||||| ||||| || ||
Sbjct: 869 ggtgtacttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccggg 810

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 809 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 750

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 749 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 690

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 689 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 630

            
Query: 340 g 340
           |
Sbjct: 629 g 629

---

>gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, complete cds
          Length = 1375

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||| ||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 866 ggtgtacttagtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 807

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 686 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 627

            
Query: 340 g 340
           |
Sbjct: 626 g 626

---

>gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, complete cds
          Length = 1201

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 792 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 733

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 732 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 673

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 672 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 613

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||| ||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 612 catgatgcccatggctttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 553

            
Query: 340 g 340
           |
Sbjct: 552 g 552

---

>emb|X05098.1|GGH2B5 Chicken histone H2B gene (pBBA-3.0)
          Length = 705

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||| ||||||||||| ||||||||||| |||||||| ||
Sbjct: 594 ggtgtacttggtgaccgccttggtaccctcggagaccgcgtgcttggccagctcgccggg 535

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 534 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 414 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 355

            
Query: 340 g 340
           |
Sbjct: 354 g 354

---

>emb|X05096.1|GGH2B3 Chicken histone H2B gene (pRR3c-3.5)
          Length = 705

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 594 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 535

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 534 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 414 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 355

            
Query: 340 g 340
           |
Sbjct: 354 g 354

---

>emb|X05095.1|GGH2B2 Chicken histone H2B gene (pRR2e-3.5)
          Length = 705

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 594 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 535

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 534 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 414 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 355

            
Query: 340 g 340
           |
Sbjct: 354 g 354

---

>ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA
          Length = 381

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 249 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||| ||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 189 catgatgcccatggctttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>dbj|D70896.1| Gallus gallus DNA for histone H2B, complete cds
          Length = 562

 Score =  161 bits (81), Expect = 3e-36
 Identities = 201/241 (83%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 468 ggtgtacttggtgaccgccttggtgccctcagagaccgcgtgcttggccagctcgccggg 409

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 408 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 349

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 348 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 289

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 288 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 229

            
Query: 340 g 340
           |
Sbjct: 228 g 228

---

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  159 bits (80), Expect = 1e-35
 Identities = 197/236 (83%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
             |||||||||| |||||||||||||| || |||||||||||||| ||||| || || || |
Sbjct: 53606 acttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagca 53547

                                                                         
Query: 165   cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
               ||||||||||  |||||||||||||||||||||||||| |    |||||||||  |||
Sbjct: 53546 gcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgtaatgcg 53487

                                                                         
Query: 225   ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
             ||||   || || |||||  ||||    ||| ||||||||||| | ||| ||||||||||
Sbjct: 53486 ccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagttcatga 53427

                                                                     
Query: 285   tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             ||  |||||||||||||||||||||| ||||||||||||| ||||| |||||||||
Sbjct: 53426 tgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcaccttg 53371



 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 60954 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 60895

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 60894 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 60835

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 60834 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 60775

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||||||||| ||| ||||||||||||| ||||| ||||||||
Sbjct: 60774 catgatgcccatggccttggaggagataccggtgtcggggtgcacttgcttcagcacctt 60715

              
Query: 340   g 340
             |
Sbjct: 60714 g 60714

---

>gb|AY158931.1| Mus musculus histone protein Hist1h2bk gene, complete cds
          Length = 1201

 Score =  159 bits (80), Expect = 1e-35
 Identities = 197/236 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| |||||||||||||| || |||||||||||||| ||||| || || || |
Sbjct: 847 acttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagca 788

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||||||||||||||||||| |    |||||||||  |||
Sbjct: 787 gcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgtaatgcg 728

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || |||||  ||||    ||| ||||||||||| | ||| ||||||||||
Sbjct: 727 ccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagttcatga 668

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||||||||||||||| ||||||||||||| ||||| |||||||||
Sbjct: 667 tgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcaccttg 612

---

>ref|NM_175665.1| Mus musculus histone 1, H2bk (Hist1h2bk), mRNA
          Length = 381

 Score =  159 bits (80), Expect = 1e-35
 Identities = 197/236 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| |||||||||||||| || |||||||||||||| ||||| || || || |
Sbjct: 364 acttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagca 305

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||||||||||||||||||| |    |||||||||  |||
Sbjct: 304 gcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgtaatgcg 245

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || |||||  ||||    ||| ||||||||||| | ||| ||||||||||
Sbjct: 244 ccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagttcatga 185

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||||||||||||||| ||||||||||||| ||||| |||||||||
Sbjct: 184 tgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcaccttg 129

---

>ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H2B (LOC462508), mRNA
          Length = 1026

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 402

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
           ||| |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 401 gagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 342

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 341 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 282

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 281 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 222

            
Query: 340 g 340
           |
Sbjct: 221 g 221

---

>ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H2B F (H2B 291A)
           (LOC469702), mRNA
          Length = 381

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||| |||| |||||| |||||||||||||| |||||||| ||
Sbjct: 369 ggtgtacttggtgacagccttagtgcgctcggacacggcgtgcttggccagctcgccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||| || || ||||||||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctgcatttcgcgggacgtgatggtggagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | ||||| |||||    ||| |||||||| |||| |||||||||
Sbjct: 249 gtgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| ||||||||||||||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA
          Length = 2436

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 471

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 470 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 411

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 410 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 351

            
Query: 340 g 340
           |
Sbjct: 350 g 350

---

>gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IMAGE:6529537)
          Length = 727

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 326

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 266

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 265 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 206

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||  ||||||||||||| || || ||||||||
Sbjct: 205 catgatgcccatggccttggaggagatgcccgtgtcggggtgcacttgtttcagcacctt 146

            
Query: 340 g 340
           |
Sbjct: 145 g 145

---

>ref|XM_988254.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A)
           (LOC671645), mRNA
          Length = 2266

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 450 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 391

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 390 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 331

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 330 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 271

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||| ||||||||| ||||| ||||||||
Sbjct: 270 catgatgcccatggccttggaggagatgccggtgtgggggtgcacttgcttcagcacctt 211

            
Query: 340 g 340
           |
Sbjct: 210 g 210

---

>gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MGC:74154
           IMAGE:6742370), complete cds
          Length = 624

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 396 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 337

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 336 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 277

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 276 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 217

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 216 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 157

            
Query: 340 g 340
           |
Sbjct: 156 g 156

---

>gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:19269
           IMAGE:3989862), complete cds
          Length = 2236

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 382 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 323

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 322 cagcagcaggcgcacggcagtctggatctcccgggacgtgatggtcgagcgcttgttgta 263

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 262 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 203

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 202 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 143

            
Query: 340 g 340
           |
Sbjct: 142 g 142

---

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 301 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 360

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 361 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 420

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 421 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 480

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 481 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgctttagcacctt 540

            
Query: 340 g 340
           |
Sbjct: 541 g 541

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 208873 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 208814

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 208813 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 208754

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 208753 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 208694

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 208693 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 208634

               
Query: 340    g 340
              |
Sbjct: 208633 g 208633



 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 175481 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 175422

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 175421 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 175362

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 175361 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 175302

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 175301 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 175242

               
Query: 340    g 340
              |
Sbjct: 175241 g 175241



 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 143456 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 143397

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 143396 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 143337

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   ||  | |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 143336 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 143277

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 143276 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgctttagcacctt 143217

               
Query: 340    g 340
              |
Sbjct: 143216 g 143216



 Score =  103 bits (52), Expect = 5e-19
 Identities = 76/84 (90%)
 Strand = Plus / Plus

                                                                          
Query: 257    aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
              ||||||||||| | ||| ||||||||||||  |||||||||||||||||||||| |||||
Sbjct: 136922 aagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggtgtcg 136981

                                      
Query: 317    gggtgcacctgcttgagcaccttg 340
              |||||||| ||||| |||||||||
Sbjct: 136982 gggtgcacttgcttcagcaccttg 137005



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 136765 ggtgtacttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccggg 136824

                                                           
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
               || |  ||||||||||  ||||||||||||||||||||||||||
Sbjct: 136825 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 136869

---

>gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MGC:78105
           IMAGE:4217814), complete cds
          Length = 657

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 376 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 317

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 257

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 256 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 197

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 196 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 137

            
Query: 340 g 340
           |
Sbjct: 136 g 136

---

>dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:C630013P15 product:H2B histone
           family, member S, full insert sequence
          Length = 2410

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 563 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 504

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 503 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 444

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 443 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 384

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 383 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 324

            
Query: 340 g 340
           |
Sbjct: 323 g 323

---

>dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
           enriched library, clone:5330429M17 product:H2B histone
           family, member S, full insert sequence
          Length = 2436

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 590 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 531

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 530 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 471

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 470 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 411

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 410 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 351

            
Query: 340 g 340
           |
Sbjct: 350 g 350

---

>ref|NM_178198.1| Mus musculus histone 1, H2bj (Hist1h2bj), mRNA
          Length = 381

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 249 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||| ||| ||||||||||||| ||||| ||||||||
Sbjct: 189 catgatgcccatggccttggaggagataccggtgtcggggtgcacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA
          Length = 381

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 249 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 189 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA
          Length = 381

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 249 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 189 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgctttagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|NM_178202.1| Mus musculus histone 1, H2bp (Hist1h2bp), mRNA
          Length = 381

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 249 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 189 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, complete cds
          Length = 1375

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 866 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 807

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 686 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 627

            
Query: 340 g 340
           |
Sbjct: 626 g 626

---

>gb|AY158932.1| Mus musculus histone protein Hist1h2bj gene, complete cds
          Length = 1375

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 866 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 807

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||| ||| ||||||||||||| ||||| ||||||||
Sbjct: 686 catgatgcccatggccttggaggagataccggtgtcggggtgcacttgcttcagcacctt 627

            
Query: 340 g 340
           |
Sbjct: 626 g 626

---

>gb|AY158930.1| Mus musculus histone protein Hist1h2bp gene, complete cds
          Length = 1201

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 852 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 793

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 792 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 733

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 732 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 673

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 672 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 613

            
Query: 340 g 340
           |
Sbjct: 612 g 612

---

>gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, complete cds
          Length = 1375

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 866 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 807

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||| |||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggatgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||  ||||    ||| ||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggacgcctcgctcgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 686 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcagcacctt 627

            
Query: 340 g 340
           |
Sbjct: 626 g 626

---

>gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, complete cds
          Length = 1375

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 866 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccggg 807

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 806 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 747

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 746 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttcacgaacgagtt 687

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 686 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgctttagcacctt 627

            
Query: 340 g 340
           |
Sbjct: 626 g 626

---

>gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, complete cds
          Length = 1381

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 515 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 574

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 575 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 634

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 635 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 694

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||  ||||||||||||| || || ||||||||
Sbjct: 695 catgatgcccatggccttggaggagatgcccgtgtcggggtgcacttgtttcagcacctt 754

            
Query: 340 g 340
           |
Sbjct: 755 g 755

---

>emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4)
          Length = 705

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 594 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 535

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 534 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||| || || ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 414 catgatgctcatggctttagatgagatgcccgtgtcggggtgcacctgcttcagcacctt 355

            
Query: 340 g 340
           |
Sbjct: 354 g 354

---

>emb|X05097.1|GGH2B4 Chicken histone H2B gene (pPP2d-2.3)
          Length = 705

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||| ||||| ||||| ||||||||||| |||||||| ||
Sbjct: 594 ggtgtacttggtgaccgccttggtaccctccgagaccgcgtgcttggccagctcgccggg 535

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 534 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 475

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 474 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 415

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 414 catgatgcccatggccttggatgagatgcccgtgtcggggtgcacctgcttcagcacctt 355

            
Query: 340 g 340
           |
Sbjct: 354 g 354

---

>emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV
          Length = 1042

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 602 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 543

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 542 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 483

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || ||| |||||||    ||| |||||||||||||  || |||||
Sbjct: 482 gtgcgccaggcgcgacgcctcaccggcgatgcgctcgaagatgtcgttgacaaacgagtt 423

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 422 catgatgcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcacctt 363

            
Query: 340 g 340
           |
Sbjct: 362 g 362

---

>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds
          Length = 2297

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                        
Query: 100  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
            |||| |||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 1435 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccggg 1376

                                                                        
Query: 160  gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 1375 cagcagcagccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 1316

                                                                        
Query: 220  ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 1315 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 1256

                                                                        
Query: 280  catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
            |||||||  |||||| || || ||||||||  ||||||||||||||||||| ||||||||
Sbjct: 1255 catgatgctcatggctttagatgagatgcccgtgtcggggtgcacctgcttcagcacctt 1196

             
Query: 340  g 340
            |
Sbjct: 1195 g 1195

---

>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks
          Length = 1564

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                        
Query: 100  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
            |||| |||||||||| |||||||||||||| ||||| ||||||||||| |||||||| ||
Sbjct: 1357 ggtgtacttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccggg 1298

                                                                        
Query: 160  gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             || |  || |||||||  |||||||||||||| ||||||||||| |    |||||||||
Sbjct: 1297 cagcagcagccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgta 1238

                                                                        
Query: 220  ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              |||||||    | || |||||||||||    ||| ||||||||||||| ||| |||||
Sbjct: 1237 gtgcgccaggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagtt 1178

                                                                        
Query: 280  catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
            |||||||  |||||||||||| ||||||||  |||||||||||| |||||| ||||||||
Sbjct: 1177 catgatgcccatggccttggacgagatgcccgtgtcggggtgcagctgcttcagcacctt 1118

             
Query: 340  g 340
            |
Sbjct: 1117 g 1117

---

>emb|Z80779.1|HSH2BG H.sapiens H2B/g gene
          Length = 1020

 Score =  153 bits (77), Expect = 6e-34
 Identities = 200/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 566 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 507

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 506 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 447

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 446 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 387

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 386 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 327

            
Query: 340 g 340
           |
Sbjct: 326 g 326

---

>gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds
          Length = 1874

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 683 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 625

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 624 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 565

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 564 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 509

---

>gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, complete cds
          Length = 1861

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 743 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 684

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 683 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 625

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 624 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 565

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 564 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 509

---

>gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing frame-shift
           errors
          Length = 618

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 414 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 355

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 354 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 296

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 295 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 236

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 235 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 180

---

>gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing frame-shift
           errors
          Length = 687

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 428 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 369

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 368 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 310

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 309 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 250

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 249 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 194

---

>emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B sequence
          Length = 1017

 Score =  151 bits (76), Expect = 2e-33
 Identities = 193/232 (83%)
 Strand = Plus / Minus

                                                                        
Query: 109  ggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggaggacgag 168
            |||||| |||||||||||||| ||||| ||||||||||| |||||||| || || |  ||
Sbjct: 1017 ggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccgggcagcagcag 958

                                                                        
Query: 169  gcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcgccag 228
             |||||||  |||||||||||||| ||||||||||| |    |||||||||  |||||||
Sbjct: 957  ccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgccag 898

                                                                        
Query: 229  cttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatgatgga 288
                | || |||||||||||    ||| ||||||||||||| ||| ||||||||||||  
Sbjct: 897  gcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgcc 838

                                                                
Query: 289  catggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
            |||||||||||| ||||||||  ||||||||||||||||||| |||||||||
Sbjct: 837  catggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 786

---

>ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone family, member F
           (LOC647719), mRNA
          Length = 703

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 484 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 425

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 424 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 366

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 365 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 306

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 305 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 250

---

>ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudogene on chromosome 1
          Length = 1134

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 682 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 624

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 623 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 564

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 563 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 508

---

>ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudogene on chromosome 1
          Length = 1134

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 681 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 623

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 622 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 563

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 562 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 507

---

>gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, complete sequence
          Length = 1134

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 742 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 683

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 682 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 624

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 623 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 564

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 563 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 508

---

>gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, complete sequence
          Length = 1134

 Score =  151 bits (76), Expect = 2e-33
 Identities = 197/236 (83%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||||| ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 741 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 682

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| |||||||||||||||||    |||||||||  |||
Sbjct: 681 gcaggcgcacggccgtctggatct-ccgggacgtgatggtggagcgcttgttgtagtgcg 623

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 622 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 563

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 562 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 507

---

>ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal protein L24-like;
           homolog of yeast ribosomal like protein 24; 60S
           ribosomal protein L30 isolog; my024 protein (LOC471902),
           mRNA
          Length = 1131

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  |||||||||| |||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 aagcagcaggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||  |||||   ||| ||||||||||||| |||||||||
Sbjct: 249 gtgcgccaggcgggaagcctcgcttgcgaggcgctcgaagatgtcgttgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||||||||| || ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgattcccatggccttagaagagatgccggtgtcggggtggacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MGC:119806
           IMAGE:40014271), complete cds
          Length = 441

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 390 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 331

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 330 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 271

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 270 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 211

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||||| || ||||||||| |||||||||| || ||||| ||||||||
Sbjct: 210 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagcacctt 151

            
Query: 340 g 340
           |
Sbjct: 150 g 150

---

>ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA
          Length = 467

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 288

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 287 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 228

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||||| || ||||||||| |||||||||| || ||||| ||||||||
Sbjct: 227 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagcacctt 168

            
Query: 340 g 340
           |
Sbjct: 167 g 167

---

>gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125414
           IMAGE:40021691), complete cds
          Length = 432

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125416
           IMAGE:40021695), complete cds
          Length = 431

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125415
           IMAGE:40021693), complete cds
          Length = 431

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 183927 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 183868

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||| ||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 183867 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 183808

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 183807 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 183748

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 183747 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 183688

               
Query: 340    g 340
              |
Sbjct: 183687 g 183687



 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 142538 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 142479

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 142478 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 142419

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 142418 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 142359

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 142358 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 142299

               
Query: 340    g 340
              |
Sbjct: 142298 g 142298



 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 236019 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 235960

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 235959 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 235900

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 235899 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 235840

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 235839 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 235780

               
Query: 340    g 340
              |
Sbjct: 235779 g 235779



 Score =  113 bits (57), Expect = 5e-22
 Identities = 195/241 (80%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 168164 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 168105

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 168104 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 168045

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   ||  | |||||||||||    ||| |||||||||||||  ||||| ||
Sbjct: 168044 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 167985

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              ||||||   |||||| || |||||||||||| |||||||||| ||||| || ||||||||
Sbjct: 167984 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 167925

               
Query: 340    g 340
              |
Sbjct: 167924 g 167924



 Score =  113 bits (57), Expect = 5e-22
 Identities = 195/241 (80%)
 Strand = Plus / Plus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 107478 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 107537

                                                                          
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
               || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 107538 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 107597

                                                                          
Query: 220    ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
                |||||||   ||  | |||||| ||||    |||||| |||||||| | ||| || ||
Sbjct: 107598 atgcgccaggcgggaagcctcgcccgcgatgcgctcaaatatgtcgttaacgaaagaatt 107657

                                                                          
Query: 280    catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
              |||||||  |||||||||||| ||||||||  ||||||| || ||||| || ||||||||
Sbjct: 107658 catgatgcccatggccttggaagagatgccagtgtcgggatggacctgtttcagcacctt 107717

               
Query: 340    g 340
              |
Sbjct: 107718 g 107718



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                         
Query: 257   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
             ||||||||||||| |||||| ||||||||   |||||||||||| ||||||||| |||||
Sbjct: 27388 aagatgtcgttgacgaaggaattcatgatccccatggccttggatgagatgccggtgtcg 27447

                                     
Query: 317   gggtgcacctgcttgagcaccttg 340
             ||||| |||||||| || ||||||
Sbjct: 27448 gggtggacctgcttcagaaccttg 27471



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                          
Query: 260    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcgggg 319
              |||||||||| |||||||||||| ||   ||| |||||||| ||||||||| ||||||||
Sbjct: 257184 atgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggtgtcgggg 257125

                                   
Query: 320    tgcacctgcttgagcaccttg 340
              || |||||||| |||||||||
Sbjct: 257124 tggacctgcttcagcaccttg 257104



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                          
Query: 257    aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
              ||||||||||| | |||||| |||||||||  |||||||||||| ||||||||  | |||
Sbjct: 200432 aagatgtcgttaacgaaggaattcatgatgcccatggccttggatgagatgccagtatcg 200491

                                      
Query: 317    gggtgcacctgcttgagcaccttg 340
              ||||| ||||| || |||||||||
Sbjct: 200492 gggtgaacctgttttagcaccttg 200515



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                          
Query: 105    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
              |||||||||| |||||||| || ||||| || ||||||||||| ||||| || || || |
Sbjct: 200280 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 200339

                                                      
Query: 165    cgaggcgcacggaggtctggatctcccgggacgtgatggt 204
                || ||||||| |||||||||||||| ||| || |||||
Sbjct: 200340 gcagacgcacggcggtctggatctccctggaggtaatggt 200379



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                          
Query: 100    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
              |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||| || ||
Sbjct: 257344 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccggg 257285

                                                           
Query: 160    gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
               || |  |||||||| |  || |||||||||| ||| ||||||||
Sbjct: 257284 tagcagcaggcgcacagccgtttggatctccctggaagtgatggt 257240



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 81/100 (81%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
             ||||||| || ||||| ||||||||||| || || ||||| || ||||| ||||| || |
Sbjct: 27236 acttggtaactgccttagtgccctcggacacagcatgcttagccagctccccaggcagca 27295

                                                     
Query: 165   cgaggcgcacggaggtctggatctcccgggacgtgatggt 204
               |||||||| |  ||||| ||||||| ||| ||||||||
Sbjct: 27296 gcaggcgcacagccgtctgaatctccctggaggtgatggt 27335

---

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 55422 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 55481

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 55482 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 55541

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 55542 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 55601

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 55602 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 55661

              
Query: 340   g 340
             |
Sbjct: 55662 g 55662



 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 621 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 680

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 681 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 740

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 741 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 800

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||||| || ||||||||| |||||||||| || ||||| ||||||||
Sbjct: 801 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagcacctt 860

            
Query: 340 g 340
           |
Sbjct: 861 g 861



 Score =  103 bits (52), Expect = 5e-19
 Identities = 79/88 (89%)
 Strand = Plus / Plus

                                                                         
Query: 253   ctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 312
             ||||||||||||||||| |||||||||||||||   ||| |||||||| ||||||||| |
Sbjct: 79193 ctcaaagatgtcgttgacgaaggagttcatgattcccatagccttggaagagatgccggt 79252

                                         
Query: 313   gtcggggtgcacctgcttgagcaccttg 340
             ||||||||| |||||||| |||||||||
Sbjct: 79253 gtcggggtggacctgcttcagcaccttg 79280



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 86914 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 86855

                                                          
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
              || |  |||||||||| |||||||||||||| ||| ||||||||
Sbjct: 86854 aagcagcaggcgcacggcggtctggatctccctggaggtgatggt 86810



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                         
Query: 257   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
             ||||||||||||| |||||||||||||||   ||||||||| || ||||||||| |||||
Sbjct: 86757 aagatgtcgttgacgaaggagttcatgattcccatggccttagaagagatgccggtgtcg 86698

                                     
Query: 317   gggtgcacctgcttgagcaccttg 340
             ||||| |||||||| |||||||||
Sbjct: 86697 gggtggacctgcttcagcaccttg 86674



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
             |||||||||||||||||||||||||||| |||||||||||||| |  || || || || |
Sbjct: 79045 acttggtgacggccttggtgccctcggacacggcgtgcttggccaattccccgggtagca 79104

                                                     
Query: 165   cgaggcgcacggaggtctggatctcccgggacgtgatggt 204
               ||||||||||  |||||||||||||  || ||||||||
Sbjct: 79105 gtaggcgcacggccgtctggatctccctcgaagtgatggt 79144

---

>ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA
          Length = 430

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||| ||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA
          Length = 449

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IMAGE:3871305), with
           apparent retained intron
          Length = 2200

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 430 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 371

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 370 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 311

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 310 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 251

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 250 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 191

            
Query: 340 g 340
           |
Sbjct: 190 g 190

---

>gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, complete cds
          Length = 1137

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 749 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 690

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 629 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 570

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||||| || ||||||||| |||||||||| || ||||| ||||||||
Sbjct: 569 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagcacctt 510

            
Query: 340 g 340
           |
Sbjct: 509 g 509

---

>gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, complete cds
          Length = 1137

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 690

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 629 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 570

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 569 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 510

            
Query: 340 g 340
           |
Sbjct: 509 g 509

---

>gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, complete cds
          Length = 1137

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 749 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 690

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||| ||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 689 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 630

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 629 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 570

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 569 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 510

            
Query: 340 g 340
           |
Sbjct: 509 g 509

---

>gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:13513
           IMAGE:4132165), complete cds
          Length = 744

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 491 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 432

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 431 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 372

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 371 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 312

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 311 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 252

            
Query: 340 g 340
           |
Sbjct: 251 g 251

---

>gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IMAGE:6668499),
           partial cds
          Length = 1219

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 412 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 353

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||| ||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 352 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 293

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 292 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 233

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 232 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 173

            
Query: 340 g 340
           |
Sbjct: 172 g 172

---

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
             Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
             H2AFN, and H2BFN histone genes, the OR2B2 gene for
             olfactory receptor 2B2, histone H2B family member I
             pseudogene H2BFIP, a hypothetical protein pseudogene,
             ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 57572 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 57513

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 57512 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 57453

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 57452 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 57393

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  ||||||||| || ||||||||| |||||||||| || ||||| ||||||||
Sbjct: 57392 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagcacctt 57333

              
Query: 340   g 340
             |
Sbjct: 57332 g 57332



 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                        
Query: 100  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
            |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 2771 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 2712

                                                                        
Query: 160  gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 2711 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 2652

                                                                        
Query: 220  ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 2651 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 2592

                                                                        
Query: 280  catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
            |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 2591 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 2532

             
Query: 340  g 340
            |
Sbjct: 2531 g 2531

---

>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2
            Contains seventeen histone (pseudo)genes and gene RPS10P1
            (40S Ribosomal protein S10 pseudogene 1), three CpG
            islands, ESTs, STSs and GSSs, complete sequence
          Length = 89301

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                        
Query: 100  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
            |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 5309 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 5250

                                                                        
Query: 160  gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             || |  ||||| ||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 5249 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 5190

                                                                        
Query: 220  ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 5189 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 5130

                                                                        
Query: 280  catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
            |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 5129 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 5070

             
Query: 340  g 340
            |
Sbjct: 5069 g 5069



 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 57401 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 57342

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 57341 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 57282

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 57281 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 57222

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 57221 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 57162

              
Query: 340   g 340
             |
Sbjct: 57161 g 57161



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 260   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcgggg 319
             |||||||||| |||||||||||| ||   ||| |||||||| ||||||||| ||||||||
Sbjct: 78566 atgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggtgtcgggg 78507

                                  
Query: 320   tgcacctgcttgagcaccttg 340
             || |||||||| |||||||||
Sbjct: 78506 tggacctgcttcagcaccttg 78486



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                         
Query: 257   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
             ||||||||||| | |||||| |||||||||  |||||||||||| ||||||||  | |||
Sbjct: 21814 aagatgtcgttaacgaaggaattcatgatgcccatggccttggatgagatgccagtatcg 21873

                                     
Query: 317   gggtgcacctgcttgagcaccttg 340
             ||||| ||||| || |||||||||
Sbjct: 21874 gggtgaacctgttttagcaccttg 21897



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
             |||||||||| |||||||| || ||||| || ||||||||||| ||||| || || || |
Sbjct: 21662 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 21721

                                                     
Query: 165   cgaggcgcacggaggtctggatctcccgggacgtgatggt 204
               || ||||||| |||||||||||||| ||| || |||||
Sbjct: 21722 gcagacgcacggcggtctggatctccctggaggtaatggt 21761



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||| || ||
Sbjct: 78726 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccggg 78667

                                                          
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
              || |  |||||||| |  || |||||||||| ||| ||||||||
Sbjct: 78666 tagcagcaggcgcacagccgtttggatctccctggaagtgatggt 78622

---

>emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene
          Length = 701

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 599 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 540

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 539 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 480

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 479 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 420

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 419 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 360

            
Query: 340 g 340
           |
Sbjct: 359 g 359

---

>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B
          Length = 1661

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 410 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 469

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 470 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 529

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 530 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 589

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||||| || ||||||||| |||||||||| || ||||| ||||||||
Sbjct: 590 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagcacctt 649

            
Query: 340 g 340
           |
Sbjct: 650 g 650

---

>gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116769
           IMAGE:40002357), complete cds
          Length = 430

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||| ||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MGC:116766
           IMAGE:40002352), complete cds
          Length = 430

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||| ||||  ||||||||||||| ||| ||||||||||    |||||||||
Sbjct: 309 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtggagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||| ||||||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcgaagatatcgttgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||||||||| |||||||| ||||||||
Sbjct: 189 catgatgcccatggccttggatgagatgccggtgtcggggtggacctgctttagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>dbj|AK158416.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930115B13 product:histone 1, H2bh, full
           insert sequence
          Length = 1680

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 410 ggtgtacttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccggg 351

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||||||||||||| || |    |||||||||
Sbjct: 350 cagcagcaggcgcacggccgtctggatctcccgggacgtgatagtcgagcgcttgttgta 291

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || |||||| ||||    ||| ||||||||||| | ||| |||||
Sbjct: 290 atgcgccaggcgggacgcctcgcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 231

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||  |||||||||||||| ||||||||||||| ||||| ||||||||
Sbjct: 230 catgatgcccatggctctggaggagatgccggtgtcggggtgcacttgcttcagcacctt 171

            
Query: 340 g 340
           |
Sbjct: 170 g 170

---

>emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (from clone DKFZp781B2436)
          Length = 1890

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 288

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 287 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 228

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||||| || ||||||||| |||||||||| || ||||| ||||||||
Sbjct: 227 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagcacctt 168

            
Query: 340 g 340
           |
Sbjct: 167 g 167

---

>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501
          Length = 1723

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                        
Query: 100  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
            |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 1271 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 1212

                                                                        
Query: 160  gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 1211 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 1152

                                                                        
Query: 220  ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
              |||||||   ||  | |||||||||||    ||| |||||||| |||| |||||||||
Sbjct: 1151 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagtt 1092

                                                                        
Query: 280  catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
            |||||||  |||||||||||| ||||| ||| |||||||||| |||||||| ||||||||
Sbjct: 1091 catgatgcccatggccttggacgagataccggtgtcggggtggacctgcttcagcacctt 1032

             
Query: 340  g 340
            |
Sbjct: 1031 g 1031

---

>gb|M25487.1|MUSHIS2B Mus musculus histone H2b mRNA, 3' end
          Length = 555

 Score =  145 bits (73), Expect = 1e-31
 Identities = 199/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| |||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 357 ggtgtacttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccggg 298

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  |||||||||||||||||||||||||| |    |||||||||
Sbjct: 297 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggtcgagcgcttgttgta 238

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   || || ||| || ||||    ||| ||||||||||| | ||| |||||
Sbjct: 237 atgcgccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttcacgaacgagtt 178

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||||||||||||| ||||||||||||| ||||| || |||||
Sbjct: 177 catgatgcccatggccttggaggagatgccggtgtcggggtgcacttgcttcaggacctt 118

            
Query: 340 g 340
           |
Sbjct: 117 g 117

---

>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11,
             DP09G08, DP35C12 of chromosome 5  of Podospora anserina
          Length = 322194

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
             |||||||||||||||||||||| || || |||||||||||||| |||||||| || ||||
Sbjct: 23470 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 23411

                                                                    
Query: 165   cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              |||||||||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 23410 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 23356

---

>dbj|AP006674.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT30L06, TM0369c,
             complete sequence
          Length = 68065

 Score =  141 bits (71), Expect = 2e-30
 Identities = 125/143 (87%)
 Strand = Plus / Minus

                                                                         
Query: 245   gcgagcttctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggag 304
             ||||||||||| |||||||| |||||||||  |||||||||   ||||||||||  ||||
Sbjct: 64320 gcgagcttctcgaagatgtcattgatgaagctgttcatgatccccatggccttgctggag 64261

                                                                         
Query: 305   atgccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcc 364
             || |||||||| ||||| |||||||| |||||||||||||||||||||||||| || |||
Sbjct: 64260 attccgatgtcagggtgaacctgcttcagcaccttgaagatgtagatcttgtaagtttcc 64201

                                    
Query: 365   acgctcttcttggacttcttctt 387
             ||| ||||||| ||| |||||||
Sbjct: 64200 acgttcttcttcgacctcttctt 64178



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                         
Query: 104   aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagg 163
             |||||||| || ||||||||||| || || || ||||||||||| |||||||| ||||| 
Sbjct: 64461 aacttggtaaccgccttggtgccttcagacacagcgtgcttggcaagctcgccggggaga 64402

                                                                     
Query: 164   acgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
             || |  | ||||| |||||| ||||||| ||| || || || ||||||||||||||
Sbjct: 64401 accaatctcacggcggtctgaatctccctggaggtaatcgtcggcttcttgttgta 64346

---

>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora
             anserina
          Length = 103568

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
             |||||||||||||||||||||| || || |||||||||||||| |||||||| || ||||
Sbjct: 81641 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 81700

                                                                    
Query: 165   cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              |||||||||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 81701 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 81755

---

>ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC616868), mRNA
          Length = 674

 Score =  139 bits (70), Expect = 9e-30
 Identities = 193/234 (82%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggaggacg 166
           |||||||||||||||||||||||||| |||||||||||||| ||||| || || || |  
Sbjct: 371 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 312

                                                                       
Query: 167 aggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcgcc 226
           ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||  |||||
Sbjct: 311 aggcgcacggccgtctggatctccctggatgtgatggtcgaacgcttgttgtaatgcgcc 252

                                                                       
Query: 227 agcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatgatg 286
           ||    | || |||||| ||||    ||| ||||| ||||||| ||||||||||||||| 
Sbjct: 251 aggcgcgacgcctcgccagcgatgcgctcgaagatatcgttgacgaaggagttcatgatt 192

                                                                 
Query: 287 gacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             |||||||||||| ||||||||| |||| ||||| |||||||| |||||||||
Sbjct: 191 cccatggccttggacgagatgccggtgtccgggtggacctgcttcagcaccttg 138

---

>gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDNA clone MGC:133641
           IMAGE:8049327), complete cds
          Length = 503

 Score =  139 bits (70), Expect = 9e-30
 Identities = 193/234 (82%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggaggacg 166
           |||||||||||||||||||||||||| |||||||||||||| ||||| || || || |  
Sbjct: 391 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 332

                                                                       
Query: 167 aggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcgcc 226
           ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||  |||||
Sbjct: 331 aggcgcacggccgtctggatctccctggatgtgatggtcgaacgcttgttgtaatgcgcc 272

                                                                       
Query: 227 agcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatgatg 286
           ||    | || |||||| ||||    ||| ||||| ||||||| ||||||||||||||| 
Sbjct: 271 aggcgcgacgcctcgccagcgatgcgctcgaagatatcgttgacgaaggagttcatgatt 212

                                                                 
Query: 287 gacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             |||||||||||| ||||||||| |||| ||||| |||||||| |||||||||
Sbjct: 211 cccatggccttggacgagatgccggtgtccgggtggacctgcttcagcaccttg 158

---

>ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC133641), mRNA
          Length = 503

 Score =  139 bits (70), Expect = 9e-30
 Identities = 193/234 (82%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggaggacg 166
           |||||||||||||||||||||||||| |||||||||||||| ||||| || || || |  
Sbjct: 391 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 332

                                                                       
Query: 167 aggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcgcc 226
           ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||  |||||
Sbjct: 331 aggcgcacggccgtctggatctccctggatgtgatggtcgaacgcttgttgtaatgcgcc 272

                                                                       
Query: 227 agcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatgatg 286
           ||    | || |||||| ||||    ||| ||||| ||||||| ||||||||||||||| 
Sbjct: 271 aggcgcgacgcctcgccagcgatgcgctcgaagatatcgttgacgaaggagttcatgatt 212

                                                                 
Query: 287 gacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             |||||||||||| ||||||||| |||| ||||| |||||||| |||||||||
Sbjct: 211 cccatggccttggacgagatgccggtgtccgggtggacctgcttcagcaccttg 158

---

>ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histone family, member F
           (LOC462509), mRNA
          Length = 843

 Score =  137 bits (69), Expect = 4e-29
 Identities = 198/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    |||||||||||| |||| |||||||||
Sbjct: 249 atgcgccaggcgggaagcctcgccagcgatgcgctcaaagatgtcattgacgaaggagtt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  ||||||||| || ||||||||| |||||||||| || ||||| || |||||
Sbjct: 189 catgatgcccatggccttcgatgagatgccggtgtcggggtggacttgcttcagtacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>ref|XM_608099.2| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC529646), mRNA
          Length = 396

 Score =  137 bits (69), Expect = 4e-29
 Identities = 198/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||| ||||| || || ||||||||||| ||||| || ||
Sbjct: 384 ggtgtacttggtgacggccttggtaccctcagacaccgcgtgcttggccagctccccggg 325

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  |||||||||| |||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 324 tagcagcaggcgcacggcggtctggatctccctggatgtgatggtcgagcgcttgttgta 265

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| |||||||||
Sbjct: 264 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 205

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||| ||||| ||||||||| |||| ||||| |||||||| ||||||||
Sbjct: 204 catgatgcccatggctttggacgagatgccggtgtccgggtggacctgcttcagcacctt 145

            
Query: 340 g 340
           |
Sbjct: 144 g 144

---

>ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC616776), mRNA
          Length = 399

 Score =  137 bits (69), Expect = 4e-29
 Identities = 198/241 (82%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 382 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccggg 323

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            |  |  ||||| |||| |||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 322 caacagcaggcgaacggcggtctggatctccctggatgtgatggtcgaacgcttgttgta 263

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||    | || |||||| ||||    ||| ||||||||||||| |||||||||
Sbjct: 262 atgcgccaggcgcgacgcctcgcccgcgatgcgctcgaagatgtcgttgacgaaggagtt 203

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           |||||||  |||||||||||| ||||||||| |||| ||||| || ||||| ||||||||
Sbjct: 202 catgatgcccatggccttggacgagatgccggtgtccgggtggacttgcttcagcacctt 143

            
Query: 340 g 340
           |
Sbjct: 142 g 142

---

>gb|AY271238.1| Homo sapiens clone RM2-A03 putative promoter sequence
          Length = 339

 Score =  135 bits (68), Expect = 1e-28
 Identities = 195/236 (82%), Gaps = 1/236 (0%)
 Strand = Plus / Plus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           |||||||| | ||||||||||||||||| |||||||||||||| |||||||| || || |
Sbjct: 1   acttggtggccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 60

                                                                       
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
             ||||||||||  |||||||||| ||||||||||| |||||    |||||||||  |||
Sbjct: 61  gcaggcgcacggccgtctggatct-ccgggacgtgacggtggagcgcttgttgtagtgcg 119

                                                                       
Query: 225 ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
           ||||   || || ||| || ||||    ||| ||||||||||||| ||||||||||||||
Sbjct: 120 ccaggcgggacgcctctcccgcgatgcgctcgaagatgtcgttgaggaaggagttcatga 179

                                                                   
Query: 285 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
           ||  |||||||||| |  |||||||| |||||||||| ||| |||| |||||||||
Sbjct: 180 tgcccatggccttgcaccagatgccggtgtcggggtggacccgcttcagcaccttg 235

---

>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429558), mRNA
          Length = 381

 Score =  133 bits (67), Expect = 6e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                       
Query: 253 ctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 312
           ||||||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |
Sbjct: 216 ctcaaagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggt 157

                                                  
Query: 313 gtcggggtgcacctgcttgagcaccttgaagatgtagat 351
           ||||||||| |||||||| ||||||||| ||| ||||||
Sbjct: 156 gtcggggtggacctgctttagcaccttgtagacgtagat 118



 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 310

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
            || |  ||||||||||  |||||||||||||| || ||||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 263

---

>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429457), partial mRNA
          Length = 628

 Score =  133 bits (67), Expect = 6e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                       
Query: 253 ctcaaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 312
           ||||||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |
Sbjct: 463 ctcaaagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggt 404

                                                  
Query: 313 gtcggggtgcacctgcttgagcaccttgaagatgtagat 351
           ||||||||| |||||||| ||||||||| ||| ||||||
Sbjct: 403 gtcggggtggacctgctttagcaccttgtagacgtagat 365



 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||
Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 557

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
            || |  ||||||||||  |||||||||||||| || ||||||||||
Sbjct: 556 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 510

---

>ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone family, member F,
           transcript variant 1 (LOC537985), mRNA
          Length = 2304

 Score =  129 bits (65), Expect = 9e-27
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 385 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccagg 326

                                                        
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
            || |  ||||||||||  ||||||||||||||||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 281



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           |||||||||||||  || ||||||||||||  ||| |||||||| || || ||| |||| 
Sbjct: 228 aagatgtcgttgacaaatgagttcatgatgcccatagccttggacgaaataccggtgtcc 169

                                   
Query: 317 gggtgcacctgcttgagcaccttg 340
           |||||||||||||| |||||||||
Sbjct: 168 gggtgcacctgcttcagcaccttg 145

---

>ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 1,
           mRNA
          Length = 523

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 359

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 358 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 299

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 298 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 239

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 238 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 179

            
Query: 340 g 340
           |
Sbjct: 178 g 178

---

>ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 2,
           mRNA
          Length = 829

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 359

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 358 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 299

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 298 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 239

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 238 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 179

            
Query: 340 g 340
           |
Sbjct: 178 g 178

---

>gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, complete cds
          Length = 1137

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 690

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 689 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 630

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 629 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 570

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 569 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 510

            
Query: 340 g 340
           |
Sbjct: 509 g 509

---

>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the
             3' part of the HFE gene for haemochromatosis protein, two
             genes for novel histone 4 family members, two genes for
             novel histone 1 family members, three genes for novel
             histone 2B family members, a gene for a novel histone 2A
             family member, a novel pseudogene, STSs, GSSs, ESTs and
             CpG islands, complete sequence
          Length = 101099

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 64919 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 64860

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 64859 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 64800

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 64799 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 64740

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 64739 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 64680

              
Query: 340   g 340
             |
Sbjct: 64679 g 64679



 Score =  113 bits (57), Expect = 5e-22
 Identities = 195/241 (80%)
 Strand = Plus / Minus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 90545 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 90486

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 90485 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 90426

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   ||  | |||||||||||    ||| |||||||||||||  ||||| ||
Sbjct: 90425 atgcgccaggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaatt 90366

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             ||||||   |||||| || |||||||||||| |||||||||| ||||| || ||||||||
Sbjct: 90365 catgatccccatggctttagaggagatgccggtgtcggggtggacctgtttcagcacctt 90306

              
Query: 340   g 340
             |
Sbjct: 90305 g 90305



 Score =  113 bits (57), Expect = 5e-22
 Identities = 195/241 (80%)
 Strand = Plus / Plus

                                                                         
Query: 100   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 29859 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 29918

                                                                         
Query: 160   gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
              || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 29919 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 29978

                                                                         
Query: 220   ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
               |||||||   ||  | |||||| ||||    |||||| |||||||| | ||| || ||
Sbjct: 29979 atgcgccaggcgggaagcctcgcccgcgatgcgctcaaatatgtcgttaacgaaagaatt 30038

                                                                         
Query: 280   catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
             |||||||  |||||||||||| ||||||||  ||||||| || ||||| || ||||||||
Sbjct: 30039 catgatgcccatggccttggaagagatgccagtgtcgggatggacctgtttcagcacctt 30098

              
Query: 340   g 340
             |
Sbjct: 30099 g 30099

---

>emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone pJG4-5-15
          Length = 808

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 338

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 337 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 278

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 277 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 218

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 217 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 158

            
Query: 340 g 340
           |
Sbjct: 157 g 157

---

>gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant 1, mRNA (cDNA
           clone MGC:116768 IMAGE:40002354), complete cds
          Length = 438

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 249 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 189 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant 2, mRNA (cDNA
           clone MGC:3802 IMAGE:3659807), complete cds
          Length = 814

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 394 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 335

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 334 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 275

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 274 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 215

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 214 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 155

            
Query: 340 g 340
           |
Sbjct: 154 g 154

---

>gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds
          Length = 1520

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 901 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 842

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 841 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 782

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 781 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 722

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| |||||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 721 catgatccccattgccttggaagagatgccggtgtcgggatggacctgcttcagcacctt 662

            
Query: 340 g 340
           |
Sbjct: 661 g 661

---

>gb|AC092896.9| Homo sapiens 3 BAC RP11-274J15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 170330

 Score =  127 bits (64), Expect = 4e-26
 Identities = 193/236 (81%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
             ||||||||| |||||||||||||||||| |||||||||||||| | |||  | || || |
Sbjct: 98707 acttggtgatggccttggtgccctcggacacggcgtgcttggccacctcctcgggcagca 98766

                                                                         
Query: 165   cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgtaccgcg 224
               |||||| |||  ||||||||||||| ||| |||||||| |    |||||||||  |||
Sbjct: 98767 gcaggcgctcggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcg 98826

                                                                         
Query: 225   ccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagttcatga 284
             ||||   ||  | |||||| ||||  | ||||||||||||||||| ||||||||||||||
Sbjct: 98827 ccaggcgggaagcctcgcccgcgacgtgctcaaagatgtcgttgacgaaggagttcatga 98886

                                                                     
Query: 285   tggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcaccttg 340
             |   ||||||||| |||||||||||| |||| | ||| |||||||| |||||||||
Sbjct: 98887 tccccatggccttagaggagatgccggtgtcagagtggacctgcttcagcaccttg 98942

---

>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds
          Length = 425

 Score =  127 bits (64), Expect = 4e-26
 Identities = 79/84 (94%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |||||
Sbjct: 212 aagatgtcgttgacgaaggagttcatgatgctcatggccttggaggagatgccggtgtcg 153

                                   
Query: 317 gggtgcacctgcttgagcaccttg 340
           ||||| ||||||||||||||||||
Sbjct: 152 gggtggacctgcttgagcaccttg 129



 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| || ||
Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccggg 310

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
            || |  ||||| |||| |||||||||||||||||| ||||||||||
Sbjct: 309 cagcagcaggcggacggcggtctggatctcccgggaggtgatggtgg 263

---

>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA
          Length = 414

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagggagga 164
           ||||||| ||||||||||| ||||||||||||||||||||||| ||||| || |||||||
Sbjct: 394 acttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggagga 335

                                                                  
Query: 165 cgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            |||||| || |||||||| ||||| ||||| | |||||||| ||||||||||||
Sbjct: 334 tgaggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgta 280



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcgggg 319
           |||||||||| ||| ||||||| ||||||||||||   |  |||||| ||  ||||||||
Sbjct: 239 atgtcgttgacgaaagagttcaggatggacatggcacggttggagataccagtgtcgggg 180

                                        
Query: 320 tgcacctgcttgagcaccttgaagatgta 348
           || ||||||||||| |||||| |||||||
Sbjct: 179 tggacctgcttgaggaccttgtagatgta 151

---

>ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H2B 291B (LOC462491),
           mRNA
          Length = 643

 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 419 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 360

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 359 aagcagcaggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgta 300

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             |||||||   ||  | |||||| ||||    ||| ||||||||||||| |||||| ||
Sbjct: 299 atgcgccaggcgggaagcctcgcctgcgatgcgctcgaagatgtcgttgacgaaggaatt 240

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   ||| || ||||| ||||||||| ||||||| || |||||||| ||||||||
Sbjct: 239 catgatccccattgctttggaagagatgccggtgtcgggatggacctgcttcagcacctt 180

            
Query: 340 g 340
           |
Sbjct: 179 g 179

---

>ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC506306), mRNA
          Length = 485

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 400 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccagg 341

                                                        
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggt 204
            || |  || |||||||  ||||||||||||||||||||||||||
Sbjct: 340 cagcagaagtcgcacggccgtctggatctcccgggacgtgatggt 296



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           |||||||||||||  || ||||||||||||  |||||| ||||| ||||||||| |||| 
Sbjct: 243 aagatgtcgttgacaaatgagttcatgatgcccatggctttggacgagatgccggtgtcc 184

                                   
Query: 317 gggtgcacctgcttgagcaccttg 340
           ||||||||||| || | |||||||
Sbjct: 183 gggtgcacctgtttcaacaccttg 160

---

>ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA
          Length = 425

 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, complete cds
          Length = 1137

 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 749 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 690

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 689 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 630

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 629 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 570

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 569 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 510

            
Query: 340 g 340
           |
Sbjct: 509 g 509

---

>gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116762
           IMAGE:40002316), complete cds
          Length = 425

 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116765
           IMAGE:40002319), complete cds
          Length = 425

 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116763
           IMAGE:40002317), complete cds
          Length = 425

 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116764
           IMAGE:40002318), complete cds
          Length = 425

 Score =  121 bits (61), Expect = 2e-24
 Identities = 196/241 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||| ||||||||||| |||||||||||||| || || |||||
Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 310

                                                                       
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgggcttcttgttgta 219
            || |  ||||||||||  ||||||||||||| ||| |||||||| |    |||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgta 250

                                                                       
Query: 220 ccgcgccagcttggccgactcgccggcgagcttctcaaagatgtcgttgatgaaggagtt 279
             | |||||   ||  | |||||||||||    ||| ||||| |||||||  ||||| ||
Sbjct: 249 atgagccaggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaatt 190

                                                                       
Query: 280 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 339
           ||||||   |||||| ||||||||||||||| |||||||||| || ||||| ||||||||
Sbjct: 189 catgatccccatggctttggaggagatgccggtgtcggggtggacttgcttcagcacctt 130

            
Query: 340 g 340
           |
Sbjct: 129 g 129

---

>emb|BX072512.1|CNS09S44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 621

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 466 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 407

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
           ||| |  || ||||| |  ||||||||||| ||||||||||||||||
Sbjct: 406 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 360



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |||| 
Sbjct: 309 aagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtcc 250

                                              
Query: 317 gggtgcacctgcttgagcaccttgaagatgtagat 351
           |||||||||||||| ||||||||| ||||||||||
Sbjct: 249 gggtgcacctgcttcagcaccttgtagatgtagat 215

---

>emb|BX072414.1|CNS09S1E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 267 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
           ||| |  || ||||| |  ||||||||||| ||||||||||||||||
Sbjct: 327 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 373



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |||| 
Sbjct: 424 aagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtcc 483

                                              
Query: 317 gggtgcacctgcttgagcaccttgaagatgtagat 351
           |||||||||||||| ||||||||| ||||||||||
Sbjct: 484 gggtgcacctgcttcagcaccttgtagatgtagat 518

---

>emb|BX051496.1|CNS09BWC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 247 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 306

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
           ||| |  || ||||| |  ||||||||||| ||||||||||||||||
Sbjct: 307 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 353



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |||| 
Sbjct: 404 aagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtcc 463

                                              
Query: 317 gggtgcacctgcttgagcaccttgaagatgtagat 351
           |||||||||||||| ||||||||| ||||||||||
Sbjct: 464 gggtgcacctgcttcagcaccttgtagatgtagat 498

---

>emb|BX051495.1|CNS09BWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 463 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 404

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
           ||| |  || ||||| |  ||||||||||| ||||||||||||||||
Sbjct: 403 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 357



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |||| 
Sbjct: 306 aagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtcc 247

                                              
Query: 317 gggtgcacctgcttgagcaccttgaagatgtagat 351
           |||||||||||||| ||||||||| ||||||||||
Sbjct: 246 gggtgcacctgcttcagcaccttgtagatgtagat 212

---

>emb|BX047440.1|CNS098RO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 444 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 385

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
           ||| |  || ||||| |  ||||||||||| ||||||||||||||||
Sbjct: 384 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 338



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |||| 
Sbjct: 287 aagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtcc 228

                                              
Query: 317 gggtgcacctgcttgagcaccttgaagatgtagat 351
           |||||||||||||| ||||||||| ||||||||||
Sbjct: 227 gggtgcacctgcttcagcaccttgtagatgtagat 193

---

>emb|BX038423.1|CNS091T7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 478 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 419

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
           ||| |  || ||||| |  ||||||||||| ||||||||||||||||
Sbjct: 418 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 372



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |||| 
Sbjct: 321 aagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtcc 262

                                              
Query: 317 gggtgcacctgcttgagcaccttgaagatgtagat 351
           |||||||||||||| ||||||||| ||||||||||
Sbjct: 261 gggtgcacctgcttcagcaccttgtagatgtagat 227

---

>emb|BX032827.1|CNS08XHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 100 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccagg 159
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 402

                                                          
Query: 160 gaggacgaggcgcacggaggtctggatctcccgggacgtgatggtgg 206
           ||| |  || ||||| |  ||||||||||| ||||||||||||||||
Sbjct: 401 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 355



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 316
           ||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |||| 
Sbjct: 304 aagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggtgtcc 245

                                              
Query: 317 gggtgcacctgcttgagcaccttgaagatgtagat 351
           |||||||||||||| ||||||||| ||||||||||
Sbjct: 244 gggtgcacctgcttcagcaccttgtagatgtagat 210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,712,250
Number of Sequences: 3902068
Number of extensions: 3712250
Number of successful extensions: 88410
Number of sequences better than 10.0: 1096
Number of HSP's better than 10.0 without gapping: 1138
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 82131
Number of HSP's gapped (non-prelim): 6045
length of query: 470
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 448
effective length of database: 17,147,199,772
effective search space: 7681945497856
effective search space used: 7681945497856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---