ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags25o17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC154589.3| Mus musculus BAC clone RP23-367D5 from chromosome... 46 0.12
2gb|AC159006.2| Mus musculus BAC clone RP23-36P21 from chromosome... 46 0.12
3ref|XM_638879.1| Dictyostelium discoideum hypothetical protein (... 42 1.9
4emb|AL357510.17| Human DNA sequence from clone RP11-195F21 on ch... 42 1.9
5gb|AF233734.1|AF233734 Helicoverpa zea HzC4 chymotrypsinogen gen... 42 1.9
6gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041... 42 1.9
7gb|AC002378.1|AC002378 Human PAC clone RP3-438O4 from 22q12.1-qt... 42 1.9
8gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's H... 40 7.3
9gb|AC182587.5| Pan troglodytes BAC clone CH251-207G3 from chromo... 40 7.3
10gb|AC146229.2| Pan troglodytes BAC clone RP43-33B3 from 7, compl... 40 7.3
11gb|AC073141.4| Homo sapiens BAC clone RP11-733D19 from 7, comple... 40 7.3
12emb|CR354398.17| Zebrafish DNA sequence from clone CH211-142C14 ... 40 7.3
13gb|AC132594.3| Mus musculus BAC clone RP24-222P6 from chromosome... 40 7.3
14gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosom... 40 7.3
15emb|AL355343.18| Human DNA sequence from clone RP11-455I14 on ch... 40 7.3
16emb|AL137058.8| Human DNA sequence from clone RP11-78J21 on chro... 40 7.3
17emb|AL645751.12| Mouse DNA sequence from clone RP23-396K15 on ch... 40 7.3
18emb|AL590380.9| Mouse DNA sequence from clone RP23-146D23 on chr... 40 7.3
19gb|AC151908.8| Mus musculus BAC clone RP23-109A22 from chromosom... 40 7.3
20gb|AC148188.3| Saimiri boliviensis boliviensis clone CH254-64N20... 40 7.3
21gb|AC092501.2| Homo sapiens chromosome 3 clone RP11-139C14, comp... 40 7.3
22dbj|AB044334.2| Mus musculus CAST gene for calpastatin type I, I... 40 7.3
23gb|AF180942.1|ATRPP5LE2 Arabidopsis thaliana RPP5 disease resist... 40 7.3
24gb|AC016720.9| Homo sapiens BAC clone RP11-326G23 from 2, comple... 40 7.3
25gb|AC019106.3| Homo sapiens BAC clone RP11-479L11 from 2, comple... 40 7.3
26gb|AC021068.17|AC021068 Homo sapiens 3 BAC RP11-48O22 (Roswell P... 40 7.3
27dbj|BS000001.1| Pan troglodytes chromosome 22 clone:PTB-520F08, ... 40 7.3
28gb|AC154780.2| Mus musculus BAC clone RP24-462E4 from 13, comple... 40 7.3
29gb|AC122236.5| Mus musculus BAC clone RP23-141I22 from 8, comple... 40 7.3
30emb|AL163203.2|HS21C003 Homo sapiens chromosome 21 segment HS21C003 40 7.3
31dbj|AP005058.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 7.3
32gb|U23519.2| Caenorhabditis elegans cosmid F26G1, complete sequence 40 7.3
33dbj|AP001465.1| Homo sapiens genomic DNA, chromosome 21q11.1, cl... 40 7.3

>gb|AC154589.3| Mus musculus BAC clone RP23-367D5 from chromosome 14, complete sequence
          Length = 205889

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 244   ctgtgcagtgtagtggtcaaaagaagcatacaaaa 278
             ||||| ||||| ||||||||||||||||| |||||
Sbjct: 18871 ctgtggagtgttgtggtcaaaagaagcattcaaaa 18905



to top

>gb|AC159006.2| Mus musculus BAC clone RP23-36P21 from chromosome 14, complete sequence
          Length = 245591

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 244    ctgtgcagtgtagtggtcaaaagaagcatacaaaa 278
              ||||| ||||| ||||||||||||||||| |||||
Sbjct: 117942 ctgtggagtgttgtggtcaaaagaagcattcaaaa 117976



to top

>ref|XM_638879.1| Dictyostelium discoideum hypothetical protein (DDB0167846), partial
           mRNA
          Length = 585

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 428 tctacacattacatatttcaaatat 452
           ||||||||||| |||||||||||||
Sbjct: 455 tctacacattagatatttcaaatat 479



to top

>emb|AL357510.17| Human DNA sequence from clone RP11-195F21 on chromosome 10 Contains the
             5' end of a novel gene, complete sequence
          Length = 121493

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 191   tttcaaaaagaaaaattggat 211
             |||||||||||||||||||||
Sbjct: 72131 tttcaaaaagaaaaattggat 72111



to top

>gb|AF233734.1|AF233734 Helicoverpa zea HzC4 chymotrypsinogen gene, complete cds
          Length = 1271

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 433 acattacatatttcaaatatc 453
           |||||||||||||||||||||
Sbjct: 616 acattacatatttcaaatatc 596



to top

>gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041-2567370 strain AX4,
             complete sequence
          Length = 333321

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 428   tctacacattacatatttcaaatat 452
             ||||||||||| |||||||||||||
Sbjct: 98399 tctacacattagatatttcaaatat 98423



to top

>gb|AC002378.1|AC002378 Human PAC clone RP3-438O4 from 22q12.1-qter, complete sequence
          Length = 77516

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   tcctgtgcagtgtagtggtca 262
             |||||||||||||||||||||
Sbjct: 48123 tcctgtgcagtgtagtggtca 48103



to top

>gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 59971

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   gcacaatttcaaaaagaaaa 204
             ||||||||||||||||||||
Sbjct: 34207 gcacaatttcaaaaagaaaa 34188



to top

>gb|AC182587.5| Pan troglodytes BAC clone CH251-207G3 from chromosome 18, complete
             sequence
          Length = 195115

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 474   aaggcaattcagagcagagtacag 497
             ||||||||||| ||||||||||||
Sbjct: 97898 aaggcaattcaaagcagagtacag 97921



to top

>gb|AC146229.2| Pan troglodytes BAC clone RP43-33B3 from 7, complete sequence
          Length = 186222

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   catatttcaaatatctggaa 458
             ||||||||||||||||||||
Sbjct: 50664 catatttcaaatatctggaa 50683



to top

>gb|AC073141.4| Homo sapiens BAC clone RP11-733D19 from 7, complete sequence
          Length = 151073

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   catatttcaaatatctggaa 458
             ||||||||||||||||||||
Sbjct: 49907 catatttcaaatatctggaa 49926



to top

>emb|CR354398.17| Zebrafish DNA sequence from clone CH211-142C14 in linkage group 7,
              complete sequence
          Length = 180088

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 436    ttacatatttcaaatatctggaat 459
              ||||||||||||||||| ||||||
Sbjct: 100563 ttacatatttcaaatatttggaat 100540



to top

>gb|AC132594.3| Mus musculus BAC clone RP24-222P6 from chromosome 7, complete sequence
          Length = 162814

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 248    gcagtgtagtggtcaaaagaagca 271
              |||||||||||||| |||||||||
Sbjct: 108972 gcagtgtagtggtctaaagaagca 108949



to top

>gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosome 7, complete sequence
          Length = 161973

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 248   gcagtgtagtggtcaaaagaagca 271
             |||||||||||||| |||||||||
Sbjct: 44966 gcagtgtagtggtctaaagaagca 44943



to top

>emb|AL355343.18| Human DNA sequence from clone RP11-455I14 on chromosome 6 Contains the
             5' end of the TIAM2 gene for T-cell lymphoma invasion and
             metastasis 2 (SIF and Tiam 1-like exchange factor (STEF)),
             complete sequence
          Length = 179262

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 107   caagttcattctgatacaac 126
             ||||||||||||||||||||
Sbjct: 90100 caagttcattctgatacaac 90119



to top

>emb|AL137058.8| Human DNA sequence from clone RP11-78J21 on chromosome 13q32.2-33.3
             Contains 2 novel genes, a pseudogene similar to part of
             TPTE and PTEN homologous inositol lipid phosphatase
             (TPIP), a pseudogene similar to part of mitochondrial
             ribosomal protein S31 (MRPS31), the gene for a novel
             protein similar to heterogeneous nuclear ribonucleoprotein
             A1 (HNRPA1) and 3 CpG islands, complete sequence
          Length = 163390

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 263   aaagaagcatacaaaaaagagctc 286
             |||||||||||||||||| |||||
Sbjct: 39018 aaagaagcatacaaaaaaaagctc 38995



to top

>emb|AL645751.12| Mouse DNA sequence from clone RP23-396K15 on chromosome 11 Contains the
              5' end of the Gabrg2 gene for gamma-aminobutyric acid
              (GABA-A) receptor, subunit gamma 2, the 3' end of the
              Gabra1 gene for gamma-aminobutyric acid (GABA-A) receptor,
              subunit alpha 1 and the 3' end of a novel gene, complete
              sequence
          Length = 186884

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 500    aatgtctaaataaagcatat 519
              ||||||||||||||||||||
Sbjct: 103726 aatgtctaaataaagcatat 103707



to top

>emb|AL590380.9| Mouse DNA sequence from clone RP23-146D23 on chromosome 2, complete
             sequence
          Length = 197008

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   atttcaaaaagaaaaattgg 209
             ||||||||||||||||||||
Sbjct: 65096 atttcaaaaagaaaaattgg 65115



to top

>gb|AC151908.8| Mus musculus BAC clone RP23-109A22 from chromosome 8, complete sequence
          Length = 233606

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 186    cacaatttcaaaaagaaaaa 205
              ||||||||||||||||||||
Sbjct: 125993 cacaatttcaaaaagaaaaa 125974



to top

>gb|AC148188.3| Saimiri boliviensis boliviensis clone CH254-64N20, complete sequence
          Length = 194092

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   catatttcaaatatctggaa 458
             ||||||||||||||||||||
Sbjct: 26193 catatttcaaatatctggaa 26212



to top

>gb|AC092501.2| Homo sapiens chromosome 3 clone RP11-139C14, complete sequence
          Length = 159331

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 499    aaatgtctaaataaagcata 518
              ||||||||||||||||||||
Sbjct: 141484 aaatgtctaaataaagcata 141465



to top

>dbj|AB044334.2| Mus musculus CAST gene for calpastatin type I, II, III, IV-L, IV-S,
            complete cds
          Length = 34223

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 304  atgtacactttgatacttgt 323
            ||||||||||||||||||||
Sbjct: 6990 atgtacactttgatacttgt 6971



to top

>gb|AF180942.1|ATRPP5LE2 Arabidopsis thaliana RPP5 disease resistance locus, main contig
          Length = 91660

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 514   gcatatggagacacatgcag 533
             ||||||||||||||||||||
Sbjct: 22316 gcatatggagacacatgcag 22297



to top

>gb|AC016720.9| Homo sapiens BAC clone RP11-326G23 from 2, complete sequence
          Length = 154318

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 469    tcctgaaggcaattcagagcagag 492
              |||||||| |||||||||||||||
Sbjct: 140458 tcctgaagacaattcagagcagag 140481



to top

>gb|AC019106.3| Homo sapiens BAC clone RP11-479L11 from 2, complete sequence
          Length = 198540

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 263  aaagaagcatacaaaaaaga 282
            ||||||||||||||||||||
Sbjct: 8434 aaagaagcatacaaaaaaga 8415



to top

>gb|AC021068.17|AC021068 Homo sapiens 3 BAC RP11-48O22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 159259

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 499   aaatgtctaaataaagcata 518
             ||||||||||||||||||||
Sbjct: 52203 aaatgtctaaataaagcata 52184



to top

>dbj|BS000001.1| Pan troglodytes chromosome 22 clone:PTB-520F08, map 22, complete
            sequences
          Length = 99407

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 474  aaggcaattcagagcagagtacag 497
            ||||||||||| ||||||||||||
Sbjct: 5901 aaggcaattcaaagcagagtacag 5878



to top

>gb|AC154780.2| Mus musculus BAC clone RP24-462E4 from 13, complete sequence
          Length = 161998

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 304   atgtacactttgatacttgt 323
             ||||||||||||||||||||
Sbjct: 83529 atgtacactttgatacttgt 83548



to top

>gb|AC122236.5| Mus musculus BAC clone RP23-141I22 from 8, complete sequence
          Length = 214447

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    cacaatttcaaaaagaaaaa 205
              ||||||||||||||||||||
Sbjct: 162059 cacaatttcaaaaagaaaaa 162078



to top

>emb|AL163203.2|HS21C003 Homo sapiens chromosome 21 segment HS21C003
          Length = 340000

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 474    aaggcaattcagagcagagtacag 497
              ||||||||||| ||||||||||||
Sbjct: 248632 aaggcaattcaaagcagagtacag 248609



to top

>dbj|AP005058.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-19M12, complete
             sequence
          Length = 179546

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 474   aaggcaattcagagcagagtacag 497
             ||||||||||| ||||||||||||
Sbjct: 55032 aaggcaattcaaagcagagtacag 55055



to top

>gb|U23519.2| Caenorhabditis elegans cosmid F26G1, complete sequence
          Length = 37754

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   tttcaaaaagaaaaattgga 210
             ||||||||||||||||||||
Sbjct: 29981 tttcaaaaagaaaaattgga 30000



to top

>dbj|AP001465.1| Homo sapiens genomic DNA, chromosome 21q11.1, clone:B663H15, centromere
             region, complete sequence
          Length = 104785

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 474   aaggcaattcagagcagagtacag 497
             ||||||||||| ||||||||||||
Sbjct: 11117 aaggcaattcaaagcagagtacag 11094


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,198,434
Number of Sequences: 3902068
Number of extensions: 6198434
Number of successful extensions: 109126
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109050
Number of HSP's gapped (non-prelim): 76
length of query: 542
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 519
effective length of database: 17,143,297,704
effective search space: 8897371508376
effective search space used: 8897371508376
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top