ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags25o20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK103626.1| Oryza sativa (japonica cultivar-group) cDNA clon... 206 6e-50
2dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic D... 80 9e-12
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 80 9e-12
4dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic D... 80 9e-12
5ref|XM_463578.1| Oryza sativa (japonica cultivar-group), predic... 58 3e-05
6gb|AC112683.10| Mus musculus chromosome 17, clone RP23-332P1, co... 54 5e-04
7gb|AC146131.4| Pan troglodytes BAC clone RP43-4F15 from 7, compl... 48 0.033
8gb|AC024730.7| Homo sapiens BAC clone RP11-422E4 from 7, complet... 48 0.033
9gb|AC098563.6| Rattus norvegicus 1 BAC CH230-123A15 (Children's ... 48 0.033
10emb|AL805977.2| Human DNA sequence from clone RP11-491O20 on chr... 48 0.033
11emb|CT025624.11| Mouse DNA sequence from clone RP24-212N20 on ch... 48 0.033
12gb|AC140409.3| Mus musculus BAC clone RP23-138K22 from 9, comple... 48 0.033
13gb|AC079356.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.13
14emb|CR790381.6| Zebrafish DNA sequence from clone DKEY-202K24 in... 46 0.13
15emb|AL157884.9| Human DNA sequence from clone RP11-462B18 on chr... 46 0.13
16gb|AC079022.2|AC079022 Oryza sativa chromosome 5 clone P0574H01,... 46 0.13
17gb|AC009041.10| Homo sapiens chromosome 16 clone RP11-161M6, com... 46 0.13
18dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
19gb|AC158686.2| Mus musculus 10 BAC RP24-74G10 (Roswell Park Canc... 46 0.13
20dbj|AK121142.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.13
21dbj|AK099779.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.13
22gb|AC166099.2| Mus musculus BAC clone RP24-254H22 from chromosom... 46 0.13
23gb|AC166360.4| Mus musculus BAC clone RP24-497L5 from chromosome... 46 0.13
24gb|AC107851.17| Mus musculus chromosome 9, clone RP23-451B4, com... 44 0.52
25gb|AC146980.9| Mus musculus chromosome 3, clone RP24-97N14, comp... 44 0.52
26gb|AC098644.4| Takifugu rubripes clone 205P11, complete sequence 44 0.52
27gb|AC167359.4| Mus musculus BAC clone RP24-94F12 from chromosome... 44 0.52
28gb|AC116386.9| Mus musculus chromosome 15, clone RP23-37B16, com... 44 0.52
29gb|AC115972.13| Mus musculus chromosome 5, clone RP24-79A6, comp... 44 0.52
30gb|AC167816.4| Mus musculus BAC clone RP23-317F20 from chromosom... 44 0.52
31gb|AC162177.2| Mus musculus BAC clone RP24-159F5 from chromosome... 44 0.52
32gb|AC164546.2| Mus musculus BAC clone RP24-189C11 from chromosom... 44 0.52
33gb|AC113121.27| Mus musculus chromosome 8, clone RP23-347G12, co... 44 0.52
34gb|AC108768.14| Mus musculus chromosome 8, clone RP23-398L15, co... 44 0.52
35gb|AC118588.6| Mus musculus chromosome 15, clone RP24-576D3, com... 44 0.52
36gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, comp... 44 0.52
37gb|AC113538.14| Mus musculus chromosome 8, clone RP23-118F24, co... 44 0.52
38gb|AC102525.8| Mus musculus chromosome 8, clone RP24-133K20, com... 44 0.52
39gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosom... 44 0.52
40gb|AC164105.4| Mus musculus BAC clone RP23-433B2 from chromosome... 44 0.52
41gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome ... 44 0.52
42gb|AC165274.2| Mus musculus BAC clone RP24-97D3 from chromosome ... 44 0.52
43gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, com... 44 0.52
44gb|AC165151.2| Mus musculus BAC clone RP24-77O15 from chromosome... 44 0.52
45gb|AC165960.4| Mus musculus BAC clone RP23-395M20 from chromosom... 44 0.52
46gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, comple... 44 0.52
47gb|AC120865.7| Mus musculus chromosome 5, clone RP23-88L6, compl... 44 0.52
48gb|AF016494.1| Fugu rubripes gamma-aminobutyric acid receptor be... 44 0.52
49gb|AC158974.8| Mus musculus chromosome 15, clone RP24-252G18, co... 44 0.52
50gb|AF487493.1| Ochotona princeps clone OCP2 microsatellite sequence 44 0.52
51gb|AF406937.1| Clupea pallasi microsatellite Cpa101 sequence 44 0.52
52gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, comp... 44 0.52
53gb|AC166800.5| Mus musculus chromosome 1, clone RP24-260I21, com... 44 0.52
54gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, com... 44 0.52
55gb|AC121594.3| Mus musculus BAC clone RP23-297A16 from chromosom... 44 0.52
56gb|AC165091.3| Mus musculus BAC clone RP23-25M19 from chromosome... 44 0.52
57gb|AC117236.4| Mus musculus BAC clone RP23-416K18 from chromosom... 44 0.52
58gb|AC167246.2| Mus musculus BAC clone RP23-401H11 from chromosom... 44 0.52
59gb|AC114671.14| Mus musculus chromosome 5, clone RP24-199D21, co... 44 0.52
60gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, co... 44 0.52
61gb|AY303753.1| Takifugu rubripes erythropoietin (EPO) gene, comp... 44 0.52
62gb|AC150512.3| Bos taurus BAC CH240-319N17 (Children's Hospital... 44 0.52
63gb|AC112361.5| Rattus norvegicus 9 BAC CH230-61F12 (Children's H... 44 0.52
64gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, c... 44 0.52
65gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, comp... 44 0.52
66gb|AC116500.13| Mus musculus chromosome 5, clone RP24-297N9, com... 44 0.52
67gb|AF241735.2| Homo sapiens chromosome X clone CTD-2324A24 map p... 44 0.52
68gb|AF241734.2| Homo sapiens chromosome X clone RP1-34M10 map p11... 44 0.52
69gb|AC091810.4| Homo sapiens chromosome X clone CTD-2324A24 map p... 44 0.52
70gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, co... 44 0.52
71gb|AC146610.4| Mus musculus BAC clone RP23-68E7 from chromosome ... 44 0.52
72gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosom... 44 0.52
73gb|AC134553.5| Mus musculus BAC clone RP24-280H19 from chromosom... 44 0.52
74gb|AC142145.3| Mus musculus BAC clone RP24-69D13 from chromosome... 44 0.52
75gb|AC127415.3| Mus musculus BAC clone RP23-450L4 from chromosome... 44 0.52
76gb|AC132345.4| Mus musculus BAC clone RP24-177P9 from chromosome... 44 0.52
77gb|AC121152.15| Mus musculus chromosome 10, clone RP24-344A4, co... 44 0.52
78gb|AC184848.2| Pan troglodytes BAC clone CH251-277H16 from chrom... 44 0.52
79ref|XM_951865.1| Neurospora crassa OR74A hypothetical protein ( ... 44 0.52
80ref|XM_327947.1| Neurospora crassa OR74A hypothetical protein ( ... 44 0.52
81gb|AC161283.2| Pan troglodytes BAC clone CH251-354N8 from chromo... 44 0.52
82gb|AY623110.1| Homo sapiens solute carrier family 6 (neurotransm... 44 0.52
83gb|AC134442.4| Mus musculus BAC clone RP24-104I4 from chromosome... 44 0.52
84gb|AC147160.2| Mus musculus BAC clone RP24-336A22 from chromosom... 44 0.52
85gb|AC129205.3| Mus musculus BAC clone RP24-235I5 from chromosome... 44 0.52
86gb|AC126424.12| Mus musculus chromosome 17, clone RP23-19K10, co... 44 0.52
87gb|AC115360.6| Mus musculus BAC clone RP23-191N22 from chromosom... 44 0.52
88gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosom... 44 0.52
89gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome... 44 0.52
90gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosom... 44 0.52
91gb|AC142265.4| Mus musculus BAC clone RP24-360F24 from chromosom... 44 0.52
92gb|AC134831.3| Mus musculus BAC clone RP24-500P4 from chromosome... 44 0.52
93gb|DQ481668.1| Takifugu rubripes HoxDa gene cluster, complete se... 44 0.52
94gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, comp... 44 0.52
95gb|AC183431.1| Mus musculus BAC clone RP24-128G23 from chromosom... 44 0.52
96gb|AC118546.80| Mus musculus strain C57BL/6J clone rp23-346h22 m... 44 0.52
97gb|AC157552.10| Mus musculus chromosome 7, clone RP23-89C10, com... 44 0.52
98gb|AC158215.3| Mus musculus chromosome 7, clone RP24-180E12, com... 44 0.52
99gb|AC113028.15| Mus musculus chromosome 5, clone RP23-205D3, com... 44 0.52
100gb|AC116473.13| Mus musculus chromosome 8, clone RP23-385E22, co... 44 0.52
101gb|AC115863.17| Mus musculus chromosome 9, clone RP24-295J1, com... 44 0.52
102gb|AF235096.5| Homo sapiens chromosome 8 clone RP11-562D1 map q2... 44 0.52
103gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Can... 44 0.52
104gb|AY277963.1| Takifugu rubripes transcription factor Sox8b (Sox... 44 0.52
105gb|AC125274.12| Mus musculus chromosome 15, clone RP24-157F9, co... 44 0.52
106gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, comp... 44 0.52
107gb|AC163393.6| Mus musculus chromosome 15, clone RP24-224P8, com... 44 0.52
108gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome... 44 0.52
109gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome... 44 0.52
110gb|AC137154.2| Mus musculus BAC clone RP24-572L22 from chromosom... 44 0.52
111gb|AC183833.2| Pan troglodytes BAC clone CH251-141C5 from chromo... 44 0.52
112gb|AC175670.3| Mus musculus BAC clone RP24-304I16 from chromosom... 44 0.52
113gb|AC175494.3| Mus musculus BAC clone RP24-75G20 from chromosome... 44 0.52
114gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome... 44 0.52
115gb|AC140255.4| Mus musculus BAC clone RP24-291E19 from chromosom... 44 0.52
116gb|AC122481.3| Mus musculus BAC clone RP24-357O20 from chromosom... 44 0.52
117gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, comple... 44 0.52
118gb|AC073089.5| Homo sapiens BAC clone RP11-324F21 from 7, comple... 44 0.52
119gb|AC004111.1| Homo sapiens BAC clone CTB-103H13 from 7, complet... 44 0.52
120gb|AC115741.9| Mus musculus chromosome 14, clone RP23-476L2, com... 44 0.52
121gb|AC136743.5| Mus musculus chromosome 9, clone RP23-149D5, comp... 44 0.52
122gb|AC105470.17| Rattus norvegicus 10 BAC CH230-192N7 (Children's... 44 0.52
123gb|AC140258.4| Mus musculus BAC clone RP24-295F23 from chromosom... 44 0.52
124gb|AC144582.3| Mus musculus BAC clone RP24-323J22 from chromosom... 44 0.52
125gb|AC145564.4| Mus musculus BAC clone RP24-482K19 from chromosom... 44 0.52
126gb|AC140474.3| Mus musculus BAC clone RP24-406O7 from chromosome... 44 0.52
127gb|AC026471.6| Homo sapiens chromosome 16 clone RP11-452L6, comp... 44 0.52
128gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosom... 44 0.52
129gb|AC124012.4| Mus musculus BAC clone RP24-357P22 from chromosom... 44 0.52
130gb|AC134438.3| Mus musculus BAC clone RP24-470G3 from chromosome... 44 0.52
131gb|DQ483436.1| Gymnogyps californianus clone 139H microsatellite... 44 0.52
132gb|AY498860.1| Homo sapiens tumor necrosis factor receptor super... 44 0.52
133emb|CR759874.20| Zebrafish DNA sequence from clone CH211-214H24 ... 44 0.52
134emb|BX248397.8| Zebrafish DNA sequence from clone CH211-233H19 i... 44 0.52
135emb|CT009638.5| Zebrafish DNA sequence from clone CH73-162A18 in... 44 0.52
136emb|AL929319.4| Zebrafish DNA sequence from clone CH211-59F17 in... 44 0.52
137emb|CR450685.13| Zebrafish DNA sequence from clone DKEY-83K24 in... 44 0.52
138emb|CR735143.13| Zebrafish DNA sequence from clone CH211-244P16 ... 44 0.52
139emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in... 44 0.52
140emb|BX537295.7| Zebrafish DNA sequence from clone DKEY-21O10 in ... 44 0.52
141emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 i... 44 0.52
142emb|AL954201.1| Pan troglodytes chromosome 22 clone PTB-118B22 m... 44 0.52
143emb|AL954202.1| Pan troglodytes chromosome 22 clone PTB-083P20 m... 44 0.52
144emb|CR376860.38| Zebrafish DNA sequence from clone DKEY-111H22 i... 44 0.52
145emb|BX908756.12| Zebrafish DNA sequence from clone CH211-190D13 ... 44 0.52
146emb|CR388060.19| Zebrafish DNA sequence from clone DKEY-208J8 in... 44 0.52
147emb|CR933522.11| Zebrafish DNA sequence from clone CH211-22N13 i... 44 0.52
148emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in... 44 0.52
149gb|AC110524.11| Mus musculus chromosome 9, clone RP23-403L22, co... 44 0.52
150emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in... 44 0.52
151gb|AC123828.4| Mus musculus BAC clone RP24-111G17 from chromosom... 44 0.52
152gb|AC123049.4| Mus musculus BAC clone RP24-360B3 from chromosome... 44 0.52
153gb|AC125153.3| Mus musculus BAC clone RP24-378F2 from chromosome... 44 0.52
154gb|AC130548.3| Mus musculus BAC clone RP24-456F12 from chromosom... 44 0.52
155gb|AC127553.3| Mus musculus BAC clone RP24-553F11 from chromosom... 44 0.52
156gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, comp... 44 0.52
157gb|AC114819.4| Mus musculus BAC clone RP23-52J20 from chromosome... 44 0.52
158gb|AC132470.3| Mus musculus BAC clone RP23-96F5 from chromosome ... 44 0.52
159gb|AC122251.4| Mus musculus BAC clone RP23-167J15 from chromosom... 44 0.52
160emb|CR385066.13| Zebrafish DNA sequence from clone DKEY-220L23 i... 44 0.52
161gb|AC122827.3| Mus musculus BAC clone RP23-211N23 from chromosom... 44 0.52
162gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome... 44 0.52
163gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosom... 44 0.52
164gb|AC129182.4| Mus musculus BAC clone RP23-340P24 from chromosom... 44 0.52
165gb|AC126262.4| Mus musculus BAC clone RP23-359F12 from chromosom... 44 0.52
166gb|AC132474.3| Mus musculus BAC clone RP23-114G13 from chromosom... 44 0.52
167gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosom... 44 0.52
168gb|AC133100.5| Mus musculus BAC clone RP23-98O11 from chromosome... 44 0.52
169emb|BX936408.10| Zebrafish DNA sequence from clone CH211-195A15 ... 44 0.52
170emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 ... 44 0.52
171emb|CR387978.12| Zebrafish DNA sequence from clone DKEY-33M5 in ... 44 0.52
172gb|AF335246.1| Homo sapiens cone rod homeobox protein (CRX) gene... 44 0.52
173gb|AC026748.7| Homo sapiens chromosome 5 clone RP11-325I22, comp... 44 0.52
174gb|AC121934.4| Mus musculus BAC clone RP24-207A18 from chromosom... 44 0.52
175gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, com... 44 0.52
176gb|AC131762.2| Mus musculus BAC clone RP24-228J18 from chromosom... 44 0.52
177gb|AC126022.4| Mus musculus BAC clone RP24-405F4 from chromosome... 44 0.52
178gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosom... 44 0.52
179gb|AC128663.4| Mus musculus BAC clone RP24-263E2 from chromosome... 44 0.52
180gb|AC126251.4| Mus musculus BAC clone RP23-457L16 from chromosom... 44 0.52
181emb|CR450741.5| Zebrafish DNA sequence from clone CH211-269F16 i... 44 0.52
182gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosom... 44 0.52
183emb|CR545462.25| Zebrafish DNA sequence from clone DKEYP-88F5 in... 44 0.52
184gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, comple... 44 0.52
185gb|AC121797.3| Mus musculus BAC clone RP23-424C23 from chromosom... 44 0.52
186gb|AC126055.4| Mus musculus BAC clone RP23-368O6 from chromosome... 44 0.52
187gb|AC091300.3| Danio rerio clone 127K3, complete sequence 44 0.52
188gb|AC091001.3| Papio anubis clone RP41-36M16, complete sequence 44 0.52
189gb|AC122225.4| Mus musculus BAC clone RP23-131E21 from 9, comple... 44 0.52
190gb|AC083858.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 44 0.52
191gb|AC122248.5| Mus musculus BAC clone RP23-156N18 from 7, comple... 44 0.52
192emb|CR847928.12| Zebrafish DNA sequence from clone DKEYP-67E7 in... 44 0.52
193gb|AC122287.4| Mus musculus BAC clone RP23-253A15 from 1, comple... 44 0.52
194gb|AC098733.2| Mus musculus BAC clone RP23-103C10 from 19, compl... 44 0.52
195gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, compl... 44 0.52
196gb|AC121986.2| Mus musculus BAC clone RP24-293I7 from 10, comple... 44 0.52
197gb|AC122048.2| Mus musculus BAC clone RP24-456G2 from 2, complet... 44 0.52
198gb|AC146157.3| Pan troglodytes BAC clone RP43-2A11 from 7, compl... 44 0.52
199gb|AC010268.10| Homo sapiens clone CTC-484E17, complete sequence 44 0.52
200emb|CR704914.2|CNS0G6V2 Tetraodon nigroviridis full-length cDNA 44 0.52
201gb|AC117596.6| Mus musculus chromosome 6, clone RP23-392K24, com... 44 0.52
202gb|AC092536.3| Homo sapiens BAC clone RP11-32N3 from 7, complete... 44 0.52
203gb|AC092021.4| Homo sapiens BAC clone RP11-420H12 from 7, comple... 44 0.52
204gb|AC091738.4| Homo sapiens BAC clone RP11-535E8 from 7, complet... 44 0.52
205gb|AC004015.1| Homo sapiens BAC clone CTA-333F24 from 7, complet... 44 0.52
206gb|AC101723.9| Mus musculus chromosome 17, clone RP23-316J7, com... 44 0.52
207gb|AC111140.11| Mus musculus chromosome 3, clone RP23-369L16, co... 44 0.52
208gb|AC007030.3| Homo sapiens PAC clone RP5-1112I4 from 7, complet... 44 0.52
209gb|AC113301.7| Mus musculus chromosome 8, clone RP23-430G7, comp... 44 0.52
210gb|AC102441.6| Mus musculus chromosome 18, clone RP24-160I12, co... 44 0.52
211gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, com... 44 0.52
212gb|AC166260.7| Mus musculus 10 BAC RP23-330F17 (Roswell Park Can... 44 0.52
213gb|AC160757.3| Mus musculus chromosome 3, clone RP23-200C3, comp... 44 0.52
214gb|AC124230.6| Mus musculus chromosome 1, clone RP23-474K11, com... 44 0.52
215emb|CR936500.10| Zebrafish DNA sequence from clone DKEY-274N8 in... 44 0.52
216emb|BX927062.11| Zebrafish DNA sequence from clone CH211-227N20 ... 44 0.52
217gb|AC139045.7| Mus musculus chromosome 7, clone RP23-466H15, com... 44 0.52
218emb|BX293991.12| Zebrafish DNA sequence from clone CH211-261I24 ... 44 0.52
219gb|AC118728.12| Mus musculus chromosome 1, clone RP24-168F13, co... 44 0.52
220emb|BX927365.7| Zebrafish DNA sequence from clone DKEY-161P7 in ... 44 0.52
221gb|AC093304.4| Homo sapiens chromosome 5 clone RP11-69K7, comple... 44 0.52
222gb|AC160125.2| Mus musculus BAC clone RP23-317M11 from chromosom... 44 0.52
223gb|AC108436.5| Mus musculus chromosome 8, clone RP23-230G11, com... 44 0.52
224emb|BX510331.13| Zebrafish DNA sequence from clone CH211-42B22 i... 44 0.52
225emb|BX908755.10| Zebrafish DNA sequence from clone DKEY-67F11 in... 44 0.52
226gb|AC163400.3| Mus musculus chromosome 15, clone RP24-97G4, comp... 44 0.52
227gb|AC112342.14| Rattus norvegicus 14 BAC CH230-253H12 (Children'... 44 0.52
228gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's... 44 0.52
229emb|CR392025.7| Zebrafish DNA sequence from clone CH211-248P17 i... 44 0.52
230emb|CR405713.7| Zebrafish DNA sequence from clone DKEY-12D5 in l... 44 0.52
231emb|CR847503.8| Zebrafish DNA sequence from clone DKEY-20D21 in ... 44 0.52
232emb|AL953854.21| Human DNA sequence from clone RP11-211P14 on ch... 44 0.52
233emb|Z82189.1|HS170A21 Human DNA sequence from clone RP1-170A21 o... 44 0.52
234emb|Z94162.1|HSN21F1 Human DNA sequence from clone LL22NC03-21F1... 44 0.52
235emb|Z82202.1|HS34P24 Human DNA sequence from clone RP1-34P24 on ... 44 0.52
236emb|CR381602.30| Zebrafish DNA sequence from clone DKEY-183M22 i... 44 0.52
237emb|CR769775.11| Human DNA sequence from clone RP11-449H15 on ch... 44 0.52
238emb|AL935212.11| Human DNA sequence from clone RP11-160N1 on chr... 44 0.52
239emb|AL732479.6| Human DNA sequence from clone RP11-351D13 on chr... 44 0.52
240emb|AL607044.24| Human DNA sequence from clone RP13-392N17 on ch... 44 0.52
241emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chr... 44 0.52
242emb|AL591890.31| Human DNA sequence from clone RP11-54A22 on chr... 44 0.52
243emb|AL592309.24| Human DNA sequence from clone RP11-293F5 on chr... 44 0.52
244emb|AL591386.19| Human DNA sequence from clone RP11-349K21 on ch... 44 0.52
245emb|AL596223.3| Human DNA sequence from clone RP11-227H15 on chr... 44 0.52
246emb|AL590235.23| Human DNA sequence from clone RP11-529E10 on ch... 44 0.52
247emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chro... 44 0.52
248emb|AL590416.4| Human DNA sequence from clone RP11-89C21 on chro... 44 0.52
249emb|AL512444.20| Human DNA sequence from clone RP11-69E9 on chro... 44 0.52
250gb|AC107742.10| Mus musculus chromosome 15, clone RP23-331D7, co... 44 0.52
251emb|AL451042.10| Human DNA sequence from clone RP11-276H7 on chr... 44 0.52
252emb|AL583882.6| Human DNA sequence from clone RP5-1098C18 on chr... 44 0.52
253emb|AL391987.15| Human DNA sequence from clone RP11-374M1 on chr... 44 0.52
254emb|AL359815.26| Human DNA sequence from clone RP11-63N8 on chro... 44 0.52
255emb|AL390240.18| Human DNA sequence from clone RP11-428F18 on ch... 44 0.52
256emb|AL390755.5| Human DNA sequence from clone RP11-472K17 on chr... 44 0.52
257gb|AC012391.10| Homo sapiens chromosome 10 clone RP11-162A23, co... 44 0.52
258emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chr... 44 0.52
259emb|AL355151.11| Human DNA sequence from clone RP11-288C24 on ch... 44 0.52
260emb|AL355392.7| Human DNA sequence from clone RP5-1187J4 on chro... 44 0.52
261emb|AL353593.33| Human DNA sequence from clone RP5-1139B12 on ch... 44 0.52
262emb|AL162731.33| Human DNA sequence from clone RP11-292F9 on chr... 44 0.52
263emb|AL353093.18| Human DNA sequence from clone RP11-224P11 on ch... 44 0.52
264gb|AC125576.4| Rattus norvegicus 18 BAC CH230-9F9 (Children's Ho... 44 0.52
265gb|AC108527.6| Rattus norvegicus 9 BAC CH230-7F11 (Children's Ho... 44 0.52
266emb|AL158822.19| Human DNA sequence from clone RP11-100C15 on ch... 44 0.52
267emb|AL158050.8| Human DNA sequence from clone RP3-437C15 on chro... 44 0.52
268gb|AY055383.1| Homo sapiens type II transmembrane serine proteas... 44 0.52
269emb|AL138689.22| Human DNA sequence from clone RP11-272L14 on ch... 44 0.52
270gb|AC087442.13| Homo sapiens chromosome 11, clone RP11-495O11, c... 44 0.52
271emb|AL138778.13| Human DNA sequence from clone RP11-57K16 on chr... 44 0.52
272gb|AC091292.2| Takifugu rubripes clone 263O5, complete sequence 44 0.52
273emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K... 44 0.52
274emb|AL117380.28|HSJ749H19 Human DNA sequence from clone RP4-749H... 44 0.52
275emb|AL118508.27|HSJ737E23 Human DNA sequence from clone RP4-737E... 44 0.52
276gb|AC115090.8| Homo sapiens chromosome 17, clone CTC-861O14, com... 44 0.52
277emb|AL121929.17|HSBA416N2 Human DNA sequence from clone RP11-416... 44 0.52
278emb|AL121796.17|HSDJ368B9 Human DNA sequence from clone RP3-368B... 44 0.52
279gb|AC107020.4| Homo sapiens 12 BAC RP11-271J4 (Roswell Park Canc... 44 0.52
280emb|AL117329.8|HSBA191L9 Human DNA sequence from clone RP11-191L... 44 0.52
281emb|AL109911.47|HS1107C24 Human DNA sequence from clone RP5-1107... 44 0.52
282emb|AL050342.42|HSDJ655K7 Human DNA sequence from clone RP4-655K... 44 0.52
283emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E... 44 0.52
284emb|AL049539.21|HSJ836N17 Human DNA sequence from clone RP5-836N... 44 0.52
285emb|AL035685.21|HS791K14 Human DNA sequence from clone RP4-791K1... 44 0.52
286emb|AL096853.13|HSFF96H12 Human DNA sequence from clone CITF22-9... 44 0.52
287emb|AL035106.28|HS998C11 Human DNA sequence from clone RP5-998C1... 44 0.52
288gb|AC153791.2| Mus musculus chromosome 15, clone RP24-269A21, co... 44 0.52
289emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G2... 44 0.52
290emb|AL031595.4|HS671O14 Human DNA sequence from clone RP4-671O14... 44 0.52
291gb|AC158149.3| Mus musculus chromosome 5, clone RP24-296L6, comp... 44 0.52
292gb|AC094241.9| Rattus norvegicus 1 BAC CH230-3C7 (Children's Hos... 44 0.52
293gb|AC158213.4| Mus musculus chromosome 7, clone RP24-253H20, com... 44 0.52
294gb|AC115509.5| Rattus norvegicus 2 BAC CH230-382P14 (Children's ... 44 0.52
295emb|AL022314.1|HS1170K4 Human DNA sequence from clone RP5-1170K4... 44 0.52
296emb|AL008583.1|HS327J16 Human DNA sequence from clone RP3-327J16... 44 0.52
297emb|AL008720.1|HS343C1 Human DNA sequence from clone CTA-343C1 o... 44 0.52
298emb|AL008638.1|HS992D9 Human DNA sequence from clone CTA-992D9 o... 44 0.52
299emb|AL008636.1|HS722E9 Human DNA sequence from clone CTA-722E9 o... 44 0.52
300emb|BX323824.17| Zebrafish DNA sequence from clone DKEY-37F18 in... 44 0.52
301emb|BX927315.10| Zebrafish DNA sequence from clone CH211-215B16 ... 44 0.52
302emb|CR376835.6| Zebrafish DNA sequence from clone CH211-59E4 in ... 44 0.52
303emb|BX914201.6| Zebrafish DNA sequence from clone DKEYP-108B3 in... 44 0.52
304gb|AC175363.2| Pan troglodytes chromosome X clone CH251-7A1 map ... 44 0.52
305emb|BX004968.20| Zebrafish DNA sequence from clone DKEY-35I13 in... 44 0.52
306gb|AC163627.4| Mus musculus BAC clone RP23-341E13 from chromosom... 44 0.52
307gb|AC160460.5| Mus musculus chromosome 8, clone RP23-15B11, comp... 44 0.52
308gb|AC160997.5| Mus musculus BAC clone RP23-68E4 from chromosome ... 44 0.52
309gb|AC162858.6| Mus musculus chromosome 8, clone RP23-117O14, com... 44 0.52
310gb|AC162297.5| Mus musculus chromosome 18, clone RP24-276H6, com... 44 0.52
311gb|AC118283.5| Homo sapiens BAC clone RP11-1398P2 from 4, comple... 44 0.52
312gb|AC161457.5| Mus musculus BAC clone RP23-156A3 from chromosome... 44 0.52
313emb|BX548154.1|CNS09SBK clone A24K23, A41I8 of Tetraodon nigrovi... 44 0.52
314gb|AC153517.8| Mus musculus 10 BAC RP23-22E18 (Roswell Park Canc... 44 0.52
315emb|AL844518.5| Zebrafish DNA sequence from clone DKEY-83D9 in l... 44 0.52
316emb|AL732562.8| Zebrafish DNA sequence from clone CH211-103D22 i... 44 0.52
317emb|AL645912.18| Mouse DNA sequence from clone RP23-134G19 on ch... 44 0.52
318emb|AL645615.14| Mouse DNA sequence from clone RP23-395B22 on ch... 44 0.52
319gb|AY172173.1| Loxodonta africana microsatellite LaT05 sequence 44 0.52
320emb|AL355932.1|NCB5O22 Neurospora crassa DNA linkage group II BA... 44 0.52
321emb|AJ313164.1|MMU313164 Mus musculus gene for langerin, exons 1-6 44 0.52
322emb|AJ314905.1|HSA314905 Homo sapiens partial OBSCN gene for obs... 44 0.52
323gb|AC164087.5| Mus musculus BAC clone RP23-408K7 from chromosome... 44 0.52
324gb|AY988150.1| Felis catus clone FCA750 microsatellite sequence 44 0.52
325emb|CR513789.22| Zebrafish DNA sequence from clone CH211-212J20 ... 44 0.52
326emb|CR352218.7| Zebrafish DNA sequence from clone DKEYP-118G5 in... 44 0.52
327emb|BX897714.6| Zebrafish DNA sequence from clone DKEY-218L23 in... 44 0.52
328emb|BX640588.5| Zebrafish DNA sequence from clone DKEY-110L7 in ... 44 0.52
329emb|CR450848.13| Zebrafish DNA sequence from clone CH211-149E23 ... 44 0.52
330emb|CR762431.9| Zebrafish DNA sequence from clone DKEY-220O10 in... 44 0.52
331emb|CR381633.6| Zebrafish DNA sequence from clone CH211-230M9 in... 44 0.52
332emb|BX546489.13| Zebrafish DNA sequence from clone CH211-258F14 ... 44 0.52
333emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 ... 44 0.52
334emb|BX927303.11| Zebrafish DNA sequence from clone CH211-67L13 i... 44 0.52
335emb|CR457462.13| Zebrafish DNA sequence from clone CH211-1O7 in ... 44 0.52
336emb|BX640595.13| Zebrafish DNA sequence from clone CH211-117K11 ... 44 0.52
337emb|AL929459.12| Zebrafish DNA sequence from clone CH211-277I17 ... 44 0.52
338emb|BX571852.20| Zebrafish DNA sequence from clone DKEY-175N6 in... 44 0.52
339emb|BX279525.12| Zebrafish DNA sequence from clone CH211-244C18 ... 44 0.52
340emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chro... 44 0.52
341emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chr... 44 0.52
342emb|AL662846.18| Mouse DNA sequence from clone RP23-399N2 on chr... 44 0.52
343emb|AL731866.8| Mouse DNA sequence from clone RP23-37F22 on chro... 44 0.52
344emb|AL669856.6| Mouse DNA sequence from clone RP23-46I13 on chro... 44 0.52
345emb|BX511225.7| Zebrafish DNA sequence from clone DKEY-28J24 in ... 44 0.52
346gb|AC022239.16| Homo sapiens chromosome 8, clone RP11-148O21, co... 44 0.52
347gb|AC009780.12| Homo sapiens 12 BAC RP11-1C11 (Roswell Park Canc... 44 0.52
348emb|AL929460.13| Zebrafish DNA sequence from clone CH211-148J1 i... 44 0.52
349gb|AC019288.8| Homo sapiens chromosome 15, clone RP11-139F4, com... 44 0.52
350emb|CR786576.5| Zebrafish DNA sequence from clone DKEY-223D7 in ... 44 0.52
351emb|CR376769.6| Zebrafish DNA sequence from clone CH211-120K3 in... 44 0.52
352emb|CR856017.2| Human DNA sequence from clone WI2-85805H8 on chr... 44 0.52
353emb|CR339043.11| Zebrafish DNA sequence from clone CH211-154I8 i... 44 0.52
354emb|CR388216.10| Zebrafish DNA sequence from clone CH211-165L2 i... 44 0.52
355emb|BX548161.12| Zebrafish DNA sequence from clone DKEY-248F6 in... 44 0.52
356emb|BX649467.5| Zebrafish DNA sequence from clone CH211-117L16 i... 44 0.52
357emb|AL627261.10| Zebrafish DNA sequence from clone RP71-1N11 in ... 44 0.52
358emb|AL626804.10| Zebrafish DNA sequence from clone RP71-1H10 in ... 44 0.52
359emb|AL807239.5| Zebrafish DNA sequence from clone CH211-231H1 in... 44 0.52
360emb|CR533571.9| Zebrafish DNA sequence from clone CH211-209O12 i... 44 0.52
361emb|AL929185.14| Zebrafish DNA sequence from clone CH211-193L2 i... 44 0.52
362emb|BX842685.6| Zebrafish DNA sequence from clone DKEY-28C10 in ... 44 0.52
363gb|AC116419.32| Mus musculus chromosome 1, clone RP24-89C10, com... 44 0.52
364emb|CR352217.9| Zebrafish DNA sequence from clone CH211-129P13 i... 44 0.52
365gb|AC158143.6| Mus musculus chromosome 5, clone RP23-409I5, comp... 44 0.52
366emb|BX649426.8| Zebrafish DNA sequence from clone DKEYP-82D11, c... 44 0.52
367emb|CR762478.7| Zebrafish DNA sequence from clone DKEY-250B10 in... 44 0.52
368emb|BX927222.8| Zebrafish DNA sequence from clone CH211-256M12 i... 44 0.52
369emb|CR858119.1| Pongo pygmaeus mRNA; cDNA DKFZp468N0312 (from cl... 44 0.52
370gb|AC103855.3| Homo sapiens chromosome 11, clone RP11-958J22, co... 44 0.52
371emb|BX901978.14| Zebrafish DNA sequence from clone DKEY-155M6 in... 44 0.52
372emb|CR376858.7| Zebrafish DNA sequence from clone CH211-87A2 in ... 44 0.52
373emb|CR558305.6| Zebrafish DNA sequence from clone DKEYP-87C9 in ... 44 0.52
374emb|BX927201.9| Zebrafish DNA sequence from clone DKEY-12D17 in ... 44 0.52
375emb|BX537307.6| Zebrafish DNA sequence from clone CH211-227H20 i... 44 0.52
376emb|BX470184.9| Zebrafish DNA sequence from clone CH211-214H13 i... 44 0.52
377emb|AL954667.9| Zebrafish DNA sequence from clone CH211-214K3 in... 44 0.52
378emb|CR762445.5| Zebrafish DNA sequence from clone DKEY-11C9 in l... 44 0.52
379gb|AC091714.3| Papio anubis clone RP41-93A16, complete sequence 44 0.52
380emb|BX530018.8| Zebrafish DNA sequence from clone DKEY-228B21 in... 44 0.52
381gb|AC106864.5| Homo sapiens BAC clone RP11-148B6 from 4, complet... 44 0.52
382gb|AE006465.1| Homo sapiens 16p13.3 sequence section 4 of 8 44 0.52
383emb|AL593857.10| Mouse DNA sequence from clone RP23-439H2 on chr... 44 0.52
384emb|BX601648.7| Zebrafish DNA sequence from clone DKEY-14F19 in ... 44 0.52
385gb|AC093230.2| Homo sapiens chromosome 19 clone LLNLF-130H12, co... 44 0.52
386gb|AC104335.2| Homo sapiens chromosome 1 clone RP11-433K2, compl... 44 0.52
387gb|AC125387.2| Homo sapiens chromosome 19 clone CTD-3056C15, com... 44 0.52
388emb|BX000486.13| Zebrafish DNA sequence from clone DKEY-149M16 i... 44 0.52
389gb|AC090647.6| Genomic sequence for Mus musculus, clone RP23-252... 44 0.52
390gb|AC106030.5| Homo sapiens chromosome 17, clone CTD-3070M1, com... 44 0.52
391gb|AC020913.9| Homo sapiens chromosome 19 clone CTD-3032J10, com... 44 0.52
392gb|AC008745.7| Homo sapiens chromosome 19 clone CTD-2571L23, com... 44 0.52
393emb|BX511146.6| Zebrafish DNA sequence from clone DKEY-150K1 in ... 44 0.52
394gb|AC008737.11| Homo sapiens chromosome 19 clone CTD-2538G9, com... 44 0.52
395emb|BX663524.6| Zebrafish DNA sequence from clone DKEY-97K15, co... 44 0.52
396gb|AF520420.1| Mus musculus c222389 pseudogene, complete sequenc... 44 0.52
397gb|AC010297.5| Homo sapiens chromosome 5 clone CTB-162J7, comple... 44 0.52
398emb|BX936413.10| Zebrafish DNA sequence from clone CH211-48M9 in... 44 0.52
399emb|BX548074.9| Zebrafish DNA sequence from clone CH211-11F6 in ... 44 0.52
400emb|CR318624.8| Zebrafish DNA sequence from clone CH211-227I15 i... 44 0.52
401emb|BX530022.5| Zebrafish DNA sequence from clone DKEY-29A22 in ... 44 0.52
402emb|BX548251.5| Zebrafish DNA sequence from clone BUSM1-127I14, ... 44 0.52
403emb|BX571698.15| Zebrafish DNA sequence from clone DKEYP-121E10 ... 44 0.52
404gb|AC084388.1| Mus musculus clone RP23-132G6, complete sequence 44 0.52
405emb|BX323995.13| Zebrafish DNA sequence from clone RP71-86K19 in... 44 0.52
406emb|BX537326.9| Zebrafish DNA sequence from clone DKEY-4I23 in l... 44 0.52
407emb|CR405690.6| Zebrafish DNA sequence from clone CH211-208M13 i... 44 0.52
408emb|AL954137.18| Zebrafish DNA sequence from clone CH211-222L21 ... 44 0.52
409emb|BX511184.11| Zebrafish DNA sequence from clone DKEY-103A3 in... 44 0.52
410gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 44 0.52
411emb|BX572609.1|CNS09SBP Tetraodon nigroviridis BAC sequence 44 0.52
412dbj|AK128775.1| Homo sapiens cDNA FLJ45390 fis, clone BRHIP3025844 44 0.52
413gb|AC109359.4| Homo sapiens BAC clone RP11-679M12 from 4, comple... 44 0.52
414gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence 44 0.52
415gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence 44 0.52
416gb|AC147797.35| Mus musculus strain C57BL/6J clone rp23-223d3, c... 44 0.52
417gb|AC011492.8| Homo sapiens chromosome 19 clone CTB-187L3, compl... 44 0.52
418gb|AC174478.3| Mus musculus BAC clone RP24-72B9 from chromosome ... 44 0.52
419emb|BX571850.7| Zebrafish DNA sequence from clone DKEY-259L18 in... 44 0.52
420emb|BX664707.24| Zebrafish DNA sequence from clone DKEYP-74B6 in... 44 0.52
421gb|AC115836.5| Homo sapiens chromosome 8, clone RP11-1069E10, co... 44 0.52
422gb|AC092377.3| Homo sapiens chromosome 16 clone RP11-680G10, com... 44 0.52
423gb|AC060226.39| Homo sapiens 12 BAC RP11-101P14 (Roswell Park Ca... 44 0.52
424gb|AC105028.4| Homo sapiens chromosome 17, clone CTD-2171B18, co... 44 0.52
425gb|AC114481.2| Homo sapiens chromosome 3 clone RP13-487A18, comp... 44 0.52
426gb|AC027796.9| Homo sapiens chromosome 17, clone RP11-235E17, co... 44 0.52
427gb|AC069306.6| Homo sapiens BAC clone RP11-654F3 from 4, complet... 44 0.52
428gb|AC005184.1| Homo sapiens Xp22 bins 45-47 BAC GSHB-665N22 (Gen... 44 0.52
429gb|AC007425.16| Homo sapiens 12q24.1-120.5-B PAC RPCI5-1048I22 (... 44 0.52
430gb|AC019270.12| Homo sapiens chromosome 8, clone RP11-10C8, comp... 44 0.52
431dbj|AK136828.1| Mus musculus adult male diencephalon cDNA, RIKEN... 44 0.52
432gb|DQ108647.1| Nodipecten subnodosus clone NsubC023 microsatelli... 44 0.52
433gb|AC182454.2| Mus musculus BAC clone RP24-141G12 from chromosom... 44 0.52
434gb|AC079926.7| Homo sapiens BAC clone RP11-620E11 from 4, comple... 44 0.52
435gb|AC099494.3| Homo sapiens chromosome 16 clone RP11-1102P22, co... 44 0.52
436gb|AC090427.2| Homo sapiens chromosome 19 clone CTD-2292J18, com... 44 0.52
437gb|AF398020.1|AF398020 Cyprinodon nevadensis mionectes microsate... 44 0.52
438gb|AC018347.17| Homo sapiens chromosome 15 clone RP11-410F2, com... 44 0.52
439gb|AC150908.6| Pan troglodytes BAC clone CH251-513A23 from chrom... 44 0.52
440gb|AC022844.8| Homo sapiens chromosome 8, clone RP11-250P18, com... 44 0.52
441emb|BX005093.22| Zebrafish DNA sequence from clone CH211-210G13 ... 44 0.52
442emb|BX255915.13| Zebrafish DNA sequence from clone CH211-245L1 i... 44 0.52
443gb|AC134749.4| Rattus norvegicus BAC CH230-353M13 (Children's H... 44 0.52
444emb|BX537118.12| Zebrafish DNA sequence from clone CH211-202N8, ... 44 0.52
445emb|BX248512.14| Zebrafish DNA sequence from clone CH211-284D12 ... 44 0.52
446emb|BX322601.9| Zebrafish DNA sequence from clone DKEY-170H8 in ... 44 0.52
447emb|BX322620.13| Zebrafish DNA sequence from clone DKEY-49L3 in ... 44 0.52
448emb|BX088704.7| Zebrafish DNA sequence from clone CH211-208M6 in... 44 0.52
449emb|BX323090.7| Zebrafish DNA sequence from clone CH211-274B7 in... 44 0.52
450emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 i... 44 0.52
451gb|AC153141.7| Mus musculus BAC clone RP23-268A17 from chromosom... 44 0.52
452emb|BX897656.9| Zebrafish DNA sequence from clone CH211-271K12, ... 44 0.52
453gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, com... 44 0.52
454emb|BX649368.5| Zebrafish DNA sequence from clone CH211-191A16 i... 44 0.52
455emb|BX323831.7| Zebrafish DNA sequence from clone CH211-12E7 in ... 44 0.52
456gb|AC161936.2| Pan troglodytes BAC clone CH251-175C18 from chrom... 44 0.52
457gb|AC009704.8| Homo sapiens chromosome 18, clone RP11-231E4, com... 44 0.52
458gb|AC153590.7| Mus musculus 6 BAC RP23-480O11 (Roswell Park Canc... 44 0.52
459gb|AC159818.2| Mus musculus BAC clone RP23-244M3 from chromosome... 44 0.52
460gb|AC148986.5| Mus musculus BAC clone RP23-89A16 from chromosome... 44 0.52
461gb|AC152060.3| Mus musculus BAC clone RP23-430C3 from chromosome... 44 0.52
462emb|BX255951.13| Zebrafish DNA sequence from clone DKEYP-31E5 in... 44 0.52
463emb|BX000363.21| Zebrafish DNA sequence from clone CH211-10K11 i... 44 0.52
464gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome... 44 0.52
465gb|AF016351.1|H006101S08 Homo sapiens hexokinase I (HK1) gene, e... 44 0.52
466gb|AC154454.2| Mus musculus BAC clone RP24-173H15 from chromosom... 44 0.52
467dbj|AK084923.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 44 0.52
468gb|AC099694.12| Mus musculus, clone RP23-195D9, complete sequence 44 0.52
469gb|AC009063.8| Homo sapiens chromosome 16 clone RP11-298D21, com... 44 0.52
470gb|AC027016.4|AC027016 Homo sapiens chromosome 11, clone RP11-43... 44 0.52
471gb|AC000038.2| Homo sapiens Chromosome 22q13 Cosmid Clone p101h3... 44 0.52
472gb|AC005744.2| Homo sapiens chromosome 22 clone dj10i10 map 22q1... 44 0.52
473dbj|AK050569.1| Mus musculus adult pancreas islet cells cDNA, RI... 44 0.52
474emb|BX323883.14| Zebrafish DNA sequence from clone CH211-285M21 ... 44 0.52
475gb|AC022379.2|AC022379 Homo sapiens chromosome 3 clone 996C6 map... 44 0.52
476gb|AC009995.9|AC009995 Homo sapiens chromosome 8, clone RP11-373... 44 0.52
477dbj|AK083074.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 44 0.52
478emb|BX324224.11| Zebrafish DNA sequence from clone CH211-168H21 ... 44 0.52
479gb|AC158596.7| Mus musculus 10 BAC RP23-188F7 (Roswell Park Canc... 44 0.52
480gb|AC153587.2| Mus musculus 6 BAC RP23-361L1 (Roswell Park Cance... 44 0.52
481emb|BX255943.6| Zebrafish DNA sequence from clone CH211-246M13 i... 44 0.52
482emb|BX120011.13| Zebrafish DNA sequence from clone DKEY-18O5 in ... 44 0.52
483emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 ... 44 0.52
484emb|BX276093.11| Zebrafish DNA sequence from clone DKEY-94F20 in... 44 0.52
485emb|BX323035.8| Zebrafish DNA sequence from clone DKEYP-94H10 in... 44 0.52
486emb|BX000463.19| Zebrafish DNA sequence from clone CH211-266I2, ... 44 0.52
487emb|BX571670.7| Zebrafish DNA sequence from clone DKEY-153J7 in ... 44 0.52
488emb|AL112860.1|CNS01AF8 Botrytis cinerea strain T4 cDNA library 44 0.52
489emb|BX255960.14| Zebrafish DNA sequence from clone DKEY-265E17 i... 44 0.52
490emb|BX247872.12| Zebrafish DNA sequence from clone CH211-223M9, ... 44 0.52
491emb|BX005156.9| Zebrafish DNA sequence from clone CH211-165F21 i... 44 0.52
492emb|AL929493.20| Zebrafish DNA sequence from clone CH211-157D2, ... 44 0.52
493emb|BX539325.9| Zebrafish DNA sequence from clone CH211-253B18 i... 44 0.52
494gb|AC138956.3| Homo sapiens chromosome 5 clone RP11-843P14, comp... 44 0.52
495gb|AC027281.10| Homo sapiens chromosome 16 clone RP11-424M24, co... 44 0.52
496gb|AC012173.9| Homo sapiens chromosome 16 clone RP11-152P23, com... 44 0.52
497gb|AC007224.5| Homo sapiens chromosome 16 clone RP11-475D10, com... 44 0.52
498gb|AC103831.4| Homo sapiens chromosome 8, clone RP11-1023P17, co... 44 0.52
499gb|AC083816.21|AC083816 Mus musculus X BAC RP23-330G24 (Roswell ... 44 0.52
500gb|AC115949.13| Mus musculus chromosome 3, clone RP24-568B16, co... 44 0.52

>dbj|AK103626.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133N22, full
            insert sequence
          Length = 2356

 Score =  206 bits (104), Expect = 6e-50
 Identities = 212/248 (85%)
 Strand = Plus / Minus

                                                                        
Query: 347  tgtagcgtttcagctctttgatcgccgccagcagcacatgcaaacacaccggcgcaaaga 406
            |||| |||||||||||||| ||  |||||| ||||||||||||  | || ||||||||||
Sbjct: 1855 tgtatcgtttcagctctttcattaccgccaacagcacatgcaaggaaactggcgcaaaga 1796

                                                                        
Query: 407  atggcatgtagatcgcgaagtagtgctccaccgaagcataactgattgacataatcgacg 466
            |||||||||| ||||| || |||||||| |  |||||||||||||| |||||||  || |
Sbjct: 1795 atggcatgtaaatcgcaaaatagtgctctattgaagcataactgatagacataacagatg 1736

                                                                        
Query: 467  gatggaagaatgcatcctcggccaatgccctcgccctcgttgcagacactgctgaagagt 526
            |||| || ||||||||||| ||||| |||||||| || |||||||| |||||||||||||
Sbjct: 1735 gatgaaaaaatgcatcctcagccaaagccctcgctcttgttgcagatactgctgaagagt 1676

                                                                        
Query: 527  cgcctataccaagagtggcgttcctttgggctaaacttgcggcttcaagagaaagctcaa 586
            | | ||| || ||  | ||||| ||||| ||||||||||| |||||||||||||||||||
Sbjct: 1675 cacttattccgaggcttgcgtttctttgagctaaacttgcagcttcaagagaaagctcaa 1616

                    
Query: 587  cctgcctc 594
            ||||||||
Sbjct: 1615 cctgcctc 1608



to top

>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0497A05
          Length = 130919

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/108 (84%)
 Strand = Plus / Minus

                                                                         
Query: 411   catgtagatcgcgaagtagtgctccaccgaagcataactgattgacataatcgacggatg 470
             |||||| ||||| || |||||||| |  |||||||||||||| |||||||  || |||||
Sbjct: 38887 catgtaaatcgcaaaatagtgctctattgaagcataactgatagacataacagatggatg 38828

                                                             
Query: 471   gaagaatgcatcctcggccaatgccctcgccctcgttgcagacactgc 518
              || ||||||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 38827 aaaaaatgcatcctcagccaaagccctcgctcttgttgcagatactgc 38780



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 515   ctgctgaagagtcgcctataccaagagtggcgttcctttgggctaaacttgcggcttcaa 574
             ||||||||||||| | ||| || ||  | ||||| ||||| ||||||||||| |||||||
Sbjct: 38683 ctgctgaagagtcacttattccgaggcttgcgtttctttgagctaaacttgcagcttcaa 38624

                              
Query: 575   gagaaagctcaacctgc 591
             |||||||||||||||||
Sbjct: 38623 gagaaagctcaacctgc 38607



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 347   tgtagcgtttcagctctttgatcgccgccagcagcacatgcaaacacaccggcgcaaaga 406
             |||| |||||||||||||| ||  |||||| ||||||||||||  | || ||||||||||
Sbjct: 39298 tgtatcgtttcagctctttcattaccgccaacagcacatgcaaggaaactggcgcaaaga 39239

                  
Query: 407   atggc 411
             |||||
Sbjct: 39238 atggc 39234



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 262    atgatggatggatggatggat 282
              |||||||||||||||||||||
Sbjct: 112941 atgatggatggatggatggat 112961



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/108 (84%)
 Strand = Plus / Minus

                                                                            
Query: 411      catgtagatcgcgaagtagtgctccaccgaagcataactgattgacataatcgacggatg 470
                |||||| ||||| || |||||||| |  |||||||||||||| |||||||  || |||||
Sbjct: 39484445 catgtaaatcgcaaaatagtgctctattgaagcataactgatagacataacagatggatg 39484386

                                                                
Query: 471      gaagaatgcatcctcggccaatgccctcgccctcgttgcagacactgc 518
                 || ||||||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 39484385 aaaaaatgcatcctcagccaaagccctcgctcttgttgcagatactgc 39484338



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                            
Query: 515      ctgctgaagagtcgcctataccaagagtggcgttcctttgggctaaacttgcggcttcaa 574
                ||||||||||||| | ||| || ||  | ||||| ||||| ||||||||||| |||||||
Sbjct: 39484241 ctgctgaagagtcacttattccgaggcttgcgtttctttgagctaaacttgcagcttcaa 39484182

                                 
Query: 575      gagaaagctcaacctgc 591
                |||||||||||||||||
Sbjct: 39484181 gagaaagctcaacctgc 39484165



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                            
Query: 347      tgtagcgtttcagctctttgatcgccgccagcagcacatgcaaacacaccggcgcaaaga 406
                |||| |||||||||||||| ||  |||||| ||||||||||||  | || ||||||||||
Sbjct: 39484856 tgtatcgtttcagctctttcattaccgccaacagcacatgcaaggaaactggcgcaaaga 39484797

                     
Query: 407      atggc 411
                |||||
Sbjct: 39484796 atggc 39484792



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 262      atgatggatggatggatggat 282
                |||||||||||||||||||||
Sbjct: 39558499 atgatggatggatggatggat 39558519



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 264      gatggatggatggatggatca 284
                |||||||||||||||||||||
Sbjct: 21899277 gatggatggatggatggatca 21899297



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 264      gatggatggatggatggatc 283
                ||||||||||||||||||||
Sbjct: 38610165 gatggatggatggatggatc 38610184



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 264      gatggatggatggatggatc 283
                ||||||||||||||||||||
Sbjct: 27050290 gatggatggatggatggatc 27050309



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 264     gatggatggatggatggatc 283
               ||||||||||||||||||||
Sbjct: 7149165 gatggatggatggatggatc 7149184



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 264     gatggatggatggatggatc 283
               ||||||||||||||||||||
Sbjct: 1485321 gatggatggatggatggatc 1485302



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 61355 tgatggatggatggatggat 61374



to top

>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1417F08
          Length = 155536

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/108 (84%)
 Strand = Plus / Minus

                                                                         
Query: 411   catgtagatcgcgaagtagtgctccaccgaagcataactgattgacataatcgacggatg 470
             |||||| ||||| || |||||||| |  |||||||||||||| |||||||  || |||||
Sbjct: 59459 catgtaaatcgcaaaatagtgctctattgaagcataactgatagacataacagatggatg 59400

                                                             
Query: 471   gaagaatgcatcctcggccaatgccctcgccctcgttgcagacactgc 518
              || ||||||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 59399 aaaaaatgcatcctcagccaaagccctcgctcttgttgcagatactgc 59352



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 515   ctgctgaagagtcgcctataccaagagtggcgttcctttgggctaaacttgcggcttcaa 574
             ||||||||||||| | ||| || ||  | ||||| ||||| ||||||||||| |||||||
Sbjct: 59255 ctgctgaagagtcacttattccgaggcttgcgtttctttgagctaaacttgcagcttcaa 59196

                              
Query: 575   gagaaagctcaacctgc 591
             |||||||||||||||||
Sbjct: 59195 gagaaagctcaacctgc 59179



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 347   tgtagcgtttcagctctttgatcgccgccagcagcacatgcaaacacaccggcgcaaaga 406
             |||| |||||||||||||| ||  |||||| ||||||||||||  | || ||||||||||
Sbjct: 59870 tgtatcgtttcagctctttcattaccgccaacagcacatgcaaggaaactggcgcaaaga 59811

                  
Query: 407   atggc 411
             |||||
Sbjct: 59810 atggc 59806



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 262    atgatggatggatggatggat 282
              |||||||||||||||||||||
Sbjct: 133513 atgatggatggatggatggat 133533



to top

>ref|XM_463578.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1674

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 347  tgtagcgtttcagctctttgatcgccgccagcagcacatgcaaacacaccggcgcaaaga 406
            |||| |||||||||||||| ||  |||||| ||||||||||||  | || ||||||||||
Sbjct: 1618 tgtatcgtttcagctctttcattaccgccaacagcacatgcaaggaaactggcgcaaaga 1559

                 
Query: 407  atggc 411
            |||||
Sbjct: 1558 atggc 1554



to top

>gb|AC112683.10| Mus musculus chromosome 17, clone RP23-332P1, complete sequence
          Length = 206979

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                             
Query: 251    gcctgtctccgatgatggatggatggatgga 281
              ||||||||| |||||||||||||||||||||
Sbjct: 140173 gcctgtctcagatgatggatggatggatgga 140203



to top

>gb|AC146131.4| Pan troglodytes BAC clone RP43-4F15 from 7, complete sequence
          Length = 179576

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 266    tggatggatggatggatcaggaggaggt 293
              ||||||||||||||||| ||||||||||
Sbjct: 113601 tggatggatggatggatgaggaggaggt 113574



to top

>gb|AC024730.7| Homo sapiens BAC clone RP11-422E4 from 7, complete sequence
          Length = 151198

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 266    tggatggatggatggatcaggaggaggt 293
              ||||||||||||||||| ||||||||||
Sbjct: 150945 tggatggatggatggatgaggaggaggt 150918



to top

>gb|AC098563.6| Rattus norvegicus 1 BAC CH230-123A15 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 250414

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 261   gatgatggatggatggatggatca 284
             ||||||||||||||||||||||||
Sbjct: 70967 gatgatggatggatggatggatca 70944



to top

>emb|AL805977.2| Human DNA sequence from clone RP11-491O20 on chromosome 6, complete
             sequence
          Length = 174830

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 266   tggatggatggatggatcaggaggaggt 293
             ||||||||||||||||| ||||||||||
Sbjct: 86007 tggatggatggatggatgaggaggaggt 86034



to top

>emb|CT025624.11| Mouse DNA sequence from clone RP24-212N20 on chromosome 14, complete
             sequence
          Length = 198113

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 259   ccgatgatggatggatggatggat 282
             ||||||||||||||||||||||||
Sbjct: 55482 ccgatgatggatggatggatggat 55505



to top

>gb|AC140409.3| Mus musculus BAC clone RP23-138K22 from 9, complete sequence
          Length = 200157

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 264    gatggatggatggatggatcagga 287
              ||||||||||||||||||||||||
Sbjct: 116869 gatggatggatggatggatcagga 116846



to top

>gb|AC079356.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0016H04,
             complete sequence
          Length = 176678

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 261   gatgatggatggatggatggatc 283
             |||||||||||||||||||||||
Sbjct: 28741 gatgatggatggatggatggatc 28719



to top

>emb|CR790381.6| Zebrafish DNA sequence from clone DKEY-202K24 in linkage group 3,
             complete sequence
          Length = 93389

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 260   cgatgatggatggatggatggat 282
             |||||||||||||||||||||||
Sbjct: 12536 cgatgatggatggatggatggat 12514



to top

>emb|AL157884.9| Human DNA sequence from clone RP11-462B18 on chromosome 9p13.1-21.1
             Contains a pseudogene similar to part of membrane guanylyl
             cyclase, a ribosomal protein S11 (RPS11) pseudogene, a
             novel gene and a CpG island, complete sequence
          Length = 176932

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 264   gatggatggatggatggatcagg 286
             |||||||||||||||||||||||
Sbjct: 15301 gatggatggatggatggatcagg 15323



to top

>gb|AC079022.2|AC079022 Oryza sativa chromosome 5 clone P0574H01, complete sequence
          Length = 151589

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 261    gatgatggatggatggatggatc 283
              |||||||||||||||||||||||
Sbjct: 111140 gatgatggatggatggatggatc 111118



to top

>gb|AC009041.10| Homo sapiens chromosome 16 clone RP11-161M6, complete sequence
          Length = 162342

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 260    cgatgatggatggatggatggat 282
              |||||||||||||||||||||||
Sbjct: 103643 cgatgatggatggatggatggat 103621



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 102969 gatgatggatggatggatggat 102948



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 103885 tgatggatggatggatggat 103866



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 103831 tgatggatggatggatggat 103812



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 261    gatgatggatggatggatggatc 283
              |||||||||||||||||||||||
Sbjct: 511342 gatgatggatggatggatggatc 511320



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 264      gatggatggatggatggatc 283
                ||||||||||||||||||||
Sbjct: 29274201 gatggatggatggatggatc 29274182



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 264      gatggatggatggatggatc 283
                ||||||||||||||||||||
Sbjct: 27828960 gatggatggatggatggatc 27828979



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 264      gatggatggatggatggatc 283
                ||||||||||||||||||||
Sbjct: 26720646 gatggatggatggatggatc 26720665



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 263      tgatggatggatggatggat 282
                ||||||||||||||||||||
Sbjct: 21250936 tgatggatggatggatggat 21250955



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 263      tgatggatggatggatggat 282
                ||||||||||||||||||||
Sbjct: 16466601 tgatggatggatggatggat 16466620



to top

>gb|AC158686.2| Mus musculus 10 BAC RP24-74G10 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 217129

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 260    cgatgatggatggatggatggat 282
              |||||||||||||||||||||||
Sbjct: 110400 cgatgatggatggatggatggat 110422



to top

>dbj|AK121142.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023077M04, full
           insert sequence
          Length = 777

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 261 gatgatggatggatggatggatc 283
           |||||||||||||||||||||||
Sbjct: 512 gatgatggatggatggatggatc 490



to top

>dbj|AK099779.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095J12, full
           insert sequence
          Length = 720

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 261 gatgatggatggatggatggatc 283
           |||||||||||||||||||||||
Sbjct: 484 gatgatggatggatggatggatc 462



to top

>gb|AC166099.2| Mus musculus BAC clone RP24-254H22 from chromosome 17, complete
             sequence
          Length = 164625

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 264   gatggatggatggatggatcagg 286
             |||||||||||||||||||||||
Sbjct: 49438 gatggatggatggatggatcagg 49416



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 49492 gatgatggatggatggatggat 49471



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 49457 gatgatggatggatggatggat 49436



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 48398 gatgatggatggatggatggat 48377



to top

>gb|AC166360.4| Mus musculus BAC clone RP24-497L5 from chromosome 17, complete sequence
          Length = 201109

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 264   gatggatggatggatggatcagg 286
             |||||||||||||||||||||||
Sbjct: 26225 gatggatggatggatggatcagg 26203



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 26279 gatgatggatggatggatggat 26258



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 26244 gatgatggatggatggatggat 26223



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 25185 gatgatggatggatggatggat 25164



to top

>gb|AC107851.17| Mus musculus chromosome 9, clone RP23-451B4, complete sequence
          Length = 190253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 22861 gatgatggatggatggatggat 22840



to top

>gb|AC146980.9| Mus musculus chromosome 3, clone RP24-97N14, complete sequence
          Length = 161054

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 84392 gatgatggatggatggatggat 84371



to top

>gb|AC098644.4| Takifugu rubripes clone 205P11, complete sequence
          Length = 89481

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 51111 gatgatggatggatggatggat 51132



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 50989 gatgatggatggatggatggat 51010



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 261   gatgatggatggatggatgga 281
             |||||||||||||||||||||
Sbjct: 51072 gatgatggatggatggatgga 51092



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 261   gatgatggatggatggatgga 281
             |||||||||||||||||||||
Sbjct: 50950 gatgatggatggatggatgga 50970



to top

>gb|AC167359.4| Mus musculus BAC clone RP24-94F12 from chromosome 8, complete sequence
          Length = 176523

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 14568 gatgatggatggatggatggat 14547



to top

>gb|AC116386.9| Mus musculus chromosome 15, clone RP23-37B16, complete sequence
          Length = 185556

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 150654 gatgatggatggatggatggat 150675



to top

>gb|AC115972.13| Mus musculus chromosome 5, clone RP24-79A6, complete sequence
          Length = 235928

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 89851 gatgatggatggatggatggat 89872



to top

>gb|AC167816.4| Mus musculus BAC clone RP23-317F20 from chromosome 9, complete sequence
          Length = 198915

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 37853 gatgatggatggatggatggat 37832



to top

>gb|AC162177.2| Mus musculus BAC clone RP24-159F5 from chromosome 9, complete sequence
          Length = 148915

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 115167 gatgatggatggatggatggat 115146



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 80353 gatgatggatggatggatggat 80332



to top

>gb|AC164546.2| Mus musculus BAC clone RP24-189C11 from chromosome 17, complete
            sequence
          Length = 156583

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 6279 gatgatggatggatggatggat 6300



to top

>gb|AC113121.27| Mus musculus chromosome 8, clone RP23-347G12, complete sequence
          Length = 192877

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 17220 gatgatggatggatggatggat 17199



to top

>gb|AC108768.14| Mus musculus chromosome 8, clone RP23-398L15, complete sequence
          Length = 209808

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 83425 gatgatggatggatggatggat 83446



to top

>gb|AC118588.6| Mus musculus chromosome 15, clone RP24-576D3, complete sequence
          Length = 175210

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 77966 gatgatggatggatggatggat 77945



to top

>gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, complete sequence
          Length = 183264

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 144590 gatgatggatggatggatggat 144611



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 20517 gatgatggatggatggatggat 20496



to top

>gb|AC113538.14| Mus musculus chromosome 8, clone RP23-118F24, complete sequence
          Length = 206380

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 91825 gatgatggatggatggatggat 91846



to top

>gb|AC102525.8| Mus musculus chromosome 8, clone RP24-133K20, complete sequence
          Length = 162463

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 135798 gatgatggatggatggatggat 135819



to top

>gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosome 5, complete
            sequence
          Length = 206735

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 5179 gatgatggatggatggatggat 5158



to top

>gb|AC164105.4| Mus musculus BAC clone RP23-433B2 from chromosome 9, complete sequence
          Length = 215089

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 60633 gatgatggatggatggatggat 60654



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 60610 gatgatggatggatggatggat 60631



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 60583 gatgatggatggatggatggat 60604



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 60544 gatgatggatggatggatggat 60565



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 60510 gatgatggatggatggatggat 60531



to top

>gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome 6, complete sequence
          Length = 229027

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 25768 gatgatggatggatggatggat 25789



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 25390 gatgatggatggatggatggat 25411



to top

>gb|AC165274.2| Mus musculus BAC clone RP24-97D3 from chromosome 16, complete sequence
          Length = 175488

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 93973 gatgatggatggatggatggat 93952



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 93763 gatgatggatggatggatggat 93742



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 93729 gatgatggatggatggatggat 93708



to top

>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence
          Length = 190857

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 264    gatggatggatggatggatcag 285
              ||||||||||||||||||||||
Sbjct: 147093 gatggatggatggatggatcag 147114



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 134509 tgatggatggatggatggat 134528



to top

>gb|AC165151.2| Mus musculus BAC clone RP24-77O15 from chromosome 16, complete sequence
          Length = 177446

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 263   tgatggatggatggatggatca 284
             ||||||||||||||||||||||
Sbjct: 75423 tgatggatggatggatggatca 75402



to top

>gb|AC165960.4| Mus musculus BAC clone RP23-395M20 from chromosome 17, complete
            sequence
          Length = 192675

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 8273 gatgatggatggatggatggat 8294



to top

>gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, complete sequence
          Length = 162139

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11572 gatgatggatggatggatggat 11593



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 262   atgatggatggatggatggat 282
             |||||||||||||||||||||
Sbjct: 57517 atgatggatggatggatggat 57537



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 266   tggatggatggatggatcag 285
             ||||||||||||||||||||
Sbjct: 11194 tggatggatggatggatcag 11213



to top

>gb|AC120865.7| Mus musculus chromosome 5, clone RP23-88L6, complete sequence
          Length = 235287

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 15163 gatgatggatggatggatggat 15142



to top

>gb|AF016494.1| Fugu rubripes gamma-aminobutyric acid receptor beta subunit gene,
             partial cds; 55kd erythrocyte membrane protein (P55),
             synaptic vesicle-associated integral membrane protein
             (VAMP-1), procollagen C-proteinase enhancer protein
             (PCOLCE) genes, complete cds; and glucose repression
             mediator protein (GRMP) gene, partial cds
          Length = 66729

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 62190 gatgatggatggatggatggat 62169



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 62155 gatgatggatggatggatggat 62134



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 62125 gatgatggatggatggatggat 62104



to top

>gb|AC158974.8| Mus musculus chromosome 15, clone RP24-252G18, complete sequence
          Length = 170539

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129896 gatgatggatggatggatggat 129875



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129843 gatgatggatggatggatggat 129822



to top

>gb|AF487493.1| Ochotona princeps clone OCP2 microsatellite sequence
          Length = 758

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 261 gatgatggatggatggatggat 282
           ||||||||||||||||||||||
Sbjct: 332 gatgatggatggatggatggat 353



to top

>gb|AF406937.1| Clupea pallasi microsatellite Cpa101 sequence
          Length = 399

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 261 gatgatggatggatggatggat 282
           ||||||||||||||||||||||
Sbjct: 342 gatgatggatggatggatggat 321



to top

>gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, complete sequence
          Length = 206840

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 86452 gatgatggatggatggatggat 86473



to top

>gb|AC166800.5| Mus musculus chromosome 1, clone RP24-260I21, complete sequence
          Length = 162752

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 121996 gatgatggatggatggatggat 122017



to top

>gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, complete sequence
          Length = 242587

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 82112 gatgatggatggatggatggat 82091



to top

>gb|AC121594.3| Mus musculus BAC clone RP23-297A16 from chromosome 8, complete sequence
          Length = 209451

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 75485 gatgatggatggatggatggat 75464



to top

>gb|AC165091.3| Mus musculus BAC clone RP23-25M19 from chromosome 17, complete sequence
          Length = 198085

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 182980 gatgatggatggatggatggat 182959



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 182858 tgatggatggatggatggat 182839



to top

>gb|AC117236.4| Mus musculus BAC clone RP23-416K18 from chromosome 12, complete sequence
          Length = 198569

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 114458 gatgatggatggatggatggat 114479



to top

>gb|AC167246.2| Mus musculus BAC clone RP23-401H11 from chromosome 9, complete
            sequence
          Length = 160140

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 4008 gatgatggatggatggatggat 4029



to top

>gb|AC114671.14| Mus musculus chromosome 5, clone RP24-199D21, complete sequence
          Length = 172228

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 50167 gatgatggatggatggatggat 50146



to top

>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence
          Length = 216191

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 70677 gatgatggatggatggatggat 70698



to top

>gb|AY303753.1| Takifugu rubripes erythropoietin (EPO) gene, complete cds,
             alternatively spliced
          Length = 63527

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 63101 gatgatggatggatggatggat 63122



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 62998 gatgatggatggatggatggat 63019



to top

>gb|AC150512.3| Bos taurus  BAC CH240-319N17 (Children's Hospital Oakland Research
            Institute Bovine BAC Library (male)) complete sequence
          Length = 167026

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 3057 gatgatggatggatggatggat 3078



to top

>gb|AC112361.5| Rattus norvegicus 9 BAC CH230-61F12 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 216648

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 172357 gatgatggatggatggatggat 172378



to top

>gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, complete sequence
          Length = 186914

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 182908 gatgatggatggatggatggat 182887



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 264    gatggatggatggatggatc 283
              ||||||||||||||||||||
Sbjct: 182781 gatggatggatggatggatc 182762



to top

>gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, complete sequence
          Length = 171861

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129558 gatgatggatggatggatggat 129579



to top

>gb|AC116500.13| Mus musculus chromosome 5, clone RP24-297N9, complete sequence
          Length = 177689

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 166004 gatgatggatggatggatggat 166025



to top

>gb|AF241735.2| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete
            sequence
          Length = 39877

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 6200 gatgatggatggatggatggat 6221



to top

>gb|AF241734.2| Homo sapiens chromosome X clone RP1-34M10 map p11.4, complete sequence
          Length = 119916

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 113807 gatgatggatggatggatggat 113828



to top

>gb|AC091810.4| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete
            sequence
          Length = 100442

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 7231 gatgatggatggatggatggat 7252



to top

>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence
          Length = 152414

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 109605 gatgatggatggatggatggat 109584



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    gatgatggatggatggatgg 280
              ||||||||||||||||||||
Sbjct: 109658 gatgatggatggatggatgg 109639



to top

>gb|AC146610.4| Mus musculus BAC clone RP23-68E7 from chromosome 7, complete sequence
          Length = 218291

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 213174 gatgatggatggatggatggat 213153



to top

>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence
          Length = 203437

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 19096 gatgatggatggatggatggat 19075



to top

>gb|AC134553.5| Mus musculus BAC clone RP24-280H19 from chromosome 12, complete
             sequence
          Length = 168895

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 264   gatggatggatggatggatcag 285
             ||||||||||||||||||||||
Sbjct: 37531 gatggatggatggatggatcag 37510



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 16069 tgatggatggatggatggat 16088



to top

>gb|AC142145.3| Mus musculus BAC clone RP24-69D13 from chromosome 8, complete
            sequence
          Length = 169014

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 4932 gatgatggatggatggatggat 4911



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 4807 gatgatggatggatggatggat 4786



to top

>gb|AC127415.3| Mus musculus BAC clone RP23-450L4 from chromosome 19, complete sequence
          Length = 177302

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 104607 gatgatggatggatggatggat 104586



to top

>gb|AC132345.4| Mus musculus BAC clone RP24-177P9 from chromosome 9, complete sequence
          Length = 183638

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 158610 gatgatggatggatggatggat 158589



to top

>gb|AC121152.15| Mus musculus chromosome 10, clone RP24-344A4, complete sequence
          Length = 147999

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 24343 gatgatggatggatggatggat 24322



to top

>gb|AC184848.2| Pan troglodytes BAC clone CH251-277H16 from chromosome 7, complete
             sequence
          Length = 155781

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 35540 gatgatggatggatggatggat 35519



to top

>ref|XM_951865.1| Neurospora crassa OR74A hypothetical protein ( glucan
            1,4-alpha-glucosidase related protein [imported] -
            Neurospora crassa OR74A ) (NCU01509.1) partial mRNA
          Length = 2253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 2220 gatgatggatggatggatggat 2241



to top

>ref|XM_327947.1| Neurospora crassa OR74A hypothetical protein ( glucan
            1,4-alpha-glucosidase related protein [imported] -
            Neurospora crassa OR74A ) (NCU01509.1) partial mRNA
          Length = 2253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 2220 gatgatggatggatggatggat 2241



to top

>gb|AC161283.2| Pan troglodytes BAC clone CH251-354N8 from chromosome 7, complete
             sequence
          Length = 160292

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 36910 gatgatggatggatggatggat 36889



to top

>gb|AY623110.1| Homo sapiens solute carrier family 6 (neurotransmitter transporter,
             dopamine), member 3 (SLC6A3) gene, complete cds
          Length = 55005

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 26644 gatgatggatggatggatggat 26665



to top

>gb|AC134442.4| Mus musculus BAC clone RP24-104I4 from chromosome 8, complete sequence
          Length = 153086

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 19875 gatgatggatggatggatggat 19896



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 19753 gatgatggatggatggatggat 19774



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 19630 tgatggatggatggatggat 19649



to top

>gb|AC147160.2| Mus musculus BAC clone RP24-336A22 from chromosome 15, complete sequence
          Length = 205374

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 131689 gatgatggatggatggatggat 131668



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 131542 gatgatggatggatggatggat 131521



to top

>gb|AC129205.3| Mus musculus BAC clone RP24-235I5 from chromosome 19, complete sequence
          Length = 165024

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 72683 gatgatggatggatggatggat 72704



to top

>gb|AC126424.12| Mus musculus chromosome 17, clone RP23-19K10, complete sequence
          Length = 182696

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 163455 gatgatggatggatggatggat 163476



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 163395 gatgatggatggatggatggat 163416



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 163298 gatgatggatggatggatggat 163319



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 163241 gatgatggatggatggatggat 163262



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 163211 gatgatggatggatggatggat 163232



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 163135 gatgatggatggatggatggat 163156



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 261    gatgatggatggatggatgga 281
              |||||||||||||||||||||
Sbjct: 163485 gatgatggatggatggatgga 163505



to top

>gb|AC115360.6| Mus musculus BAC clone RP23-191N22 from chromosome 19, complete sequence
          Length = 217325

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 154897 gatgatggatggatggatggat 154876



to top

>gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosome 12, complete
             sequence
          Length = 172985

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 94638 gatgatggatggatggatggat 94659



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 262    atgatggatggatggatggat 282
              |||||||||||||||||||||
Sbjct: 164555 atgatggatggatggatggat 164535



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 264    gatggatggatggatggatc 283
              ||||||||||||||||||||
Sbjct: 108127 gatggatggatggatggatc 108108



to top

>gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome 9, complete sequence
          Length = 221263

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 180251 gatgatggatggatggatggat 180272



to top

>gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosome Y, complete sequence
          Length = 172606

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 45343 gatgatggatggatggatggat 45322



to top

>gb|AC142265.4| Mus musculus BAC clone RP24-360F24 from chromosome Y, complete sequence
          Length = 164772

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 12957 gatgatggatggatggatggat 12936



to top

>gb|AC134831.3| Mus musculus BAC clone RP24-500P4 from chromosome 18, complete sequence
          Length = 188380

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 19618 gatgatggatggatggatggat 19639



to top

>gb|DQ481668.1| Takifugu rubripes HoxDa gene cluster, complete sequence
          Length = 366816

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 30600 gatgatggatggatggatggat 30621



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 30520 gatgatggatggatggatggat 30541



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 261   gatgatggatggatggatgga 281
             |||||||||||||||||||||
Sbjct: 30664 gatgatggatggatggatgga 30684



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 261   gatgatggatggatggatgga 281
             |||||||||||||||||||||
Sbjct: 30577 gatgatggatggatggatgga 30597



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 262    atgatggatggatggatgga 281
              ||||||||||||||||||||
Sbjct: 357404 atgatggatggatggatgga 357385



to top

>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence
          Length = 189304

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11178 gatgatggatggatggatggat 11157



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11151 gatgatggatggatggatggat 11130



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11124 gatgatggatggatggatggat 11103



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11094 gatgatggatggatggatggat 11073



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11075 gatgatggatggatggatggat 11054



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11048 gatgatggatggatggatggat 11027



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 11006 gatgatggatggatggatggat 10985



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 10976 gatgatggatggatggatggat 10955



to top

>gb|AC183431.1| Mus musculus BAC clone RP24-128G23 from chromosome y, complete sequence
          Length = 158633

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 86397 gatgatggatggatggatggat 86376



to top

>gb|AC118546.80| Mus musculus strain C57BL/6J clone rp23-346h22 map 17, complete
             sequence
          Length = 223070

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 30112 gatgatggatggatggatggat 30091



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 28992 gatgatggatggatggatggat 28971



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 29327 tgatggatggatggatggat 29308



to top

>gb|AC157552.10| Mus musculus chromosome 7, clone RP23-89C10, complete sequence
          Length = 195587

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 39328 gatgatggatggatggatggat 39349



to top

>gb|AC158215.3| Mus musculus chromosome 7, clone RP24-180E12, complete sequence
          Length = 156342

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 1983 gatgatggatggatggatggat 1962



to top

>gb|AC113028.15| Mus musculus chromosome 5, clone RP23-205D3, complete sequence
          Length = 275646

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 135114 gatgatggatggatggatggat 135093



to top

>gb|AC116473.13| Mus musculus chromosome 8, clone RP23-385E22, complete sequence
          Length = 186155

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 156934 gatgatggatggatggatggat 156955



to top

>gb|AC115863.17| Mus musculus chromosome 9, clone RP24-295J1, complete sequence
          Length = 174095

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 63182 gatgatggatggatggatggat 63161



to top

>gb|AF235096.5| Homo sapiens chromosome 8 clone RP11-562D1 map q24.13, complete
             sequence
          Length = 199966

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 32498 gatgatggatggatggatggat 32477



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 31971 gatgatggatggatggatggat 31950



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   gatgatggatggatggatgg 280
             ||||||||||||||||||||
Sbjct: 32328 gatgatggatggatggatgg 32309



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   gatgatggatggatggatgg 280
             ||||||||||||||||||||
Sbjct: 32270 gatgatggatggatggatgg 32251



to top

>gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 183897

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 8650 gatgatggatggatggatggat 8671



to top

>gb|AY277963.1| Takifugu rubripes transcription factor Sox8b (Sox8b) gene, complete
            cds
          Length = 13279

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 4460 gatgatggatggatggatggat 4439



to top

>gb|AC125274.12| Mus musculus chromosome 15, clone RP24-157F9, complete sequence
          Length = 188060

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 47562 gatgatggatggatggatggat 47541



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 47509 gatgatggatggatggatggat 47488



to top

>gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, complete sequence
          Length = 193489

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 155215 gatgatggatggatggatggat 155236



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 110636 tgatggatggatggatggat 110617



to top

>gb|AC163393.6| Mus musculus chromosome 15, clone RP24-224P8, complete sequence
          Length = 167152

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 39709 gatgatggatggatggatggat 39688



to top

>gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome 14, complete sequence
          Length = 243730

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 10003 gatgatggatggatggatggat 10024



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 9951 gatgatggatggatggatggat 9972



to top

>gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome 5, complete sequence
          Length = 188588

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 123468 gatgatggatggatggatggat 123447



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 123300 gatgatggatggatggatggat 123279



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 74209 gatgatggatggatggatggat 74230



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 39663 gatgatggatggatggatggat 39642



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 39496 gatgatggatggatggatggat 39475



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 264    gatggatggatggatggatca 284
              |||||||||||||||||||||
Sbjct: 123568 gatggatggatggatggatca 123548



to top

>gb|AC137154.2| Mus musculus BAC clone RP24-572L22 from chromosome 5, complete sequence
          Length = 173460

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 111676 gatgatggatggatggatggat 111655



to top

>gb|AC183833.2| Pan troglodytes BAC clone CH251-141C5 from chromosome 7, complete
             sequence
          Length = 155911

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 59919 gatgatggatggatggatggat 59898



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 59869 gatgatggatggatggatggat 59848



to top

>gb|AC175670.3| Mus musculus BAC clone RP24-304I16 from chromosome y, complete sequence
          Length = 168071

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 13953 gatgatggatggatggatggat 13932



to top

>gb|AC175494.3| Mus musculus BAC clone RP24-75G20 from chromosome y, complete sequence
          Length = 229858

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 45616 gatgatggatggatggatggat 45637



to top

>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence
          Length = 181395

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 168151 gatgatggatggatggatggat 168172



to top

>gb|AC140255.4| Mus musculus BAC clone RP24-291E19 from chromosome Y, complete sequence
          Length = 187268

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 163588 gatgatggatggatggatggat 163567



to top

>gb|AC122481.3| Mus musculus BAC clone RP24-357O20 from chromosome 17, complete sequence
          Length = 126340

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 106308 gatgatggatggatggatggat 106287



to top

>gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, complete sequence
          Length = 148689

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 101666 gatgatggatggatggatggat 101645



to top

>gb|AC073089.5| Homo sapiens BAC clone RP11-324F21 from 7, complete sequence
          Length = 171788

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 146221 gatgatggatggatggatggat 146200



to top

>gb|AC004111.1| Homo sapiens BAC clone CTB-103H13 from 7, complete sequence
          Length = 106172

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 9159 gatgatggatggatggatggat 9138



to top

>gb|AC115741.9| Mus musculus chromosome 14, clone RP23-476L2, complete sequence
          Length = 188141

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 112699 gatgatggatggatggatggat 112678



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 112647 gatgatggatggatggatggat 112626



to top

>gb|AC136743.5| Mus musculus chromosome 9, clone RP23-149D5, complete sequence
          Length = 213343

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 151796 gatgatggatggatggatggat 151775



to top

>gb|AC105470.17| Rattus norvegicus 10 BAC CH230-192N7 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 212491

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 28012 gatgatggatggatggatggat 28033



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 261   gatgatggatggatggatgg 280
             ||||||||||||||||||||
Sbjct: 27153 gatgatggatggatggatgg 27172



to top

>gb|AC140258.4| Mus musculus BAC clone RP24-295F23 from chromosome Y, complete sequence
          Length = 176758

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 61717 gatgatggatggatggatggat 61738



to top

>gb|AC144582.3| Mus musculus BAC clone RP24-323J22 from chromosome Y, complete sequence
          Length = 214364

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 133017 gatgatggatggatggatggat 133038



to top

>gb|AC145564.4| Mus musculus BAC clone RP24-482K19 from chromosome Y, complete sequence
          Length = 188188

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 149991 gatgatggatggatggatggat 150012



to top

>gb|AC140474.3| Mus musculus BAC clone RP24-406O7 from chromosome Y, complete sequence
          Length = 123100

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 22129 gatgatggatggatggatggat 22108



to top

>gb|AC026471.6| Homo sapiens chromosome 16 clone RP11-452L6, complete sequence
          Length = 186860

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 83920 gatgatggatggatggatggat 83899



to top

>gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosome 13, complete
             sequence
          Length = 201051

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 34420 gatgatggatggatggatggat 34441



to top

>gb|AC124012.4| Mus musculus BAC clone RP24-357P22 from chromosome 18, complete
            sequence
          Length = 193064

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 3172 gatgatggatggatggatggat 3193



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 263  tgatggatggatggatggat 282
            ||||||||||||||||||||
Sbjct: 3285 tgatggatggatggatggat 3304



to top

>gb|AC134438.3| Mus musculus BAC clone RP24-470G3 from chromosome 5, complete sequence
          Length = 140395

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 93336 gatgatggatggatggatggat 93357



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 42911 gatgatggatggatggatggat 42932



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 42744 gatgatggatggatggatggat 42765



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 8198 gatgatggatggatggatggat 8177



to top

>gb|DQ483436.1| Gymnogyps californianus clone 139H microsatellite sequence
          Length = 1721

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 264  gatggatggatggatggatcaggagg 289
            |||||||||||||||||| |||||||
Sbjct: 1669 gatggatggatggatggagcaggagg 1694



to top

>gb|AY498860.1| Homo sapiens tumor necrosis factor receptor superfamily, member 8
             (TNFRSF8) gene, complete cds
          Length = 84102

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 24996 gatgatggatggatggatggat 24975



to top

>emb|CR759874.20| Zebrafish DNA sequence from clone CH211-214H24 in linkage group 20,
             complete sequence
          Length = 223471

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 17445 gatgatggatggatggatggat 17424



to top

>emb|BX248397.8| Zebrafish DNA sequence from clone CH211-233H19 in linkage group 18,
             complete sequence
          Length = 160938

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 49724 gatgatggatggatggatggat 49745



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 262  atgatggatggatggatggat 282
            |||||||||||||||||||||
Sbjct: 6008 atgatggatggatggatggat 6028



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 262  atgatggatggatggatggat 282
            |||||||||||||||||||||
Sbjct: 5743 atgatggatggatggatggat 5763



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 262   atgatggatggatggatgga 281
             ||||||||||||||||||||
Sbjct: 50358 atgatggatggatggatgga 50377



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 262   atgatggatggatggatgga 281
             ||||||||||||||||||||
Sbjct: 50070 atgatggatggatggatgga 50089



to top

>emb|CT009638.5| Zebrafish DNA sequence from clone CH73-162A18 in linkage group 6,
            complete sequence
          Length = 101890

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 4616 gatgatggatggatggatggat 4595



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 4573 gatgatggatggatggatggat 4552



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 263  tgatggatggatggatggat 282
            ||||||||||||||||||||
Sbjct: 9686 tgatggatggatggatggat 9705



to top

>emb|AL929319.4| Zebrafish DNA sequence from clone CH211-59F17 in linkage group 10,
              complete sequence
          Length = 194614

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 137490 gatgatggatggatggatggat 137511



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 135735 tgatggatggatggatggat 135754



to top

>emb|CR450685.13| Zebrafish DNA sequence from clone DKEY-83K24 in linkage group 8,
             complete sequence
          Length = 195473

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 66605 gatgatggatggatggatggat 66584



to top

>emb|CR735143.13| Zebrafish DNA sequence from clone CH211-244P16 in linkage group 5,
              complete sequence
          Length = 147626

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 113939 gatgatggatggatggatggat 113960



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 262    atgatggatggatggatggat 282
              |||||||||||||||||||||
Sbjct: 113747 atgatggatggatggatggat 113767



to top

>emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in linkage group 23,
              complete sequence
          Length = 165253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 152518 gatgatggatggatggatggat 152497



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 262    atgatggatggatggatggat 282
              |||||||||||||||||||||
Sbjct: 152259 atgatggatggatggatggat 152239



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 152452 tgatggatggatggatggat 152433



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    gatgatggatggatggatgg 280
              ||||||||||||||||||||
Sbjct: 151960 gatgatggatggatggatgg 151941



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    gatgatggatggatggatgg 280
              ||||||||||||||||||||
Sbjct: 151368 gatgatggatggatggatgg 151349



to top

>emb|BX537295.7| Zebrafish DNA sequence from clone DKEY-21O10 in linkage group 1,
             complete sequence
          Length = 165366

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 23144 gatgatggatggatggatggat 23123



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 22957 gatgatggatggatggatggat 22936



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 22852 gatgatggatggatggatggat 22831



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 22455 gatgatggatggatggatggat 22434



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 22302 gatgatggatggatggatggat 22281



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 262   atgatggatggatggatggat 282
             |||||||||||||||||||||
Sbjct: 87986 atgatggatggatggatggat 87966



to top

>emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 in linkage group 19,
              complete sequence
          Length = 171079

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 160431 gatgatggatggatggatggat 160452



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 160195 tgatggatggatggatggat 160214



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 160155 tgatggatggatggatggat 160174



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 159884 tgatggatggatggatggat 159903



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 159741 tgatggatggatggatggat 159760



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 159689 tgatggatggatggatggat 159708



to top

>emb|AL954201.1| Pan troglodytes chromosome 22 clone PTB-118B22 map q21.1, complete
              sequence
          Length = 181254

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 173663 gatgatggatggatggatggat 173684



to top

>emb|AL954202.1| Pan troglodytes chromosome 22 clone PTB-083P20 map q21.1, complete
             sequence
          Length = 197872

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 16629 gatgatggatggatggatggat 16650



to top

>emb|CR376860.38| Zebrafish DNA sequence from clone DKEY-111H22 in linkage group 8,
              complete sequence
          Length = 195545

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 103772 gatgatggatggatggatggat 103793



to top

>emb|BX908756.12| Zebrafish DNA sequence from clone CH211-190D13 in linkage group 1,
             complete sequence
          Length = 134952

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 79881 gatgatggatggatggatggat 79860



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 79664 gatgatggatggatggatggat 79643



to top

>emb|CR388060.19| Zebrafish DNA sequence from clone DKEY-208J8 in linkage group 16,
              complete sequence
          Length = 213586

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 117441 gatgatggatggatggatggat 117462



to top

>emb|CR933522.11| Zebrafish DNA sequence from clone CH211-22N13 in linkage group 1,
            complete sequence
          Length = 121726

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 1759 gatgatggatggatggatggat 1738



to top

>emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in linkage group 23,
             complete sequence
          Length = 201764

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 92510 gatgatggatggatggatggat 92531



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 262   atgatggatggatggatggat 282
             |||||||||||||||||||||
Sbjct: 92797 atgatggatggatggatggat 92817



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 261   gatgatggatggatggatgg 280
             ||||||||||||||||||||
Sbjct: 93720 gatgatggatggatggatgg 93739



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 261   gatgatggatggatggatgg 280
             ||||||||||||||||||||
Sbjct: 93124 gatgatggatggatggatgg 93143



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 92632 tgatggatggatggatggat 92651



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 92560 tgatggatggatggatggat 92579



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 69980 tgatggatggatggatggat 69961



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 263  tgatggatggatggatggat 282
            ||||||||||||||||||||
Sbjct: 4137 tgatggatggatggatggat 4156



to top

>gb|AC110524.11| Mus musculus chromosome 9, clone RP23-403L22, complete sequence
          Length = 225122

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 128013 gatgatggatggatggatggat 128034



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 127817 gatgatggatggatggatggat 127838



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 90957 tgatggatggatggatggat 90976



to top

>emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in linkage group 3,
             complete sequence
          Length = 226081

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 19657 gatgatggatggatggatggat 19678



to top

>gb|AC123828.4| Mus musculus BAC clone RP24-111G17 from chromosome 7, complete sequence
          Length = 151989

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 70182 gatgatggatggatggatggat 70203



to top

>gb|AC123049.4| Mus musculus BAC clone RP24-360B3 from chromosome 5, complete
           sequence
          Length = 166292

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 261 gatgatggatggatggatggat 282
           ||||||||||||||||||||||
Sbjct: 826 gatgatggatggatggatggat 805



to top

>gb|AC125153.3| Mus musculus BAC clone RP24-378F2 from chromosome 6, complete sequence
          Length = 195328

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 190100 gatgatggatggatggatggat 190079



to top

>gb|AC130548.3| Mus musculus BAC clone RP24-456F12 from chromosome 5, complete sequence
          Length = 170929

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 78393 gatgatggatggatggatggat 78372



to top

>gb|AC127553.3| Mus musculus BAC clone RP24-553F11 from chromosome 5, complete sequence
          Length = 159693

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 55664 gatgatggatggatggatggat 55643



to top

>gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, complete sequence
          Length = 208417

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 152727 gatgatggatggatggatggat 152706



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 261   gatgatggatggatggatgg 280
             ||||||||||||||||||||
Sbjct: 35457 gatgatggatggatggatgg 35476



to top

>gb|AC114819.4| Mus musculus BAC clone RP23-52J20 from chromosome 8, complete sequence
          Length = 204239

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 35486 gatgatggatggatggatggat 35507



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 35417 gatgatggatggatggatggat 35438



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 35289 gatgatggatggatggatggat 35310



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 262   atgatggatggatggatggat 282
             |||||||||||||||||||||
Sbjct: 57751 atgatggatggatggatggat 57771



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 262   atgatggatggatggatgga 281
             ||||||||||||||||||||
Sbjct: 57731 atgatggatggatggatgga 57750



to top

>gb|AC132470.3| Mus musculus BAC clone RP23-96F5 from chromosome 14, complete sequence
          Length = 206002

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 97026 gatgatggatggatggatggat 97047



to top

>gb|AC122251.4| Mus musculus BAC clone RP23-167J15 from chromosome 14, complete sequence
          Length = 204588

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 179835 gatgatggatggatggatggat 179856



to top

>emb|CR385066.13| Zebrafish DNA sequence from clone DKEY-220L23 in linkage group 3,
             complete sequence
          Length = 238822

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 264   gatggatggatggatggatcag 285
             ||||||||||||||||||||||
Sbjct: 39803 gatggatggatggatggatcag 39824



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 263 tgatggatggatggatggat 282
           ||||||||||||||||||||
Sbjct: 578 tgatggatggatggatggat 597



to top

>gb|AC122827.3| Mus musculus BAC clone RP23-211N23 from chromosome 18, complete
             sequence
          Length = 194843

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 40296 gatgatggatggatggatggat 40275



to top

>gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome 7, complete sequence
          Length = 205725

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 44706 gatgatggatggatggatggat 44685



to top

>gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosome 8, complete sequence
          Length = 199412

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 42574 gatgatggatggatggatggat 42553



to top

>gb|AC129182.4| Mus musculus BAC clone RP23-340P24 from chromosome 19, complete sequence
          Length = 187601

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 103051 gatgatggatggatggatggat 103072



to top

>gb|AC126262.4| Mus musculus BAC clone RP23-359F12 from chromosome 12, complete sequence
          Length = 208710

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 185657 gatgatggatggatggatggat 185636



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 185476 gatgatggatggatggatggat 185455



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 185457 gatgatggatggatggatggat 185436



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 189058 tgatggatggatggatggat 189039



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 185723 tgatggatggatggatggat 185704



to top

>gb|AC132474.3| Mus musculus BAC clone RP23-114G13 from chromosome 9, complete sequence
          Length = 220976

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 146716 gatgatggatggatggatggat 146695



to top

>gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosome 7, complete sequence
          Length = 176054

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 156240 gatgatggatggatggatggat 156219



to top

>gb|AC133100.5| Mus musculus BAC clone RP23-98O11 from chromosome 19, complete sequence
          Length = 204855

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 131327 gatgatggatggatggatggat 131306



to top

>emb|BX936408.10| Zebrafish DNA sequence from clone CH211-195A15 in linkage group 17,
              complete sequence
          Length = 198387

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 179902 gatgatggatggatggatggat 179881



to top

>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16,
              complete sequence
          Length = 179375

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 175591 gatgatggatggatggatggat 175612



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 264    gatggatggatggatggatca 284
              |||||||||||||||||||||
Sbjct: 134000 gatggatggatggatggatca 133980



to top

>emb|CR387978.12| Zebrafish DNA sequence from clone DKEY-33M5 in linkage group 1,
           complete sequence
          Length = 208746

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 261 gatgatggatggatggatggat 282
           ||||||||||||||||||||||
Sbjct: 242 gatgatggatggatggatggat 263



to top

>gb|AF335246.1| Homo sapiens cone rod homeobox protein (CRX) gene, promoter region
           and exon 1A
          Length = 2080

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 261 gatgatggatggatggatggat 282
           ||||||||||||||||||||||
Sbjct: 234 gatgatggatggatggatggat 213



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 261 gatgatggatggatggatggat 282
           ||||||||||||||||||||||
Sbjct: 207 gatgatggatggatggatggat 186



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 263 tgatggatggatggatggat 282
           ||||||||||||||||||||
Sbjct: 143 tgatggatggatggatggat 124



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 263 tgatggatggatggatggat 282
           ||||||||||||||||||||
Sbjct: 73  tgatggatggatggatggat 54



to top

>gb|AC026748.7| Homo sapiens chromosome 5 clone RP11-325I22, complete sequence
          Length = 191795

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 90614 gatgatggatggatggatggat 90635



to top

>gb|AC121934.4| Mus musculus BAC clone RP24-207A18 from chromosome 5, complete sequence
          Length = 152037

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 100105 gatgatggatggatggatggat 100126



to top

>gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, complete sequence
          Length = 179509

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 99238 gatgatggatggatggatggat 99259



to top

>gb|AC131762.2| Mus musculus BAC clone RP24-228J18 from chromosome 12, complete sequence
          Length = 157435

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129892 gatgatggatggatggatggat 129871



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129865 gatgatggatggatggatggat 129844



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129839 gatgatggatggatggatggat 129818



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129801 gatgatggatggatggatggat 129780



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129774 gatgatggatggatggatggat 129753



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129681 gatgatggatggatggatggat 129660



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 129658 gatgatggatggatggatggat 129637



to top

>gb|AC126022.4| Mus musculus BAC clone RP24-405F4 from chromosome 16, complete sequence
          Length = 173331

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 32612 gatgatggatggatggatggat 32633



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 32482 gatgatggatggatggatggat 32503



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 32451 gatgatggatggatggatggat 32472



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 32412 gatgatggatggatggatggat 32433



to top

>gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosome 16, complete sequence
          Length = 159535

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 145531 gatgatggatggatggatggat 145552



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 145401 gatgatggatggatggatggat 145422



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 145370 gatgatggatggatggatggat 145391



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 145331 gatgatggatggatggatggat 145352



to top

>gb|AC128663.4| Mus musculus BAC clone RP24-263E2 from chromosome 8, complete sequence
          Length = 197679

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 92433 gatgatggatggatggatggat 92412



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 92379 gatgatggatggatggatggat 92358



to top

>gb|AC126251.4| Mus musculus BAC clone RP23-457L16 from chromosome 14, complete sequence
          Length = 181355

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 105820 gatgatggatggatggatggat 105799



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 105793 gatgatggatggatggatggat 105772



to top

>emb|CR450741.5| Zebrafish DNA sequence from clone CH211-269F16 in linkage group 24,
              complete sequence
          Length = 157603

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 123218 gatgatggatggatggatggat 123197



to top

>gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosome 12, complete sequence
          Length = 196396

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 264    gatggatggatggatggatcag 285
              ||||||||||||||||||||||
Sbjct: 116960 gatggatggatggatggatcag 116981



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 264    gatggatggatggatggatcag 285
              ||||||||||||||||||||||
Sbjct: 116900 gatggatggatggatggatcag 116921



to top

>emb|CR545462.25| Zebrafish DNA sequence from clone DKEYP-88F5 in linkage group 20,
              complete sequence
          Length = 199482

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 198081 gatgatggatggatggatggat 198102



to top

>gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, complete sequence
          Length = 221903

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 179480 gatgatggatggatggatggat 179501



to top

>gb|AC121797.3| Mus musculus BAC clone RP23-424C23 from chromosome 3, complete sequence
          Length = 177109

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 121092 gatgatggatggatggatggat 121113



to top

>gb|AC126055.4| Mus musculus BAC clone RP23-368O6 from chromosome 16, complete sequence
          Length = 197096

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 124301 gatgatggatggatggatggat 124280



to top

>gb|AC091300.3| Danio rerio clone 127K3, complete sequence
          Length = 64915

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 56180 gatgatggatggatggatggat 56159



to top

>gb|AC091001.3| Papio anubis clone RP41-36M16, complete sequence
          Length = 177066

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 164938 gatgatggatggatggatggat 164917



to top

>gb|AC122225.4| Mus musculus BAC clone RP23-131E21 from 9, complete sequence
          Length = 209737

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 148203 gatgatggatggatggatggat 148182



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 148276 tgatggatggatggatggat 148257



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 148224 tgatggatggatggatggat 148205



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 148149 tgatggatggatggatggat 148130



to top

>gb|AC083858.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-423A22, complete
             sequence
          Length = 74718

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 29303 gatgatggatggatggatggat 29282



to top

>gb|AC122248.5| Mus musculus BAC clone RP23-156N18 from 7, complete sequence
          Length = 198901

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 18575 gatgatggatggatggatggat 18554



to top

>emb|CR847928.12| Zebrafish DNA sequence from clone DKEYP-67E7 in linkage group 1,
             complete sequence
          Length = 160252

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 63294 gatgatggatggatggatggat 63273



to top

>gb|AC122287.4| Mus musculus BAC clone RP23-253A15 from 1, complete sequence
          Length = 226926

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 1109 gatgatggatggatggatggat 1088



to top

>gb|AC098733.2| Mus musculus BAC clone RP23-103C10 from 19, complete sequence
          Length = 214382

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 160030 gatgatggatggatggatggat 160009



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 160007 gatgatggatggatggatggat 159986



to top

>gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, complete sequence
          Length = 175889

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 147519 gatgatggatggatggatggat 147540



to top

>gb|AC121986.2| Mus musculus BAC clone RP24-293I7 from 10, complete sequence
          Length = 182686

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 111400 gatgatggatggatggatggat 111421



to top

>gb|AC122048.2| Mus musculus BAC clone RP24-456G2 from 2, complete sequence
          Length = 153772

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 58930 gatgatggatggatggatggat 58909



to top

>gb|AC146157.3| Pan troglodytes BAC clone RP43-2A11 from 7, complete sequence
          Length = 148463

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 132602 gatgatggatggatggatggat 132623



to top

>gb|AC010268.10| Homo sapiens clone CTC-484E17, complete sequence
          Length = 165776

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 164731 gatgatggatggatggatggat 164752



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 164523 gatgatggatggatggatggat 164544



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 164415 gatgatggatggatggatggat 164436



to top

>emb|CR704914.2|CNS0G6V2 Tetraodon nigroviridis full-length cDNA
          Length = 726

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 261 gatgatggatggatggatggat 282
           ||||||||||||||||||||||
Sbjct: 609 gatgatggatggatggatggat 630



to top

>gb|AC117596.6| Mus musculus chromosome 6, clone RP23-392K24, complete sequence
          Length = 233811

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 52537 gatgatggatggatggatggat 52558



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 52394 gatgatggatggatggatggat 52415



to top

>gb|AC092536.3| Homo sapiens BAC clone RP11-32N3 from 7, complete sequence
          Length = 132755

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 132584 gatgatggatggatggatggat 132605



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 132354 gatgatggatggatggatggat 132375



to top

>gb|AC092021.4| Homo sapiens BAC clone RP11-420H12 from 7, complete sequence
          Length = 37083

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 30727 gatgatggatggatggatggat 30748



to top

>gb|AC091738.4| Homo sapiens BAC clone RP11-535E8 from 7, complete sequence
          Length = 131928

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 1829 gatgatggatggatggatggat 1850



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 1599 gatgatggatggatggatggat 1620



to top

>gb|AC004015.1| Homo sapiens BAC clone CTA-333F24 from 7, complete sequence
          Length = 144239

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 115607 gatgatggatggatggatggat 115586



to top

>gb|AC101723.9| Mus musculus chromosome 17, clone RP23-316J7, complete sequence
          Length = 181452

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 83009 gatgatggatggatggatggat 83030



to top

>gb|AC111140.11| Mus musculus chromosome 3, clone RP23-369L16, complete sequence
          Length = 236182

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 92377 gatgatggatggatggatggat 92398



to top

>gb|AC007030.3| Homo sapiens PAC clone RP5-1112I4 from 7, complete sequence
          Length = 117853

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 90279 gatgatggatggatggatggat 90258



to top

>gb|AC113301.7| Mus musculus chromosome 8, clone RP23-430G7, complete sequence
          Length = 195985

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 66070 gatgatggatggatggatggat 66049



to top

>gb|AC102441.6| Mus musculus chromosome 18, clone RP24-160I12, complete sequence
          Length = 224556

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 61573 gatgatggatggatggatggat 61552



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 61550 gatgatggatggatggatggat 61529



to top

>gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, complete sequence
          Length = 188853

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 60009 gatgatggatggatggatggat 60030



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 59990 gatgatggatggatggatggat 60011



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 59948 gatgatggatggatggatggat 59969



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 59918 gatgatggatggatggatggat 59939



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 59899 gatgatggatggatggatggat 59920



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 59864 gatgatggatggatggatggat 59885



to top

>gb|AC166260.7| Mus musculus 10 BAC RP23-330F17 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 175641

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 54421 gatgatggatggatggatggat 54400



to top

>gb|AC160757.3| Mus musculus chromosome 3, clone RP23-200C3, complete sequence
          Length = 228862

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 217368 gatgatggatggatggatggat 217347



to top

>gb|AC124230.6| Mus musculus chromosome 1, clone RP23-474K11, complete sequence
          Length = 202996

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 98436 gatgatggatggatggatggat 98415



to top

>emb|CR936500.10| Zebrafish DNA sequence from clone DKEY-274N8 in linkage group 3,
             complete sequence
          Length = 86479

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 56703 gatgatggatggatggatggat 56724



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 56365 tgatggatggatggatggat 56384



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 54889 tgatggatggatggatggat 54908



to top

>emb|BX927062.11| Zebrafish DNA sequence from clone CH211-227N20 in linkage group 13,
              complete sequence
          Length = 154186

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 140232 gatgatggatggatggatggat 140211



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 132077 gatgatggatggatggatggat 132098



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 262    atgatggatggatggatggat 282
              |||||||||||||||||||||
Sbjct: 139657 atgatggatggatggatggat 139637



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 131985 tgatggatggatggatggat 132004



to top

>gb|AC139045.7| Mus musculus chromosome 7, clone RP23-466H15, complete sequence
          Length = 186309

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 158855 gatgatggatggatggatggat 158834



to top

>emb|BX293991.12| Zebrafish DNA sequence from clone CH211-261I24 in linkage group 11,
              complete sequence
          Length = 198825

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 133914 gatgatggatggatggatggat 133935



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 262   atgatggatggatggatggat 282
             |||||||||||||||||||||
Sbjct: 62307 atgatggatggatggatggat 62287



to top

>gb|AC118728.12| Mus musculus chromosome 1, clone RP24-168F13, complete sequence
          Length = 176970

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 52967 gatgatggatggatggatggat 52988



to top

>emb|BX927365.7| Zebrafish DNA sequence from clone DKEY-161P7 in linkage group 23,
             complete sequence
          Length = 229608

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 38307 gatgatggatggatggatggat 38286



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 38416 tgatggatggatggatggat 38397



to top

>gb|AC093304.4| Homo sapiens chromosome 5 clone RP11-69K7, complete sequence
          Length = 161421

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 4940 gatgatggatggatggatggat 4919



to top

>gb|AC160125.2| Mus musculus BAC clone RP23-317M11 from chromosome 9, complete sequence
          Length = 209835

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 61905 gatgatggatggatggatggat 61884



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 61878 gatgatggatggatggatggat 61857



to top

>gb|AC108436.5| Mus musculus chromosome 8, clone RP23-230G11, complete sequence
          Length = 185534

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 103756 gatgatggatggatggatggat 103777



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 103504 tgatggatggatggatggat 103523



to top

>emb|BX510331.13| Zebrafish DNA sequence from clone CH211-42B22 in linkage group 17,
             complete sequence
          Length = 150762

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 34180 gatgatggatggatggatggat 34159



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 262   atgatggatggatggatggat 282
             |||||||||||||||||||||
Sbjct: 34067 atgatggatggatggatggat 34047



to top

>emb|BX908755.10| Zebrafish DNA sequence from clone DKEY-67F11 in linkage group 3,
             complete sequence
          Length = 160005

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 91108 gatgatggatggatggatggat 91087



to top

>gb|AC163400.3| Mus musculus chromosome 15, clone RP24-97G4, complete sequence
          Length = 168328

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 46615 gatgatggatggatggatggat 46594



to top

>gb|AC112342.14| Rattus norvegicus 14 BAC CH230-253H12 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 150292

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 94596 gatgatggatggatggatggat 94617



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 94489 gatgatggatggatggatggat 94510



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 94470 gatgatggatggatggatggat 94491



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 87584 gatgatggatggatggatggat 87605



to top

>gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 227741

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 96679 gatgatggatggatggatggat 96658



to top

>emb|CR392025.7| Zebrafish DNA sequence from clone CH211-248P17 in linkage group 17,
              complete sequence
          Length = 158863

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 154972 gatgatggatggatggatggat 154993



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 151920 tgatggatggatggatggat 151939



to top

>emb|CR405713.7| Zebrafish DNA sequence from clone DKEY-12D5 in linkage group 8,
             complete sequence
          Length = 99181

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 20661 gatgatggatggatggatggat 20682



to top

>emb|CR847503.8| Zebrafish DNA sequence from clone DKEY-20D21 in linkage group 8, complete
              sequence
          Length = 217514

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 204400 gatgatggatggatggatggat 204379



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 188792 tgatggatggatggatggat 188773



to top

>emb|AL953854.21| Human DNA sequence from clone RP11-211P14 on chromosome 9 Contains a
            pseudogene similar to part of a vomeronasal 2 family
            protein and a novel protein similar to contactin
            associated protein-like 3 (CNTNAP3), complete sequence
          Length = 157546

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 3580 gatgatggatggatggatggat 3601



to top

>emb|Z82189.1|HS170A21 Human DNA sequence from clone RP1-170A21 on chromosome 22, complete
              sequence
          Length = 176947

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 176874 gatgatggatggatggatggat 176895



to top

>emb|Z94162.1|HSN21F1 Human DNA sequence from clone LL22NC03-21F1 on chromosome 22, complete
             sequence
          Length = 39212

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 35416 gatgatggatggatggatggat 35395



to top

>emb|Z82202.1|HS34P24 Human DNA sequence from clone RP1-34P24 on chromosome 22, complete
             sequence
          Length = 105357

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 92119 gatgatggatggatggatggat 92098



to top

>emb|CR381602.30| Zebrafish DNA sequence from clone DKEY-183M22 in linkage group 6,
              complete sequence
          Length = 192136

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 107371 gatgatggatggatggatggat 107350



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 106988 gatgatggatggatggatggat 106967



to top

>emb|CR769775.11| Human DNA sequence from clone RP11-449H15 on chromosome 9 Contains a
             novel gene, complete sequence
          Length = 169430

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 25722 gatgatggatggatggatggat 25743



to top

>emb|AL935212.11| Human DNA sequence from clone RP11-160N1 on chromosome 9 Contains eight
             novel pseudogenes, two novel genes and three CpG islands,
             complete sequence
          Length = 181647

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 37850 gatgatggatggatggatggat 37829



to top

>emb|AL732479.6| Human DNA sequence from clone RP11-351D13 on chromosome 10, complete
             sequence
          Length = 97781

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 39787 gatgatggatggatggatggat 39808



to top

>emb|AL607044.24| Human DNA sequence from clone RP13-392N17 on chromosome 10, complete
             sequence
          Length = 125086

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 25641 gatgatggatggatggatggat 25662



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 25241 tgatggatggatggatggat 25260



to top

>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the 3'
              end of the IL3RA gene for interleukin 3 receptor, alpha
              (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra,
              MGC34174), the SLC25A6 gene for solute carrier family 25
              (mitochondrial carrier; adenine nucleotide translocator),
              member 6 (ANT3, ANT3Y, MGC17525), the ASMTL gene for
              acetylserotonin O-methyltransferase-like (ASMTLX), a novel
              gene (LOC286530), a novel gene (FLJ13330) and six CpG
              islands, complete sequence
          Length = 162377

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 130926 gatgatggatggatggatggat 130905



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 16736 gatgatggatggatggatggat 16757



to top

>emb|AL591890.31| Human DNA sequence from clone RP11-54A22 on chromosome 9 Contains three
              novel genes, and the 5' end of the COL5A1 gene for collagen
              (type V) alpha 1, and a CpG island, complete sequence
          Length = 173415

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 127526 gatgatggatggatggatggat 127505



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 125674 gatgatggatggatggatggat 125653



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 125205 gatgatggatggatggatggat 125184



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 264    gatggatggatggatggatca 284
              |||||||||||||||||||||
Sbjct: 125094 gatggatggatggatggatca 125074



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tgatggatggatggatggat 282
              ||||||||||||||||||||
Sbjct: 125573 tgatggatggatggatggat 125554



to top

>emb|AL592309.24| Human DNA sequence from clone RP11-293F5 on chromosome 1 Contains a novel
              gene, a novel pseudogene, a novel gene similar to heparan
              sulfate 6-O-sulfotransferase 1 (HS6ST1), a pseudogene
              similar to part of a novel gene, the gene for a
              hypothetical protein AE2, a profilin 1 (PFN1) pseudogene,
              the 5' end of the ALPL gene for alkaline phosphatase,
              liver/bone/kidney and a CpG island, complete sequence
          Length = 206231

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 166526 gatgatggatggatggatggat 166547



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 264    gatggatggatggatggatc 283
              ||||||||||||||||||||
Sbjct: 195078 gatggatggatggatggatc 195097



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 261    gatgatggatggatggatgg 280
              ||||||||||||||||||||
Sbjct: 166561 gatgatggatggatggatgg 166580



to top

>emb|AL591386.19| Human DNA sequence from clone RP11-349K21 on chromosome 9, complete
             sequence
          Length = 69657

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 44377 gatgatggatggatggatggat 44356



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   gatgatggatggatggatgg 280
             ||||||||||||||||||||
Sbjct: 44629 gatgatggatggatggatgg 44610



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 44416 tgatggatggatggatggat 44397



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 44233 tgatggatggatggatggat 44214



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tgatggatggatggatggat 282
             ||||||||||||||||||||
Sbjct: 44077 tgatggatggatggatggat 44058



to top

>emb|AL596223.3| Human DNA sequence from clone RP11-227H15 on chromosome 10 Contains 3'
              end of the VPS26 gene for vacuolar protein sorting 26
              (yeast) (HB58, Hbeta58, FLJ12930), the SUPV3L1 gene for
              suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3), the
              gene for a novel hexokinase domain containing protein
              (FLJ37767), the 5' end of the HK1 gene for hexokinase 1
              (HKI, HXK1), two novel genes, a ribosomal protein S15a
              (RPS15A) pseudogene and two CpG islands, complete sequence
          Length = 180548

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 264    gatggatggatggatggatcag 285
              ||||||||||||||||||||||
Sbjct: 175268 gatggatggatggatggatcag 175247



to top

>emb|AL590235.23| Human DNA sequence from clone RP11-529E10 on chromosome 4, complete
             sequence
          Length = 159246

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 29557 gatgatggatggatggatggat 29536



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 29425 gatgatggatggatggatggat 29404



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 29293 gatgatggatggatggatggat 29272



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 29157 gatgatggatggatggatggat 29136



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 29021 gatgatggatggatggatggat 29000



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 261   gatgatggatggatggatggat 282
             ||||||||||||||||||||||
Sbjct: 28982 gatgatggatggatggatggat 28961



to top

>emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chromosome 1 Contains part of
              the PLXNA2 gene for plexin A2, complete sequence
          Length = 164057

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 158173 gatgatggatggatggatggat 158194



to top

>emb|AL590416.4| Human DNA sequence from clone RP11-89C21 on chromosome 10p13-14 Contains
              the 3' end of the gene for a protein related to the N
              terminus of tre (RNTRE) (KIAA0019), gene FLJ34168, a novel
              gene and a CpG island, complete sequence
          Length = 171026

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 167541 gatgatggatggatggatggat 167562



to top

>emb|AL512444.20| Human DNA sequence from clone RP11-69E9 on chromosome 1 Contains part
            of the EPHB2 gene for EphB2 and a novel gene, complete
            sequence
          Length = 126589

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 261  gatgatggatggatggatggat 282
            ||||||||||||||||||||||
Sbjct: 3428 gatgatggatggatggatggat 3449



to top

>gb|AC107742.10| Mus musculus chromosome 15, clone RP23-331D7, complete sequence
          Length = 223952

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 261    gatgatggatggatggatggat 282
              ||||||||||||||||||||||
Sbjct: 217692 gatgatggatggatggatggat 217671


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,168,921
Number of Sequences: 3902068
Number of extensions: 4168921
Number of successful extensions: 399672
Number of sequences better than 10.0: 2772
Number of HSP's better than 10.0 without gapping: 2797
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 277667
Number of HSP's gapped (non-prelim): 106113
length of query: 594
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 571
effective length of database: 17,143,297,704
effective search space: 9788822988984
effective search space used: 9788822988984
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top