Clone Information

BLAST Search Result

Clone Name	rbags26c20
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AC170188.2\| Mus musculus BAC clone RP24-195M20 from chromosom...	50	0.008
2	gb\|AC119900.7\| Mus musculus chromosome 8, clone RP24-235K6, comp...	50	0.008
3	gb\|AC139381.4\| Mus musculus BAC clone RP23-171D1 from 13, comple...	50	0.008
4	ref\|XM_851441.1\| PREDICTED: Canis familiaris similar to General ...	48	0.033
5	ref\|XM_851398.1\| PREDICTED: Canis familiaris similar to General ...	48	0.033
6	ref\|XM_536013.2\| PREDICTED: Canis familiaris similar to General ...	48	0.033
7	gb\|AC124672.9\| Mus musculus chromosome 1, clone RP23-328G14, com...	48	0.033
8	ref\|XM_758557.1\| Theileria parva strain Muguga chromosome 4 hypo...	48	0.033
9	gb\|AC143341.8\| Medicago truncatula clone mth2-7a11, complete seq...	48	0.033
10	ref\|XM_970187.1\| PREDICTED: Tribolium castaneum similar to CG965...	48	0.033
11	gb\|DQ267106.1\| Triticum urartu clone BAC 210J24 chromosome 4A, c...	48	0.033
12	gb\|AC140442.4\| Mus musculus BAC clone RP24-106P1 from 12, comple...	48	0.033
13	gb\|AC163040.5\| Mus musculus BAC clone RP23-71C23 from chromosome...	48	0.033
14	emb\|AL611936.11\| Mouse DNA sequence from clone RP23-40G2 on chro...	48	0.033
15	ref\|XM_639032.1\| Dictyostelium discoideum hypothetical protein (...	46	0.13
16	ref\|XM_511295.1\| PREDICTED: Pan troglodytes similar to KIAA0909 ...	46	0.13
17	gb\|AC113005.10\| Mus musculus chromosome 3, clone RP23-299B23, co...	46	0.13
18	gb\|AC161496.6\| Mus musculus chromosome 3, clone RP23-119A9, comp...	46	0.13
19	gb\|AC137104.11\| Mus musculus chromosome 1, clone RP23-241K20, co...	46	0.13
20	gb\|AC124110.8\| Mus musculus chromosome 1, clone RP24-343C13, com...	46	0.13
21	ref\|XM_607664.2\| PREDICTED: Bos taurus similar to retrotransposo...	46	0.13
22	ref\|XM_603144.2\| PREDICTED: Bos taurus similar to a disintegrin ...	46	0.13
23	ref\|XM_959652.1\| Neurospora crassa OR74A hypothetical protein (N...	46	0.13
24	ref\|XM_325098.1\| Neurospora crassa OR74A hypothetical protein (N...	46	0.13
25	ref\|XM_451914.1\| Kluyveromyces lactis NRRL Y-1140, KLLA0B08679g ...	46	0.13
26	ref\|XR_002740.1\| PREDICTED: Mus musculus hypothetical protein LO...	46	0.13
27	ref\|XM_907057.2\| PREDICTED: Mus musculus similar to High mobilit...	46	0.13
28	ref\|XM_484474.3\| PREDICTED: Mus musculus similar to High mobilit...	46	0.13
29	ref\|XM_857646.1\| PREDICTED: Canis familiaris similar to PGC-1 re...	46	0.13
30	ref\|XM_534998.2\| PREDICTED: Canis familiaris similar to PGC-1 re...	46	0.13
31	emb\|CT009568.8\| M.truncatula DNA sequence from clone MTH2-95K22 ...	46	0.13
32	ref\|XM_389409.1\| Gibberella zeae PH-1 chromosome 4 hypothetical ...	46	0.13
33	gb\|AC101527.12\| Mus musculus chromosome 15, clone RP23-191D20, c...	46	0.13
34	gb\|AC154291.2\| Mus musculus BAC clone RP23-447B21 from chromosom...	46	0.13
35	emb\|AL049749.2\|HS293L6 Human DNA sequence from clone RP1-293L6 o...	46	0.13
36	emb\|CR382122.1\| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	46	0.13
37	emb\|BX842682.1\| Neurospora crassa DNA linkage group I BAC contig...	46	0.13
38	emb\|BX842638.1\| Neurospora crassa DNA linkage group I cosmid con...	46	0.13
39	gb\|AC151294.3\| Mus musculus BAC clone RP23-137I7 from chromosome...	46	0.13
40	gb\|AF015725.3\| Homo sapiens chromosome 21 clone cosmid clone D68...	46	0.13
41	gb\|AC116957.2\| Dictyostelium discoideum chromosome 2 map 1685067...	46	0.13
42	dbj\|BS000197.1\| Pan troglodytes chromosome 22 clone:PTB-108M20, ...	46	0.13
43	emb\|AJ229042.1\|HS229042 Homo sapiens 959 kb contig between AML1 ...	46	0.13
44	emb\|AL163268.2\|HS21C068 Homo sapiens chromosome 21 segment HS21C068	46	0.13
45	dbj\|AP006245.1\| Homo sapiens genomic DNA, chromosome 8, clone:RP...	46	0.13
46	gb\|AF086807.1\|AF086807 Bos taurus fertilin alpha (ADAM 1) mRNA, ...	46	0.13
47	emb\|BX284660.1\| Human DNA sequence from clone RP1-293L6 on chrom...	46	0.13
48	emb\|AL929060.7\| Mouse DNA sequence from clone RP23-17F8 on chrom...	46	0.13
49	emb\|AL627087.11\| Mouse DNA sequence from clone RP23-243K17 on ch...	46	0.13
50	gb\|AC159470.17\| Mus musculus 10 BAC RP24-462C5 (Roswell Park Can...	46	0.13
51	gb\|AC167231.12\| Mus musculus BAC RP23-416P12 (Roswell Park Canc...	46	0.13
52	dbj\|AP000079.1\| Homo sapiens genomic DNA, chromosome 8p11.2, sen...	46	0.13
53	ref\|NM_114344.2\| Arabidopsis thaliana HD2A (HISTONE DEACETYLASE ...	44	0.51
54	ref\|NM_119526.2\| Arabidopsis thaliana AGD2 (ABERRANT GROWTH AND ...	44	0.51
55	ref\|NM_121431.2\| Arabidopsis thaliana DNA binding AT5G14270 mRNA...	44	0.51
56	ref\|NM_104710.3\| Arabidopsis thaliana nucleic acid binding AT1G6...	44	0.51
57	ref\|NM_125003.1\| Arabidopsis thaliana nucleic acid binding / tra...	44	0.51
58	ref\|XM_507492.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.51
59	ref\|XM_506853.2\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.51
60	ref\|XM_466588.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.51
61	ref\|XM_518336.1\| PREDICTED: Pan troglodytes similar to RNA helic...	44	0.51
62	gb\|AC167168.5\| Mus musculus chromosome 1, clone RP23-100P14, com...	44	0.51
63	ref\|XM_513839.1\| PREDICTED: Pan troglodytes LOC457347 (LOC457347...	44	0.51
64	gb\|AC135957.3\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.51
65	gb\|AC093351.8\| Mus musculus chromosome 7, clone RP23-16L19, comp...	44	0.51
66	ref\|NM_010414.1\| Mus musculus Huntington disease gene homolog (H...	44	0.51
67	gb\|BC070620.1\| Xenopus laevis hypothetical protein MGC81381, mRN...	44	0.51
68	ref\|NM_145025.2\| Homo sapiens chromosome 6 open reading frame 19...	44	0.51
69	gb\|AY518701.1\| Arabidopsis thaliana aminotransferase AGD2 mRNA, ...	44	0.51
70	gb\|DQ484035.1\| Gymnogyps californianus clone 201G microsatellite...	44	0.51
71	ref\|XM_883510.1\| Leishmania major strain Friedlin hypothetical p...	44	0.51
72	emb\|AL139794.3\|LMFLCHR4B Leishmania major Friedlin chromosome 4,...	44	0.51
73	ref\|XM_384733.1\| Gibberella zeae PH-1 chromosome 2 hypothetical ...	44	0.51
74	gb\|AC127552.3\| Mus musculus BAC clone RP24-550N13 from chromosom...	44	0.51
75	gb\|AC133204.3\| Mus musculus BAC clone RP23-106N3 from chromosome...	44	0.51
76	ref\|XM_807307.1\| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.51
77	gb\|AC124370.3\| Mus musculus BAC clone RP24-554F1 from chromosome...	44	0.51
78	ref\|XM_803723.1\| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.51
79	gb\|AC121579.3\| Mus musculus BAC clone RP23-255H8 from 3, complet...	44	0.51
80	gb\|AC116567.5\| Mus musculus BAC clone RP23-1M9 from 5, complete ...	44	0.51
81	ref\|XM_547544.2\| PREDICTED: Canis familiaris similar to Dingo pr...	44	0.51
82	emb\|CR699252.2\|CNS0G2HS Tetraodon nigroviridis full-length cDNA	44	0.51
83	emb\|CR696851.2\|CNS0G0N3 Tetraodon nigroviridis full-length cDNA	44	0.51
84	emb\|CR690011.2\|CNS0FVD3 Tetraodon nigroviridis full-length cDNA	44	0.51
85	emb\|CR676980.2\|CNS0FLBK Tetraodon nigroviridis full-length cDNA	44	0.51
86	gb\|AC004917.2\| Homo sapiens PAC clone RP5-892G19 from 7, complet...	44	0.51
87	emb\|CR665950.2\|CNS0FCTG Tetraodon nigroviridis full-length cDNA	44	0.51
88	ref\|NM_012749.1\| Rattus norvegicus nucleolin (Ncl), mRNA	44	0.51
89	emb\|AL512640.9\| Human DNA sequence from clone RP11-219K22 on chr...	44	0.51
90	emb\|AL355989.11\| Human DNA sequence from clone RP11-272J7 on chr...	44	0.51
91	emb\|AL121788.17\|HSDJ70A9 Human DNA sequence from clone RP1-70A9 ...	44	0.51
92	gb\|AY117246.1\| Arabidopsis thaliana unknown protein (At4g33680) ...	44	0.51
93	gb\|AY096729.1\| Arabidopsis thaliana putative histone deacetylase...	44	0.51
94	gb\|AY074284.1\| Arabidopsis thaliana unknown protein (At1g60210) ...	44	0.51
95	gb\|AY065396.1\| Arabidopsis thaliana putative histone deacetylase...	44	0.51
96	gb\|AY065256.1\| Arabidopsis thaliana unknown protein (At4g33680) ...	44	0.51
97	gb\|AY059785.1\| Arabidopsis thaliana putative kinase (At5g14270) ...	44	0.51
98	emb\|CR380953.1\| Candida glabrata strain CBS138 chromosome G comp...	44	0.51
99	ref\|NM_001016482.2\| Xenopus tropicalis tubby like protein 1 (tul...	44	0.51
100	gb\|BC022031.2\| Homo sapiens chromosome 6 open reading frame 199,...	44	0.51
101	emb\|AL163817.1\|ATF18O22 Arabidopsis thaliana DNA chromosome 5, B...	44	0.51
102	emb\|AL161584.2\|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, ...	44	0.51
103	emb\|AL031394.1\|ATT16L1 Arabidopsis thaliana DNA chromosome 4, BA...	44	0.51
104	gb\|BC085751.1\| Rattus norvegicus nucleolin, mRNA (cDNA clone MGC...	44	0.51
105	emb\|CR858094.1\| Pongo pygmaeus mRNA; cDNA DKFZp459L1130 (from cl...	44	0.51
106	dbj\|AB210152.1\| Pan troglodytes DDX16 gene for DEAD/H (Asp-Glu-A...	44	0.51
107	dbj\|AB210151.1\| Pan troglodytes DDX16 gene for DEAD/H (Asp-Glu-A...	44	0.51
108	dbj\|AK092103.1\| Homo sapiens cDNA FLJ34784 fis, clone NT2NE2004255	44	0.51
109	dbj\|AK055538.1\| Homo sapiens cDNA FLJ30976 fis, clone HHDPC20000...	44	0.51
110	gb\|AC069025.5\| Homo sapiens chromosome 10 clone RP11-526G5, comp...	44	0.51
111	gb\|AF195545.1\| Arabidopsis thaliana putative histone deacetylase...	44	0.51
112	dbj\|AK161740.1\| Mus musculus adult male thymus cDNA, RIKEN full-...	44	0.51
113	gb\|AY056423.1\| Arabidopsis thaliana AT4g33680/T16L1_170 mRNA, co...	44	0.51
114	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.51
115	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.51
116	gb\|AC091946.5\| Homo sapiens chromosome 5 clone RP11-360I2, compl...	44	0.51
117	ref\|XM_217807.3\| PREDICTED: Rattus norvegicus zinc finger protei...	44	0.51
118	dbj\|BA000041.2\| Pan troglodytes DNA, major histocompatibility co...	44	0.51
119	dbj\|AP005385.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.51
120	dbj\|AP004124.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.51
121	dbj\|AB023029.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	44	0.51
122	dbj\|AK121891.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.51
123	dbj\|AK101873.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.51
124	dbj\|AK099539.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.51
125	emb\|AM055942.1\| Toxoplasma gondii, strain RH, genomic DNA chromo...	44	0.51
126	emb\|CT574568.2\| Pan troglodytes chromosome X clone PTB-081L12 ma...	44	0.51
127	gb\|AC122205.6\| Mus musculus BAC clone RP23-76C13 from chromosome...	44	0.51
128	emb\|X00551.1\|SCCR17 Yeast gene for subunit VI of ubiquinol-cytoc...	44	0.51
129	emb\|CR760884.2\| Xenopus tropicalis finished cDNA, clone TTpA003j24	44	0.51
130	emb\|CR760273.2\| Xenopus tropicalis finished cDNA, clone TNeu097k05	44	0.51
131	gb\|AC107689.7\| Mus musculus chromosome 3, clone RP24-283F19, com...	44	0.51
132	dbj\|AP000767.4\| Homo sapiens genomic DNA, chromosome 11q, clone:...	44	0.51
133	gb\|DQ332617.1\| Synthetic construct Saccharomyces cerevisiae clon...	44	0.51
134	gb\|DQ331645.1\| Synthetic construct Saccharomyces cerevisiae clon...	44	0.51
135	gb\|BT001972.1\| Arabidopsis thaliana clone U19063 unknown protein...	44	0.51
136	gb\|AE000666.1\| Methanothermobacter thermautotrophicus str. Delta...	44	0.51
137	gb\|U24233.1\|MMU24233 Mus musculus huntingtin (Hd) mRNA, complete...	44	0.51
138	gb\|AE000512.1\| Thermotoga maritima MSB8, complete genome	44	0.51
139	emb\|AL832162.1\|HSM803469 Homo sapiens mRNA; cDNA DKFZp686K0714 (...	44	0.51
140	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.51
141	gb\|AC004473.1\|T13D8 Arabidopsis thaliana chromosome 1 BAC T13D8,...	44	0.51
142	emb\|BX000983.15\| Mouse DNA sequence from clone RP24-260C8 on chr...	44	0.51
143	gb\|AC135085.3\| Mus musculus BAC clone RP24-317P24 from 1, comple...	44	0.51
144	gb\|AC003051.1\|AC003051 Homo sapiens chromosome 17, clone 289A8, ...	44	0.51
145	gb\|L28827.1\|MUSHDH Mouse Huntington's Disease gene homologue (Hd...	44	0.51
146	gb\|U40455.1\|HSU40455 Human chromosome X cosmid, clones 196B12, 9...	44	0.51
147	gb\|L23313.1\|MUSHDPROB Mouse alternatively spliced HD protein mRN...	44	0.51
148	gb\|L23312.1\|MUSHDPROA Mouse HD protein mRNA, complete cds	44	0.51
149	dbj\|D50617.1\|YSCCHRVIN Saccharomyces cerevisiae chromosome VI co...	44	0.51
150	dbj\|AB060276.1\| Oryza sativa mRNA for kinase-like protein, compl...	44	0.51
151	gb\|AC130283.8\| Mus musculus chromosome 15, clone RP23-136E18, co...	42	2.0
152	gb\|AC114642.6\| Mus musculus chromosome 3, clone RP24-127D4, comp...	42	2.0
153	gb\|AC110510.6\| Mus musculus chromosome 1, clone RP24-503F14, com...	42	2.0
154	gb\|AC132899.11\| Mus musculus chromosome 15, clone RP24-367P22, c...	42	2.0
155	gb\|AC126598.13\| Mus musculus chromosome 5, clone RP24-486L9, com...	42	2.0
156	gb\|DQ100962.1\| Homo sapiens isolate P200H immunoglobulin heavy c...	42	2.0
157	gb\|AC110904.8\| Mus musculus chromosome 7, clone RP24-174I24, com...	42	2.0
158	gb\|AY726636.1\| Xenopus laevis Brg1 mRNA, complete cds	42	2.0
159	gb\|AC140431.4\| Mus musculus BAC clone RP24-172K3 from chromosome...	42	2.0
160	gb\|AC161810.10\| Mus musculus chromosome 3, clone RP24-363L5, com...	42	2.0
161	gb\|AC121304.7\| Mus musculus chromosome 3, clone RP24-63C3, compl...	42	2.0
162	gb\|AC163610.4\| Mus musculus BAC clone RP23-59P17 from chromosome...	42	2.0
163	gb\|AC157087.2\| Mus musculus BAC clone RP23-287O24 from chromosom...	42	2.0
164	gb\|AC135667.5\| Mus musculus BAC clone RP24-536G18 from chromosom...	42	2.0
165	gb\|AC142244.11\| Mus musculus chromosome 1, clone RP23-79H24, com...	42	2.0
166	ref\|XM_511457.1\| PREDICTED: Pan troglodytes similar to Dopamine-...	42	2.0
167	gb\|AC131975.28\| Mus musculus chromosome 17, clone RP24-146B4, co...	42	2.0
168	gb\|AC160526.13\| Mus musculus chromosome 8, clone RP24-191C23, co...	42	2.0
169	gb\|AC160027.16\| Mus musculus 10 BAC RP23-192N23 (Roswell Park Ca...	42	2.0
170	gb\|AC115691.8\| Mus musculus chromosome 18, clone RP24-286B14, co...	42	2.0
171	gb\|AC115011.27\| Mus musculus chromosome 1, clone RP24-192A11, co...	42	2.0
172	ref\|XM_631827.1\| Dictyostelium discoideum hypothetical protein (...	42	2.0
173	gb\|AC165224.9\| Mus musculus chromosome 5, clone RP24-389L10, com...	42	2.0
174	gb\|AC115006.12\| Mus musculus chromosome 8, clone RP24-184D21, co...	42	2.0
175	gb\|AC123713.13\| Mus musculus chromosome 7, clone RP23-391D20, co...	42	2.0
176	ref\|XM_642353.1\| Dictyostelium discoideum SMAD/FHA domain-contai...	42	2.0
177	gb\|AC135720.8\| Mus musculus chromosome 15, clone RP24-298F20, co...	42	2.0
178	ref\|XM_636607.1\| Dictyostelium discoideum hypothetical protein (...	42	2.0
179	ref\|XM_636112.1\| Dictyostelium discoideum hypothetical protein (...	42	2.0
180	ref\|XM_635360.1\| Dictyostelium discoideum hypothetical protein (...	42	2.0
181	ref\|XM_630095.1\| Dictyostelium discoideum hypothetical protein (...	42	2.0
182	gb\|AC161597.7\| Mus musculus BAC clone RP23-387P23 from chromosom...	42	2.0
183	gb\|AC165247.2\| Mus musculus BAC clone RP24-213G21 from chromosom...	42	2.0
184	gb\|AC164302.2\| Mus musculus BAC clone RP23-286N12 from chromosom...	42	2.0
185	gb\|AC166097.5\| Mus musculus BAC clone RP24-447P10 from chromosom...	42	2.0
186	gb\|AC169129.2\| Mus musculus BAC clone RP23-259N3 from chromosome...	42	2.0
187	ref\|XM_509822.1\| PREDICTED: Pan troglodytes similar to KIAA0360 ...	42	2.0
188	ref\|XM_507879.1\| PREDICTED: Pan troglodytes similar to Pro-neure...	42	2.0
189	ref\|XM_473891.1\| Oryza sativa (japonica cultivar-group), predic...	42	2.0
190	gb\|AC169504.1\| Mus musculus BAC clone RP23-416K3 from chromosome...	42	2.0
191	ref\|NM_005407.1\| Homo sapiens sal-like 2 (Drosophila) (SALL2), mRNA	42	2.0
192	ref\|NM_003048.3\| Homo sapiens solute carrier family 9 (sodium/hy...	42	2.0
193	gb\|AC002534.1\| Arabidopsis thaliana BAC T32N15 from chromosome I...	42	2.0
194	ref\|NM_012330.1\| Homo sapiens MYST histone acetyltransferase (mo...	42	2.0
195	gb\|BC083067.1\| Mus musculus high mobility group box 1, mRNA (cDN...	42	2.0
196	gb\|BC085090.1\| Mus musculus high mobility group box 1, mRNA (cDN...	42	2.0
197	gb\|AC166646.4\| Mus musculus chromosome 3, clone RP24-400P18, com...	42	2.0
198	gb\|AC133489.32\| Mus musculus strain C57BL/6J clone rp23-74a5, co...	42	2.0
199	gb\|AC102355.13\| Mus musculus chromosome 5, clone RP23-120C8, com...	42	2.0
200	gb\|AC109149.15\| Mus musculus chromosome 19, clone RP24-178F17, c...	42	2.0
201	gb\|AC111130.17\| Mus musculus chromosome 5, clone RP23-339G19, co...	42	2.0
202	gb\|DP000013.1\| Otolemur garnettii target 1 genomic scaffold	42	2.0
203	gb\|AC115868.12\| Mus musculus chromosome 7, clone RP24-329F21, co...	42	2.0
204	gb\|AC113469.9\| Mus musculus chromosome 8, clone RP23-261B5, comp...	42	2.0
205	gb\|AC113587.16\| Mus musculus chromosome 15, clone RP24-424I13, c...	42	2.0
206	gb\|AF106329.1\| Escherichia coli plasmid F putative methyltransfe...	42	2.0
207	gb\|AC157991.5\| Mus musculus chromosome 18, clone RP23-335B10, co...	42	2.0
208	gb\|AC162171.7\| Mus musculus chromosome 5, clone RP23-143N11, com...	42	2.0
209	gb\|AF259072.1\| Mus musculus T-cell receptor alpha locus BAC clon...	42	2.0
210	gb\|CP000079.1\| Leishmania major strain Friedlin chromosome 27, c...	42	2.0
211	gb\|AE017353.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	2.0
212	gb\|AE017346.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	2.0
213	gb\|AE017341.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	2.0
214	gb\|AE000658.1\|HUAE000658 Homo sapiens T-cell receptor alpha delt...	42	2.0
215	gb\|AF469174.1\| Cryptosporidium parvum strain cpa16 microsatellit...	42	2.0
216	gb\|AC166800.5\| Mus musculus chromosome 1, clone RP24-260I21, com...	42	2.0
217	gb\|AC102124.16\| Mus musculus chromosome 18, clone RP23-188D1, co...	42	2.0
218	gb\|AC128597.3\| Rattus norvegicus BAC CH230-62C6 (Children's Hos...	42	2.0
219	gb\|AC119266.14\| Mus musculus chromosome 13, clone RP24-321G8, co...	42	2.0
220	gb\|AC101391.15\| Mus musculus chromosome 5, clone RP23-119E13, co...	42	2.0
221	gb\|AF235097.2\| Homo sapiens chromosome X multiple clones map p11...	42	2.0
222	gb\|CP000099.1\| Methanosarcina barkeri str. fusaro chromosome 1, ...	42	2.0
223	gb\|AC165090.3\| Mus musculus BAC clone RP23-95H4 from chromosome ...	42	2.0
224	gb\|AC154279.2\| Mus musculus BAC clone RP24-271E12 from chromosom...	42	2.0
225	gb\|AC144519.4\| Mus musculus BAC clone RP24-325A1 from chromosome...	42	2.0
226	gb\|AC167171.2\| Mus musculus BAC clone RP23-409H8 from chromosome...	42	2.0
227	gb\|AC164303.2\| Mus musculus BAC clone RP24-530J21 from chromosom...	42	2.0
228	gb\|AC154025.12\| Mus musculus 6 BAC RP24-539J4 (Roswell Park Canc...	42	2.0
229	gb\|AC111023.12\| Mus musculus chromosome 19, clone RP23-221A9, co...	42	2.0
230	gb\|U49944.2\| Caenorhabditis elegans cosmid C39E6, complete sequence	42	2.0
231	gb\|AC102714.16\| Mus musculus chromosome 5, clone RP24-298D13, co...	42	2.0
232	gb\|AC113092.25\| Mus musculus chromosome 6, clone RP23-309N11, co...	42	2.0
233	gb\|AC118627.6\| Mus musculus chromosome 15, clone RP24-91E8, comp...	42	2.0
234	gb\|AC115718.14\| Mus musculus chromosome 8, clone RP23-247P3, com...	42	2.0
235	gb\|AC123658.9\| Mus musculus chromosome 15, clone RP23-192C13, co...	42	2.0
236	gb\|AC102874.7\| Mus musculus chromosome 1, clone RP24-500O1, comp...	42	2.0
237	ref\|XM_875023.1\| PREDICTED: Bos taurus similar to Dingo protein ...	42	2.0
238	ref\|XM_604484.2\| PREDICTED: Bos taurus similar to Dingo protein ...	42	2.0
239	gb\|AC100726.7\| Mus musculus chromosome 19, clone RP24-245B11, co...	42	2.0
240	gb\|BC080271.1\| Mus musculus solute carrier family 4 (anion excha...	42	2.0
241	gb\|AC117784.13\| Mus musculus chromosome 15, clone RP24-545F24, c...	42	2.0
242	gb\|AC114512.5\| Rattus norvegicus 5 BAC CH230-5N9 (Children's Hos...	42	2.0
243	gb\|AC121292.9\| Mus musculus chromosome 1, clone RP23-172B15, com...	42	2.0
244	gb\|AC131989.8\| Mus musculus chromosome 14, clone RP24-186N15, co...	42	2.0
245	gb\|AC161409.11\| Mus musculus chromosome 7, clone RP23-292B24, co...	42	2.0
246	ref\|XM_425989.1\| PREDICTED: Gallus gallus similar to nephew of a...	42	2.0
247	gb\|AC102509.6\| Mus musculus chromosome 7, clone RP24-327G7, comp...	42	2.0
248	gb\|AC124614.11\| Mus musculus chromosome 10, clone RP24-417L12, c...	42	2.0
249	gb\|AC117826.10\| Mus musculus chromosome 1, clone RP24-81K19, com...	42	2.0
250	gb\|AC100986.9\| Mus musculus chromosome 3, clone RP23-77E5, compl...	42	2.0
251	gb\|AC111135.10\| Mus musculus chromosome 9, clone RP23-349N4, com...	42	2.0
252	gb\|AC129332.6\| Mus musculus BAC clone RP23-91I19 from chromosome...	42	2.0
253	gb\|AC140189.3\| Mus musculus BAC clone RP24-370G18 from chromosom...	42	2.0
254	gb\|AC140339.4\| Mus musculus BAC clone RP24-64N14 from chromosome...	42	2.0
255	gb\|AC147263.3\| Mus musculus BAC clone RP24-213I13 from chromosom...	42	2.0
256	gb\|AC107685.7\| Mus musculus chromosome 19, clone RP24-376I6, com...	42	2.0
257	gb\|AC137680.10\| Mus musculus chromosome 13, clone RP23-454P19, c...	42	2.0
258	gb\|AC091463.9\| Mus musculus chromosome 16, clone RP23-301D7, com...	42	2.0
259	gb\|AC096338.17\| Rattus norvegicus X BAC CH230-95I19 (Children's ...	42	2.0
260	gb\|AC119615.7\| Rattus norvegicus 10 NOVECTOR CH230-502G21 (Child...	42	2.0
261	gb\|AC131586.10\| Mus musculus chromosome 14, clone RP24-226L18, c...	42	2.0
262	ref\|NM_010439.2\| Mus musculus high mobility group box 1 (Hmgb1),...	42	2.0
263	gb\|BC072638.1\| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cD...	42	2.0
264	ref\|NM_005183.2\| Homo sapiens calcium channel, voltage-dependent...	42	2.0
265	gb\|BC061779.1\| Rattus norvegicus high mobility group box 1, mRNA...	42	2.0
266	ref\|XM_880866.1\| PREDICTED: Bos taurus similar to chromatin-spec...	42	2.0
267	ref\|XM_880848.1\| PREDICTED: Bos taurus similar to chromatin-spec...	42	2.0
268	ref\|XM_592917.2\| PREDICTED: Bos taurus similar to chromatin-spec...	42	2.0
269	gb\|AC123747.26\| Mus musculus chromosome 3, clone RP24-123I12, co...	42	2.0
270	ref\|XM_954472.1\| Neurospora crassa OR74A hypothetical protein (N...	42	2.0
271	gb\|AC139211.13\| Mus musculus chromosome 6, clone RP23-302O24, co...	42	2.0
272	ref\|XM_958109.1\| Neurospora crassa OR74A hypothetical protein (N...	42	2.0
273	ref\|XM_328859.1\| Neurospora crassa OR74A hypothetical protein (N...	42	2.0
274	ref\|XM_329836.1\| Neurospora crassa OR74A hypothetical protein (N...	42	2.0
275	gb\|AC091295.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	42	2.0
276	gb\|AC118216.15\| Mus musculus chromosome 1, clone RP23-209N14, co...	42	2.0
277	gb\|AC068500.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	42	2.0
278	gb\|AC135509.2\| Mus musculus BAC clone RP24-448I12 from chromosom...	42	2.0
279	gb\|AC090046.10\| Mus musculus chromosome 6, clone RP23-82P24, com...	42	2.0
280	ref\|XM_708191.1\| Candida albicans SC5314 hypothetical protein (C...	42	2.0
281	ref\|XM_708140.1\| Candida albicans SC5314 hypothetical protein (C...	42	2.0
282	gb\|AC146235.2\| Pan troglodytes BAC clone CH251-212L1 from Y, com...	42	2.0
283	gb\|AC147345.2\| Pan troglodytes BAC clone CH251-8K7 from Y, compl...	42	2.0
284	gb\|AC142146.3\| Mus musculus BAC clone RP24-74D8 from chromosome ...	42	2.0
285	gb\|AC135240.2\| Mus musculus BAC clone RP24-63O24 from chromosome...	42	2.0
286	gb\|AC132602.2\| Mus musculus BAC clone RP23-477C13 from chromosom...	42	2.0
287	gb\|AC134243.3\| Mus musculus BAC clone RP24-90E15 from chromosome...	42	2.0
288	gb\|AC131185.4\| Mus musculus BAC clone RP23-402H1 from chromosome...	42	2.0
289	gb\|CP000114.1\| Streptococcus agalactiae A909, complete genome	42	2.0
290	gb\|AC158220.4\| Mus musculus chromosome 7, clone RP23-278M8, comp...	42	2.0
291	gb\|AC154398.6\| Mus musculus chromosome 1, clone RP24-372I12, com...	42	2.0
292	gb\|AC164402.3\| Mus musculus chromosome 15, clone RP23-463G20, co...	42	2.0
293	gb\|AC161206.10\| Mus musculus chromosome 15, clone RP24-299A13, c...	42	2.0
294	ref\|NM_001010848.2\| Homo sapiens neuregulin 3 (NRG3), mRNA	42	2.0
295	gb\|AC132844.7\| Mus musculus chromosome 17, clone RP24-481P13, co...	42	2.0
296	gb\|AC133459.9\| Mus musculus chromosome 12, clone RP23-383O15, co...	42	2.0
297	gb\|AC109170.10\| Mus musculus chromosome 8, clone RP23-87B3, comp...	42	2.0
298	gb\|AC090437.62\| Mus musculus strain C57BL/6J clone rp23-11f20 ma...	42	2.0
299	gb\|AC120147.8\| Mus musculus chromosome 19, clone RP24-223N20, co...	42	2.0
300	gb\|AY815793.1\| Schistosoma japonicum SJCHGC09170 protein mRNA, c...	42	2.0
301	emb\|AJ249803.1\|GHE249803 Gallid herpesvirus 1 UL52 gene, UL51 ge...	42	2.0
302	gb\|AC107834.13\| Mus musculus chromosome 1, clone RP23-251L12, co...	42	2.0
303	gb\|AC151969.3\| Mus musculus BAC clone RP24-255B1 from chromosome...	42	2.0
304	gb\|AC101559.20\| Mus musculus chromosome 5, clone RP23-194K16, co...	42	2.0
305	gb\|AC111029.8\| Mus musculus chromosome 3, clone RP23-235E15, com...	42	2.0
306	gb\|AC060781.8\| Mus musculus chromosome 19, clone RP23-196A19, co...	42	2.0
307	gb\|AC160540.7\| Mus musculus chromosome 7, clone RP23-44O19, comp...	42	2.0
308	gb\|AC162872.9\| Mus musculus chromosome 3, clone RP24-346J6, comp...	42	2.0
309	gb\|AY539926.1\| Rattus norvegicus LRRGT00175 mRNA, complete cds	42	2.0
310	gb\|AC165348.3\| Mus musculus BAC clone RP23-300C11 from chromosom...	42	2.0
311	gb\|AC162887.5\| Mus musculus chromosome 19, clone RP23-414O6, com...	42	2.0
312	gb\|AC165415.5\| Mus musculus chromosome 15, clone RP23-17G19, com...	42	2.0
313	ref\|XM_909743.2\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
314	gb\|AC165965.3\| Mus musculus BAC clone RP23-307L24 from chromosom...	42	2.0
315	gb\|AC163636.5\| Mus musculus BAC clone RP24-499E13 from chromosom...	42	2.0
316	gb\|AC121286.7\| Mus musculus chromosome 12, clone RP23-36H21, com...	42	2.0
317	gb\|BC061959.1\| Danio rerio similar to additional sex combs like ...	42	2.0
318	gb\|AC122820.4\| Mus musculus BAC clone RP23-200M5 from chromosome...	42	2.0
319	gb\|AC135860.4\| Mus musculus BAC clone RP24-441J10 from chromosom...	42	2.0
320	ref\|XR_003570.1\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
321	ref\|XR_002569.1\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
322	ref\|XR_002668.1\| PREDICTED: Mus musculus hypothetical protein LO...	42	2.0
323	gb\|AC139213.11\| Mus musculus chromosome 7, clone RP23-341H2, com...	42	2.0
324	ref\|XR_002302.1\| PREDICTED: Mus musculus hypothetical protein LO...	42	2.0
325	ref\|XR_002282.1\| PREDICTED: Mus musculus hypothetical protein LO...	42	2.0
326	ref\|XR_003222.1\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
327	ref\|XM_884320.2\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
328	ref\|XM_914398.2\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
329	ref\|XM_977875.1\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
330	ref\|XM_980492.1\| PREDICTED: Mus musculus hypothetical LOC629356 ...	42	2.0
331	gb\|AC139940.5\| Mus musculus chromosome 15, clone RP23-468K16, co...	42	2.0
332	gb\|AC100539.12\| Mus musculus chromosome 1, clone RP23-152E3, com...	42	2.0
333	gb\|AC110262.12\| Mus musculus chromosome 17, clone RP23-291L10, c...	42	2.0
334	ref\|XM_001001990.1\| PREDICTED: Mus musculus similar to High mobi...	42	2.0
335	ref\|XM_485920.3\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
336	ref\|XM_916659.2\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
337	gb\|AC120922.4\| Rattus norvegicus 9 BAC CH230-104J1 (Children's H...	42	2.0
338	ref\|XR_003871.1\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
339	ref\|XM_984150.1\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
340	ref\|XM_906615.2\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
341	ref\|XM_484867.4\| PREDICTED: Mus musculus similar to High mobilit...	42	2.0
342	gb\|BC064790.1\| Mus musculus high mobility group box 1, mRNA (cDN...	42	2.0
343	gb\|AC140378.2\| Mus musculus BAC clone RP24-84M18 from chromosome...	42	2.0
344	gb\|AC127248.3\| Mus musculus BAC clone RP24-442E2 from chromosome...	42	2.0
345	gb\|AC140782.4\| Mus musculus BAC clone RP24-417N13 from chromosom...	42	2.0
346	gb\|AC127249.4\| Mus musculus BAC clone RP24-475B8 from chromosome...	42	2.0
347	gb\|AC125043.4\| Mus musculus BAC clone RP23-342M4 from chromosome...	42	2.0
348	gb\|AC140233.3\| Mus musculus BAC clone RP23-282N19 from chromosom...	42	2.0
349	gb\|DQ483775.1\| Gymnogyps californianus clone 198F microsatellite...	42	2.0
350	gb\|DQ484017.1\| Gymnogyps californianus clone 183G microsatellite...	42	2.0
351	gb\|DQ483866.1\| Gymnogyps californianus clone 32G microsatellite ...	42	2.0
352	ref\|XM_823691.1\| Trypanosoma brucei TREU927 hypothetical protein...	42	2.0
353	emb\|CT025525.8\| Mouse DNA sequence from clone RP23-285C6 on chro...	42	2.0
354	ref\|XM_848190.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
355	ref\|XM_533243.2\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
356	ref\|XM_862039.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
357	ref\|XM_862027.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
358	ref\|XM_862017.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
359	ref\|XM_862005.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
360	ref\|XM_861996.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
361	ref\|XM_861983.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
362	ref\|XM_861961.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
363	ref\|XM_861950.1\| PREDICTED: Canis familiaris similar to phosphol...	42	2.0
364	emb\|CT010581.10\| Mouse DNA sequence from clone RP23-104J14 on ch...	42	2.0
365	ref\|XM_540257.2\| PREDICTED: Canis familiaris similar to immunogl...	42	2.0
366	ref\|XM_568270.1\| Cryptococcus neoformans var. neoformans JEC21 h...	42	2.0
367	emb\|CT009494.4\| Mouse DNA sequence from clone RP23-125D7 on chro...	42	2.0
368	ref\|XM_566508.1\| Cryptococcus neoformans var. neoformans JEC21 h...	42	2.0
369	ref\|XM_571602.1\| Cryptococcus neoformans var. neoformans JEC21 h...	42	2.0
370	gb\|AC126932.4\| Mus musculus BAC clone RP24-80G20 from chromosome...	42	2.0
371	gb\|AC117239.4\| Mus musculus BAC clone RP24-117K6 from chromosome...	42	2.0
372	gb\|AC124458.5\| Mus musculus BAC clone RP24-136E11 from chromosom...	42	2.0
373	gb\|AC132100.3\| Mus musculus BAC clone RP24-294D10 from chromosom...	42	2.0
374	gb\|AC121977.3\| Mus musculus BAC clone RP24-287A16 from chromosom...	42	2.0
375	gb\|AC122460.4\| Mus musculus BAC clone RP24-283I1 from chromosome...	42	2.0
376	gb\|AC123794.4\| Mus musculus BAC clone RP24-315P14 from chromosom...	42	2.0
377	gb\|AC122483.5\| Mus musculus BAC clone RP24-366B4 from chromosome...	42	2.0
378	gb\|AC122015.3\| Mus musculus BAC clone RP24-358M18 from chromosom...	42	2.0
379	gb\|AC122010.3\| Mus musculus BAC clone RP24-349I15 from chromosom...	42	2.0
380	gb\|AC125460.4\| Mus musculus BAC clone RP24-448D10 from chromosom...	42	2.0
381	gb\|AC124376.4\| Mus musculus BAC clone RP24-573J18 from chromosom...	42	2.0
382	gb\|AC124367.4\| Mus musculus BAC clone RP24-545D20 from chromosom...	42	2.0
383	gb\|AC122199.4\| Mus musculus BAC clone RP23-57C9 from chromosome ...	42	2.0
384	gb\|AC127349.3\| Mus musculus BAC clone RP23-62M5 from chromosome ...	42	2.0
385	gb\|AC122821.4\| Mus musculus BAC clone RP23-201I4 from chromosome...	42	2.0
386	gb\|AC127414.4\| Mus musculus BAC clone RP23-246P24 from chromosom...	42	2.0
387	gb\|AC116319.4\| Mus musculus BAC clone RP23-265J2 from chromosome...	42	2.0
388	gb\|AC123859.4\| Mus musculus BAC clone RP23-346B13 from chromosom...	42	2.0
389	ref\|XM_803007.1\| Trypanosoma cruzi strain CL Brener retrotranspo...	42	2.0
390	gb\|AC122232.3\| Mus musculus BAC clone RP23-136G1 from chromosome...	42	2.0
391	gb\|J00443.1\|MUSIGCD10 Mouse Ig germline mu-chain C-region (D-J-C...	42	2.0
392	gb\|AC109247.14\| Mus musculus chromosome 9, clone RP23-462C14, co...	42	2.0
393	ref\|XM_805865.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	2.0
394	ref\|XM_809831.1\| Trypanosoma cruzi strain CL Brener retrotranspo...	42	2.0
395	gb\|AC110212.12\| Mus musculus chromosome 19, clone RP23-183H23, c...	42	2.0
396	ref\|XM_810077.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	2.0
397	gb\|AC124424.4\| Mus musculus BAC clone RP24-230J3 from chromosome...	42	2.0
398	gb\|AC125157.4\| Mus musculus BAC clone RP24-390G17 from chromosom...	42	2.0
399	gb\|AC125524.4\| Mus musculus BAC clone RP24-378N16 from chromosom...	42	2.0
400	gb\|AC124379.3\| Mus musculus BAC clone RP24-399H16 from chromosom...	42	2.0
401	gb\|AC122041.4\| Mus musculus BAC clone RP24-443H19 from chromosom...	42	2.0
402	gb\|AC124391.3\| Mus musculus BAC clone RP24-439L13 from chromosom...	42	2.0
403	gb\|AC127563.4\| Mus musculus BAC clone RP24-283E13 from chromosom...	42	2.0
404	gb\|AC121971.3\| Mus musculus BAC clone RP24-275H22 from chromosom...	42	2.0
405	gb\|BC060623.1\| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cD...	42	2.0
406	emb\|Z82286.1\|CEW02A2 Caenorhabditis elegans Cosmid W02A2, comple...	42	2.0
407	gb\|AC126553.4\| Mus musculus BAC clone RP23-448L16 from chromosom...	42	2.0
408	ref\|XM_813005.1\| Trypanosoma cruzi strain CL Brener ATP-binding ...	42	2.0
409	gb\|AC124487.3\| Mus musculus BAC clone RP23-452B18 from chromosom...	42	2.0
410	gb\|AC125352.4\| Mus musculus BAC clone RP23-451M13 from chromosom...	42	2.0
411	ref\|XM_813397.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	2.0
412	gb\|AC121844.2\| Mus musculus BAC clone RP24-81L3 from chromosome ...	42	2.0
413	gb\|AC121881.3\| Mus musculus BAC clone RP24-134L8 from chromosome...	42	2.0
414	gb\|AC122420.4\| Mus musculus BAC clone RP24-167C5 from chromosome...	42	2.0
415	gb\|AC127371.3\| Mus musculus BAC clone RP23-35D4 from 15, complet...	42	2.0
416	gb\|AC125049.3\| Mus musculus BAC clone RP23-367C15 from chromosom...	42	2.0
417	gb\|AC124582.4\| Mus musculus BAC clone RP23-120A15 from 6, comple...	42	2.0
418	gb\|AC122864.3\| Mus musculus BAC clone RP23-142M19 from 6, comple...	42	2.0
419	ref\|XM_860848.1\| PREDICTED: Canis familiaris hypothetical protei...	42	2.0
420	gb\|AC124178.3\| Mus musculus BAC clone RP23-193J15 from 18, compl...	42	2.0
421	gb\|AC112792.4\| Mus musculus BAC clone RP23-192J17 from 18, compl...	42	2.0
422	gb\|AC122268.5\| Mus musculus BAC clone RP23-216B15 from 14, compl...	42	2.0
423	ref\|XM_810085.1\| Trypanosoma cruzi strain CL Brener retrotranspo...	42	2.0
424	gb\|AC116179.6\| Mus musculus BAC clone RP23-272C6 from 10, comple...	42	2.0
425	gb\|AC122296.4\| Mus musculus BAC clone RP23-265P8 from 6, complet...	42	2.0
426	gb\|AC116323.6\| Mus musculus BAC clone RP23-281F3 from 8, complet...	42	2.0
427	gb\|AC122879.3\| Mus musculus BAC clone RP23-76C10 from 1, complet...	42	2.0
428	gb\|AC122317.4\| Mus musculus BAC clone RP23-304C21 from 12, compl...	42	2.0
429	gb\|AC104920.10\| Mus musculus chromosome 10, clone RP23-360H23, c...	42	2.0
430	gb\|AC098736.4\| Mus musculus BAC clone RP23-122B3 from 1, complet...	42	2.0
431	gb\|AC098886.4\| Mus musculus BAC clone RP23-122M21 from 4, comple...	42	2.0
432	gb\|AC098744.3\| Mus musculus BAC clone RP23-122P15 from 8, comple...	42	2.0
433	gb\|AC117198.3\| Mus musculus BAC clone RP23-127K18 from 9, comple...	42	2.0
434	gb\|AC115299.4\| Mus musculus BAC clone RP23-444O19 from 13, compl...	42	2.0
435	gb\|AC117237.2\| Mus musculus BAC clone RP23-431G18 from 13, compl...	42	2.0
436	gb\|AC121950.2\| Mus musculus BAC clone RP24-216M19 from 6, comple...	42	2.0
437	gb\|AC107794.13\| Mus musculus chromosome 6, clone RP23-473P21, co...	42	2.0
438	gb\|AC098725.3\| Mus musculus BAC clone RP23-3D20 from 3, complete...	42	2.0
439	gb\|AC098731.3\| Mus musculus BAC clone RP23-3L10 from 9, complete...	42	2.0
440	emb\|CR714011.2\|CNS0GDVR Tetraodon nigroviridis full-length cDNA	42	2.0
441	gb\|AC138642.10\| Mus musculus chromosome 3, clone RP23-21O7, comp...	42	2.0
442	gb\|AC110882.13\| Mus musculus chromosome 18, clone RP23-287A10, c...	42	2.0
443	gb\|BC021128.1\| Homo sapiens MYST histone acetyltransferase (mono...	42	2.0
444	gb\|AC114995.7\| Mus musculus chromosome 8, clone RP23-171P5, comp...	42	2.0
445	emb\|CR704903.2\|CNS0G6UR Tetraodon nigroviridis full-length cDNA	42	2.0
446	ref\|XM_720574.1\| Plasmodium yoelii yoelii str. 17XNL malate:quin...	42	2.0
447	ref\|XM_720849.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	42	2.0
448	ref\|XM_724266.1\| Plasmodium yoelii yoelii str. 17XNL casein kina...	42	2.0
449	gb\|AC027269.5\| Homo sapiens BAC clone RP11-100C21 from 7, comple...	42	2.0
450	gb\|AC004015.1\| Homo sapiens BAC clone CTA-333F24 from 7, complet...	42	2.0
451	ref\|XM_731640.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	2.0
452	ref\|XM_737246.1\| Plasmodium chabaudi chabaudi malate:quinone oxi...	42	2.0
453	ref\|XM_740941.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	2.0
454	ref\|XM_666630.1\| Plasmodium berghei strain ANKA hypothetical pro...	42	2.0
455	ref\|XM_669806.1\| Plasmodium berghei strain ANKA Casein kinase II...	42	2.0
456	ref\|XM_674206.1\| Plasmodium berghei strain ANKA hypothetical pro...	42	2.0
457	gb\|AC110169.7\| Mus musculus chromosome 9, clone RP23-233D3, comp...	42	2.0
458	gb\|AC110236.8\| Mus musculus chromosome 15, clone RP23-104L4, com...	42	2.0
459	gb\|AC165355.3\| Mus musculus BAC clone RP23-129P10 from chromosom...	42	2.0
460	gb\|AC122734.6\| Mus musculus chromosome 10, clone RP24-108E17, co...	42	2.0
461	ref\|XM_662055.1\| Cryptosporidium hominis TU502 regulator of chro...	42	2.0
462	ref\|XM_660416.1\| Cryptosporidium hominis TU502 KIAA1453 protein ...	42	2.0
463	ref\|XM_662188.1\| Cryptosporidium hominis TU502 hypothetical prot...	42	2.0
464	gb\|AC160106.2\| Mus musculus BAC clone RP24-300H23 from chromosom...	42	2.0
465	gb\|AC113299.14\| Mus musculus chromosome 5, clone RP23-429P17, co...	42	2.0
466	gb\|AC164570.3\| Mus musculus BAC clone CH25-194I22 from chromosom...	42	2.0
467	gb\|AC137677.24\| Mus musculus chromosome 1, clone RP23-257D12, co...	42	2.0
468	gb\|AC138270.12\| Mus musculus chromosome 7, clone RP23-323F17, co...	42	2.0
469	gb\|AC141922.19\| Medicago truncatula clone mth2-9n11, complete se...	42	2.0
470	gb\|AC144931.29\| Medicago truncatula clone mth2-22b18, complete s...	42	2.0
471	gb\|AC161876.3\| Mus musculus BAC clone RP24-388H6 from chromosome...	42	2.0
472	gb\|AC156564.3\| Mus musculus BAC clone RP24-81G20 from chromosome...	42	2.0
473	gb\|AC102934.11\| Mus musculus chromosome 3, clone RP24-209C11, co...	42	2.0
474	gb\|AC116794.11\| Mus musculus chromosome 5, clone RP24-312A3, com...	42	2.0
475	gb\|AC159619.2\| Mus musculus BAC clone RP24-392J3 from chromosome...	42	2.0
476	gb\|AC095491.7\| Rattus norvegicus 4 BAC CH230-7L13 (Children's Ho...	42	2.0
477	gb\|AC095563.7\| Rattus norvegicus 9 BAC CH230-7G11 (Children's Ho...	42	2.0
478	gb\|AC103574.7\| Rattus norvegicus 1 BAC CH230-205C19 (Children's ...	42	2.0
479	gb\|AC108554.8\| Rattus norvegicus 7 BAC CH230-81L13 (Children's H...	42	2.0
480	gb\|AC118351.14\| Rattus norvegicus 1 BAC CH230-362O18 (Children's...	42	2.0
481	gb\|AC087871.9\| Genomic sequence for Mus musculus, clone RP23-334...	42	2.0
482	emb\|AL590434.16\| Human DNA sequence from clone RP11-181E22 on ch...	42	2.0
483	ref\|XM_502214.1\| Yarrowia lipolytica CLIB122, YALI0C24189g predi...	42	2.0
484	emb\|AL365274.17\| Human DNA sequence from clone RP11-298A17 on ch...	42	2.0
485	emb\|AL359979.10\| Human DNA sequence from clone RP11-239E10 on ch...	42	2.0
486	emb\|AL391316.7\| Human DNA sequence from clone XX-YM901F10 on chr...	42	2.0
487	emb\|AL356786.36\| Human DNA sequence from clone RP3-520E18 on chr...	42	2.0
488	emb\|AL356967.23\| Human DNA sequence from clone RP11-427E4 on chr...	42	2.0
489	emb\|AL355852.23\| Human DNA sequence from clone RP11-403E24 on ch...	42	2.0
490	emb\|AL356414.11\| Human DNA sequence from clone RP11-352D3 on chr...	42	2.0
491	emb\|AL162377.10\| Human DNA sequence from clone RP11-327P2 on chr...	42	2.0
492	emb\|AL161730.9\| Human DNA sequence from clone RP11-441I5 on chro...	42	2.0
493	emb\|AL139321.28\| Human DNA sequence from clone RP11-185C18 on ch...	42	2.0
494	emb\|AL139136.17\| Human DNA sequence from clone RP11-53I24 on chr...	42	2.0
495	emb\|AL157936.12\| Human DNA sequence from clone RP11-279I21 on ch...	42	2.0
496	emb\|AL139421.12\| Human DNA sequence from clone RP4-717I23 on chr...	42	2.0
497	gb\|AC094014.3\| Papio anubis clone RP41-371B12, complete sequence	42	2.0
498	emb\|AL139184.8\| Human DNA sequence from clone RP11-71C5 on chrom...	42	2.0
499	gb\|AC091752.2\| Rattus norvegicus strain Brown Norway clone RP31-...	42	2.0
500	gb\|AC027740.11\| Mus musculus, clone RP23-57M1, complete sequence	42	2.0

>gb|AC170188.2| Mus musculus BAC clone RP24-195M20 from chromosome 13, complete sequence
          Length = 165687

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 541    ctcttcttcctcttcttcctcatcc 565
              |||||||||||||||||||||||||
Sbjct: 135184 ctcttcttcctcttcttcctcatcc 135208

to top

>gb|AC119900.7| Mus musculus chromosome 8, clone RP24-235K6, complete sequence
          Length = 174540

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 541    ctcttcttcctcttcttcctcatcc 565
              |||||||||||||||||||||||||
Sbjct: 130971 ctcttcttcctcttcttcctcatcc 130947

to top

>gb|AC139381.4| Mus musculus BAC clone RP23-171D1 from 13, complete sequence
          Length = 242105

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 541    ctcttcttcctcttcttcctcatcc 565
              |||||||||||||||||||||||||
Sbjct: 136426 ctcttcttcctcttcttcctcatcc 136402

to top

>ref|XM_851441.1| PREDICTED: Canis familiaris similar to General transcription factor
           3C polypeptide 3 (Transcription factor IIIC-gamma
           subunit) (TF3C-gamma) (TFIIIC 102 kDa subunit)
           (TFIIIC102), transcript variant 3 (LOC478851), mRNA
          Length = 2726

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 541 ctcttcttcctcttcttcctcatc 564
           ||||||||||||||||||||||||
Sbjct: 300 ctcttcttcctcttcttcctcatc 277

to top

>ref|XM_851398.1| PREDICTED: Canis familiaris similar to General transcription factor
           3C polypeptide 3 (Transcription factor IIIC-gamma
           subunit) (TF3C-gamma) (TFIIIC 102 kDa subunit)
           (TFIIIC102), transcript variant 2 (LOC478851), mRNA
          Length = 1286

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 541 ctcttcttcctcttcttcctcatc 564
           ||||||||||||||||||||||||
Sbjct: 359 ctcttcttcctcttcttcctcatc 336

to top

>ref|XM_536013.2| PREDICTED: Canis familiaris similar to General transcription factor
           3C polypeptide 3 (Transcription factor IIIC-gamma
           subunit) (TF3C-gamma) (TFIIIC 102 kDa subunit)
           (TFIIIC102), transcript variant 1 (LOC478851), mRNA
          Length = 3455

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 541 ctcttcttcctcttcttcctcatc 564
           ||||||||||||||||||||||||
Sbjct: 359 ctcttcttcctcttcttcctcatc 336

to top

>gb|AC124672.9| Mus musculus chromosome 1, clone RP23-328G14, complete sequence
          Length = 249008

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 542    tcttcttcctcttcttcctcatccactt 569
              |||||||||||||||||||| |||||||
Sbjct: 205088 tcttcttcctcttcttcctcttccactt 205115

to top

>ref|XM_758557.1| Theileria parva strain Muguga chromosome 4 hypothetical protein
           (TP04_0015) partial mRNA
          Length = 1527

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 537 atggctcttcttcctcttcttcctcatc 564
           |||||| |||||||||||||||||||||
Sbjct: 913 atggcttttcttcctcttcttcctcatc 886

to top

>gb|AC143341.8| Medicago truncatula clone mth2-7a11, complete sequence
          Length = 111446

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 541   ctcttcttcctcttcttcctcatc 564
             ||||||||||||||||||||||||
Sbjct: 21288 ctcttcttcctcttcttcctcatc 21311

to top

>ref|XM_970187.1| PREDICTED: Tribolium castaneum similar to CG9650-PB, isoform B
            (LOC664174), mRNA
          Length = 2496

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 542  tcttcttcctcttcttcctcatccactt 569
            ||||||||||||||||| ||||||||||
Sbjct: 1688 tcttcttcctcttcttcttcatccactt 1661

to top

>gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, complete sequence
          Length = 111912

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 541   ctcttcttcctcttcttcctcatc 564
             ||||||||||||||||||||||||
Sbjct: 49952 ctcttcttcctcttcttcctcatc 49929



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 49961 ctcttcttcctcttcttcctc 49941

to top

>gb|AC140442.4| Mus musculus BAC clone RP24-106P1 from 12, complete sequence
          Length = 153574

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 542   tcttcttcctcttcttcctcatcc 565
             ||||||||||||||||||||||||
Sbjct: 25518 tcttcttcctcttcttcctcatcc 25541



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 27680 ctcttcttcctcttcttcctc 27700



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 27672 tcttcttcctcttcttcctc 27691

to top

>gb|AC163040.5| Mus musculus BAC clone RP23-71C23 from chromosome 12, complete sequence
          Length = 235086

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 542    tcttcttcctcttcttcctcatcc 565
              ||||||||||||||||||||||||
Sbjct: 194315 tcttcttcctcttcttcctcatcc 194338



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 196477 ctcttcttcctcttcttcctc 196497



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 196469 tcttcttcctcttcttcctc 196488

to top

>emb|AL611936.11| Mouse DNA sequence from clone RP23-40G2 on chromosome 4, complete
              sequence
          Length = 166167

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 542    tcttcttcctcttcttcctcatcc 565
              ||||||||||||||||||||||||
Sbjct: 115907 tcttcttcctcttcttcctcatcc 115930

to top

>ref|XM_639032.1| Dictyostelium discoideum hypothetical protein (DDB0167703), partial
            mRNA
          Length = 3579

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 542  tcttcttcctcttcttcctcatc 564
            |||||||||||||||||||||||
Sbjct: 1433 tcttcttcctcttcttcctcatc 1411

to top

>ref|XM_511295.1| PREDICTED: Pan troglodytes similar to KIAA0909 protein (LOC454458),
            mRNA
          Length = 5262

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 542  tcttcttcctcttcttcctcatc 564
            |||||||||||||||||||||||
Sbjct: 1642 tcttcttcctcttcttcctcatc 1664

to top

>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence
          Length = 218917

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 541    ctcttcttcctcttcttcctcatccactttc 571
              ||||||||||||||||||||| ||| |||||
Sbjct: 112883 ctcttcttcctcttcttcctcttcctctttc 112853

to top

>gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, complete sequence
          Length = 203655

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 541 ctcttcttcctcttcttcctcatccactttc 571
           ||||||||||||||||||||| ||| |||||
Sbjct: 618 ctcttcttcctcttcttcctcttcctctttc 648

to top

>gb|AC137104.11| Mus musculus chromosome 1, clone RP23-241K20, complete sequence
          Length = 171622

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 543   cttcttcctcttcttcctcatcc 565
             |||||||||||||||||||||||
Sbjct: 13568 cttcttcctcttcttcctcatcc 13546

to top

>gb|AC124110.8| Mus musculus chromosome 1, clone RP24-343C13, complete sequence
          Length = 149487

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 543    cttcttcctcttcttcctcatcc 565
              |||||||||||||||||||||||
Sbjct: 119608 cttcttcctcttcttcctcatcc 119586

to top

>ref|XM_607664.2| PREDICTED: Bos taurus similar to retrotransposon gag domain
            containing 4 (LOC529223), mRNA
          Length = 1794

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 543  cttcttcctcttcttcctcatcc 565
            |||||||||||||||||||||||
Sbjct: 1356 cttcttcctcttcttcctcatcc 1334

to top

>ref|XM_603144.2| PREDICTED: Bos taurus similar to a disintegrin and metalloproteinase
            domain 1a (LOC613291), partial mRNA
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 541  ctcttcttcctcttcttcctcatccac 567
            ||||||||||||||||||||| |||||
Sbjct: 1003 ctcttcttcctcttcttcctcttccac 977



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 1021 ctcttcttcctcttcttcctc 1001



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 1012 ctcttcttcctcttcttcctc 992

to top

>ref|XM_959652.1| Neurospora crassa OR74A hypothetical protein (NCU00919.1) partial
            mRNA
          Length = 2346

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 541  ctcttcttcctcttcttcctcatccactttcataa 575
            |||||||||||||||||| ||||| | ||||||||
Sbjct: 1095 ctcttcttcctcttcttcttcatcgattttcataa 1061

to top

>ref|XM_325098.1| Neurospora crassa OR74A hypothetical protein (NCU00919.1) partial
            mRNA
          Length = 2346

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 541  ctcttcttcctcttcttcctcatccactttcataa 575
            |||||||||||||||||| ||||| | ||||||||
Sbjct: 1095 ctcttcttcctcttcttcttcatcgattttcataa 1061

to top

>ref|XM_451914.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B08679g predicted mRNA
          Length = 1092

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 542 tcttcttcctcttcttcctcatccact 568
           |||||||| ||||||||||||||||||
Sbjct: 818 tcttcttcttcttcttcctcatccact 792

to top

>ref|XR_002740.1| PREDICTED: Mus musculus hypothetical protein LOC669992 (LOC669992),
           mRNA
          Length = 896

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 542 tcttcttcctcttcttcctcatc 564
           |||||||||||||||||||||||
Sbjct: 571 tcttcttcctcttcttcctcatc 549

to top

>ref|XM_907057.2| PREDICTED: Mus musculus similar to High mobility group protein 1
           (HMG-1) (High mobility group protein B1) (Amphoterin)
           (Heparin-binding protein p30) (LOC432959), mRNA
          Length = 748

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 542 tcttcttcctcttcttcctcatc 564
           |||||||||||||||||||||||
Sbjct: 717 tcttcttcctcttcttcctcatc 695

to top

>ref|XM_484474.3| PREDICTED: Mus musculus similar to High mobility group protein 1
           (HMG-1) (High mobility group protein B1) (Amphoterin)
           (Heparin-binding protein p30) (LOC432959), mRNA
          Length = 748

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 542 tcttcttcctcttcttcctcatc 564
           |||||||||||||||||||||||
Sbjct: 717 tcttcttcctcttcttcctcatc 695

to top

>ref|XM_857646.1| PREDICTED: Canis familiaris similar to PGC-1 related co-activator,
            transcript variant 2 (LOC477805), mRNA
          Length = 4914

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 542  tcttcttcctcttcttcctcatc 564
            |||||||||||||||||||||||
Sbjct: 4093 tcttcttcctcttcttcctcatc 4115

to top

>ref|XM_534998.2| PREDICTED: Canis familiaris similar to PGC-1 related co-activator,
            transcript variant 1 (LOC477805), mRNA
          Length = 5283

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 542  tcttcttcctcttcttcctcatc 564
            |||||||||||||||||||||||
Sbjct: 4456 tcttcttcctcttcttcctcatc 4478

to top

>emb|CT009568.8| M.truncatula DNA sequence from clone MTH2-95K22 on chromosome 3,
             complete sequence
          Length = 121926

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 543   cttcttcctcttcttcctcatccactttcat 573
             ||||||| || ||||||||||||||||||||
Sbjct: 38433 cttcttcatcatcttcctcatccactttcat 38403

to top

>ref|XM_389409.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09233.1)
            partial mRNA
          Length = 4731

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 539  ggctcttcttcctcttcttcctcatcc 565
            ||||| |||||||||||||||||||||
Sbjct: 1058 ggctcctcttcctcttcttcctcatcc 1032

to top

>gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, complete sequence
          Length = 193390

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 542   tcttcttcctcttcttcctcatc 564
             |||||||||||||||||||||||
Sbjct: 55124 tcttcttcctcttcttcctcatc 55146



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100485 ctcttcttcctcttcttcctc 100505



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100476 ctcttcttcctcttcttcctc 100496



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100467 ctcttcttcctcttcttcctc 100487



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100458 ctcttcttcctcttcttcctc 100478



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100413 ctcttcttcctcttcttcctc 100433



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100404 ctcttcttcctcttcttcctc 100424



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100395 ctcttcttcctcttcttcctc 100415



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100386 ctcttcttcctcttcttcctc 100406



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100377 ctcttcttcctcttcttcctc 100397



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100368 ctcttcttcctcttcttcctc 100388



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 100359 ctcttcttcctcttcttcctc 100379



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 100351 tcttcttcctcttcttcctc 100370

to top

>gb|AC154291.2| Mus musculus BAC clone RP23-447B21 from chromosome 17, complete sequence
          Length = 178703

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 543    cttcttcctcttcttcctcatccactt 569
              |||||||||| ||||||||||||||||
Sbjct: 128680 cttcttcctcctcttcctcatccactt 128706



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 542    tcttcttcctcttcttcctcatccactt 569
              ||||||||||| |||||||||| |||||
Sbjct: 128742 tcttcttcctcctcttcctcattcactt 128769

to top

>emb|AL049749.2|HS293L6 Human DNA sequence from clone RP1-293L6 on chromosome 22 Contains the
             first exon of the CACNG2 gene for voltage-dependent
             calcium channel gamma subunit 2, ESTs, STSs, GSSs and a
             putative CpG island, complete sequence
          Length = 99497

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 541   ctcttcttcctcttcttcctcat 563
             |||||||||||||||||||||||
Sbjct: 52750 ctcttcttcctcttcttcctcat 52772

to top

>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1320834

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 542    tcttcttcctcttcttcctcatccact 568
              |||||||| ||||||||||||||||||
Sbjct: 768625 tcttcttcttcttcttcctcatccact 768599

to top

>emb|BX842682.1| Neurospora crassa DNA linkage group I BAC contig B13C5
          Length = 116467

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 541  ctcttcttcctcttcttcctcatccactttcataa 575
            |||||||||||||||||| ||||| | ||||||||
Sbjct: 1254 ctcttcttcctcttcttcttcatcgattttcataa 1220

to top

>emb|BX842638.1| Neurospora crassa DNA linkage group I cosmid contig G17B7
          Length = 60687

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 541   ctcttcttcctcttcttcctcatccactttcataa 575
             |||||||||||||||||| ||||| | ||||||||
Sbjct: 53268 ctcttcttcctcttcttcttcatcgattttcataa 53234

to top

>gb|AC151294.3| Mus musculus BAC clone RP23-137I7 from chromosome 17, complete sequence
          Length = 206868

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 543   cttcttcctcttcttcctcatccactt 569
             |||||||||| ||||||||||||||||
Sbjct: 10009 cttcttcctcctcttcctcatccactt 10035



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 542   tcttcttcctcttcttcctcatccactt 569
             ||||||||||| |||||||||| |||||
Sbjct: 10071 tcttcttcctcctcttcctcattcactt 10098

to top

>gb|AF015725.3| Homo sapiens chromosome 21 clone cosmid clone D68F9 map 21q22.2,
             complete sequence
          Length = 30577

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 542   tcttcttcctcttcttcctcatc 564
             |||||||||||||||||||||||
Sbjct: 22354 tcttcttcctcttcttcctcatc 22332

to top

>gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067-2090751 strain AX4,
              complete sequence
          Length = 405682

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 542    tcttcttcctcttcttcctcatc 564
              |||||||||||||||||||||||
Sbjct: 255226 tcttcttcctcttcttcctcatc 255204

to top

>dbj|BS000197.1| Pan troglodytes chromosome 22 clone:PTB-108M20, map 22, complete
             sequences
          Length = 192863

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 542   tcttcttcctcttcttcctcatc 564
             |||||||||||||||||||||||
Sbjct: 83350 tcttcttcctcttcttcctcatc 83328

to top

>emb|AJ229042.1|HS229042 Homo sapiens 959 kb contig between AML1 and CBR1 on chromosome 21q22,
             segment 2/3
          Length = 348050

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 542   tcttcttcctcttcttcctcatc 564
             |||||||||||||||||||||||
Sbjct: 62151 tcttcttcctcttcttcctcatc 62173

to top

>emb|AL163268.2|HS21C068 Homo sapiens chromosome 21 segment HS21C068
          Length = 340000

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 542    tcttcttcctcttcttcctcatc 564
              |||||||||||||||||||||||
Sbjct: 136926 tcttcttcctcttcttcctcatc 136904

to top

>dbj|AP006245.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-139F9, complete
             sequence
          Length = 155586

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 299   tctctatccccccttcccttcccttcc 325
             ||||| |||||||||||||||||||||
Sbjct: 64222 tctctttccccccttcccttcccttcc 64196



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 95644 tcttcttcctcttcttcctc 95663

to top

>gb|AF086807.1|AF086807 Bos taurus fertilin alpha (ADAM 1) mRNA, partial cds
          Length = 2439

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 541  ctcttcttcctcttcttcctcatccac 567
            ||||||||||||||||||||| |||||
Sbjct: 2412 ctcttcttcctcttcttcctcttccac 2386



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 2421 ctcttcttcctcttcttcctc 2401

to top

>emb|BX284660.1| Human DNA sequence from clone RP1-293L6 on chromosome 22, complete
             sequence
          Length = 70881

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 541   ctcttcttcctcttcttcctcat 563
             |||||||||||||||||||||||
Sbjct: 45283 ctcttcttcctcttcttcctcat 45261

to top

>emb|AL929060.7| Mouse DNA sequence from clone RP23-17F8 on chromosome 2, complete
              sequence
          Length = 170200

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 545    tcttcctcttcttcctcatccactttc 571
              ||||||||||||||||||||| |||||
Sbjct: 116564 tcttcctcttcttcctcatcctctttc 116590

to top

>emb|AL627087.11| Mouse DNA sequence from clone RP23-243K17 on chromosome 4, complete
              sequence
          Length = 179705

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 541    ctcttcttcctcttcttcctcatccactttcataa 575
              ||||||||||||||| ||||| ||| |||||||||
Sbjct: 139566 ctcttcttcctcttcctcctcctcctctttcataa 139532

to top

>gb|AC159470.17| Mus musculus 10 BAC RP24-462C5 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 175513

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 542  tcttcttcctcttcttcctcatc 564
            |||||||||||||||||||||||
Sbjct: 2293 tcttcttcctcttcttcctcatc 2271

to top

>gb|AC167231.12| Mus musculus  BAC RP23-416P12 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 205781

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 542   tcttcttcctcttcttcctcatc 564
             |||||||||||||||||||||||
Sbjct: 87922 tcttcttcctcttcttcctcatc 87900

to top

>dbj|AP000079.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region,
             section 15/19, complete sequence
          Length = 100000

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 299   tctctatccccccttcccttcccttcc 325
             ||||| |||||||||||||||||||||
Sbjct: 91077 tctctttccccccttcccttcccttcc 91103



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 59646 tcttcttcctcttcttcctc 59627

to top

>ref|NM_114344.2| Arabidopsis thaliana HD2A (HISTONE DEACETYLASE 2A); nucleic acid
           binding / zinc ion binding AT3G44750 (HD2A) mRNA,
           complete cds
          Length = 961

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 392 ctcttcttcctcttcttcctca 371

to top

>ref|NM_119526.2| Arabidopsis thaliana AGD2 (ABERRANT GROWTH AND DEATH 2);
           transaminase AT4G33680 (AGD2) mRNA, complete cds
          Length = 1587

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 550 ctcttcttcctcatccactttc 571
           ||||||||||||||||||||||
Sbjct: 84  ctcttcttcctcatccactttc 105

to top

>ref|NM_121431.2| Arabidopsis thaliana DNA binding AT5G14270 mRNA, complete cds
          Length = 2896

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 546  cttcctcttcttcctcatccactttcataaacagtccaagct 587
            ||||||| || ||||||||   ||||||||||||||||||||
Sbjct: 2449 cttcctcctcatcctcatcttgtttcataaacagtccaagct 2408

to top

>ref|NM_104710.3| Arabidopsis thaliana nucleic acid binding AT1G60200 mRNA, complete
            cds
          Length = 2747

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 542  tcttcttcctcttcttcctcat 563
            ||||||||||||||||||||||
Sbjct: 1612 tcttcttcctcttcttcctcat 1591

to top

>ref|NM_125003.1| Arabidopsis thaliana nucleic acid binding / transcription factor/
           zinc ion binding AT5G56200 mRNA, complete cds
          Length = 1482

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 548 tcctcttcttcctcatccactt 569
           ||||||||||||||||||||||
Sbjct: 492 tcctcttcttcctcatccactt 513

to top

>ref|XM_507492.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1791_B03.42-1
            mRNA
          Length = 3100

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                     
Query: 1    cttcctcgactacatnanaaatttgaatttacagcaggaag 41
            ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 3003 cttcctccactacatca-aaattcgaatttacagcaggaag 2964



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 542  tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
            |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 2492 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 2447

to top

>ref|XM_506853.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1791_B03.42-1
            mRNA
          Length = 3189

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                     
Query: 1    cttcctcgactacatnanaaatttgaatttacagcaggaag 41
            ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 3004 cttcctccactacatca-aaattcgaatttacagcaggaag 2965



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 542  tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
            |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 2493 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 2448

to top

>ref|XM_466588.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2915

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                     
Query: 1    cttcctcgactacatnanaaatttgaatttacagcaggaag 41
            ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 2730 cttcctccactacatca-aaattcgaatttacagcaggaag 2691



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 542  tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
            |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 2219 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 2174

to top

>ref|XM_518336.1| PREDICTED: Pan troglodytes similar to RNA helicase (LOC462546),
           mRNA
          Length = 3120

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 429 ctcttcttcctcttcttcctca 408

to top

>gb|AC167168.5| Mus musculus chromosome 1, clone RP23-100P14, complete sequence
          Length = 204256

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 542    tcttcttcctcttcttcctcat 563
              ||||||||||||||||||||||
Sbjct: 153623 tcttcttcctcttcttcctcat 153602

to top

>ref|XM_513839.1| PREDICTED: Pan troglodytes LOC457347 (LOC457347), mRNA
          Length = 964

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 543 cttcttcctcttcttcctcatc 564
           ||||||||||||||||||||||
Sbjct: 244 cttcttcctcttcttcctcatc 223

to top

>gb|AC135957.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0037P02 map E61794SA, complete sequence
          Length = 131645

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 541   ctcttcttcctcttcttcctca 562
             ||||||||||||||||||||||
Sbjct: 88713 ctcttcttcctcttcttcctca 88734



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 88704 ctcttcttcctcttcttcctc 88724

to top

>gb|AC093351.8| Mus musculus chromosome 7, clone RP23-16L19, complete sequence
          Length = 239688

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 541    ctcttcttcctcttcttcctcatccacttt 570
              |||||| |||||||||||||||||| ||||
Sbjct: 125286 ctcttcctcctcttcttcctcatcctcttt 125315

to top

>ref|NM_010414.1| Mus musculus Huntington disease gene homolog (Hdh), mRNA
          Length = 10081

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 544  ttcttcctcttcttcctcatcc 565
            ||||||||||||||||||||||
Sbjct: 8030 ttcttcctcttcttcctcatcc 8009

to top

>gb|BC070620.1| Xenopus laevis hypothetical protein MGC81381, mRNA (cDNA clone
            MGC:81381 IMAGE:6634514), complete cds
          Length = 2362

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 545  tcttcctcttcttcctcatcca 566
            ||||||||||||||||||||||
Sbjct: 1179 tcttcctcttcttcctcatcca 1158

to top

>ref|NM_145025.2| Homo sapiens chromosome 6 open reading frame 199 (C6orf199), mRNA
          Length = 2584

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 540 gctcttcttcctcttcttcctc 561
           ||||||||||||||||||||||
Sbjct: 698 gctcttcttcctcttcttcctc 677

to top

>gb|AY518701.1| Arabidopsis thaliana aminotransferase AGD2 mRNA, complete cds
          Length = 1386

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 550 ctcttcttcctcatccactttc 571
           ||||||||||||||||||||||
Sbjct: 36  ctcttcttcctcatccactttc 57

to top

>gb|DQ484035.1| Gymnogyps californianus clone 201G microsatellite sequence
          Length = 1186

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 540 gctcttcttcctcttcttcctc 561
           ||||||||||||||||||||||
Sbjct: 120 gctcttcttcctcttcttcctc 141

to top

>ref|XM_883510.1| Leishmania major strain Friedlin hypothetical protein (L7610.06)
            partial mRNA
          Length = 1800

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 540  gctcttcttcctcttcttcctc 561
            ||||||||||||||||||||||
Sbjct: 1432 gctcttcttcctcttcttcctc 1411

to top

>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end
          Length = 247462

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 540    gctcttcttcctcttcttcctc 561
              ||||||||||||||||||||||
Sbjct: 137230 gctcttcttcctcttcttcctc 137251

to top

>ref|XM_384733.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG04557.1)
           partial mRNA
          Length = 927

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 222 ctcttcttcctcttcttcctca 201

to top

>gb|AC127552.3| Mus musculus BAC clone RP24-550N13 from chromosome 3, complete sequence
          Length = 156534

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 540   gctcttcttcctcttcttcctcatcc 565
             |||||||||||||||| |||||||||
Sbjct: 38825 gctcttcttcctcttcctcctcatcc 38800

to top

>gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome 5, complete sequence
          Length = 224181

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 544   ttcttcctcttcttcctcatcc 565
             ||||||||||||||||||||||
Sbjct: 54597 ttcttcctcttcttcctcatcc 54618

to top

>ref|XM_807307.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053510517.50) partial mRNA
          Length = 3366

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 546  cttcctcttcttcctcatccac 567
            ||||||||||||||||||||||
Sbjct: 2621 cttcctcttcttcctcatccac 2642

to top

>gb|AC124370.3| Mus musculus BAC clone RP24-554F1 from chromosome 3, complete sequence
          Length = 181208

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 544   ttcttcctcttcttcctcatcc 565
             ||||||||||||||||||||||
Sbjct: 22062 ttcttcctcttcttcctcatcc 22083

to top

>ref|XM_803723.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053507851.10) partial mRNA
          Length = 2081

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 546  cttcctcttcttcctcatccac 567
            ||||||||||||||||||||||
Sbjct: 1336 cttcctcttcttcctcatccac 1357

to top

>gb|AC121579.3| Mus musculus BAC clone RP23-255H8 from 3, complete sequence
          Length = 184377

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 544    ttcttcctcttcttcctcatcc 565
              ||||||||||||||||||||||
Sbjct: 149069 ttcttcctcttcttcctcatcc 149090

to top

>gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete sequence
          Length = 206570

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 544    ttcttcctcttcttcctcatcc 565
              ||||||||||||||||||||||
Sbjct: 107308 ttcttcctcttcttcctcatcc 107287

to top

>ref|XM_547544.2| PREDICTED: Canis familiaris similar to Dingo protein isoform 1
            (LOC490422), mRNA
          Length = 6681

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 541  ctcttcttcctcttcttcctca 562
            ||||||||||||||||||||||
Sbjct: 4548 ctcttcttcctcttcttcctca 4527

to top

>emb|CR699252.2|CNS0G2HS Tetraodon nigroviridis full-length cDNA
          Length = 1104

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 343 ctcttcttcctcttcttcctca 322

to top

>emb|CR696851.2|CNS0G0N3 Tetraodon nigroviridis full-length cDNA
          Length = 1096

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 341 ctcttcttcctcttcttcctca 320

to top

>emb|CR690011.2|CNS0FVD3 Tetraodon nigroviridis full-length cDNA
          Length = 1097

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 336 ctcttcttcctcttcttcctca 315

to top

>emb|CR676980.2|CNS0FLBK Tetraodon nigroviridis full-length cDNA
          Length = 620

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 43  ctcttcttcctcttcttcctca 22

to top

>gb|AC004917.2| Homo sapiens PAC clone RP5-892G19 from 7, complete sequence
          Length = 110233

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 541   ctcttcttcctcttcttcctca 562
             ||||||||||||||||||||||
Sbjct: 32186 ctcttcttcctcttcttcctca 32165

to top

>emb|CR665950.2|CNS0FCTG Tetraodon nigroviridis full-length cDNA
          Length = 884

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 119 ctcttcttcctcttcttcctca 98

to top

>ref|NM_012749.1| Rattus norvegicus nucleolin (Ncl), mRNA
          Length = 2142

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 544 ttcttcctcttcttcctcatcc 565
           ||||||||||||||||||||||
Sbjct: 825 ttcttcctcttcttcctcatcc 804

to top

>emb|AL512640.9| Human DNA sequence from clone RP11-219K22 on chromosome 10, complete
             sequence
          Length = 96322

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 543   cttcttcctcttcttcctcatc 564
             ||||||||||||||||||||||
Sbjct: 32969 cttcttcctcttcttcctcatc 32990

to top

>emb|AL355989.11| Human DNA sequence from clone RP11-272J7 on chromosome 10 Contains a
             transcription elongation factor B (SIII) pseudogene, a
             novel gene, a heterogeneous nuclear ribonucleoprotein A3
             (HNRPA3) pseudogene gene and a CpG island, complete
             sequence
          Length = 161451

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 542   tcttcttcctcttcttcctcat 563
             ||||||||||||||||||||||
Sbjct: 53471 tcttcttcctcttcttcctcat 53450

to top

>emb|AL121788.17|HSDJ70A9 Human DNA sequence from clone RP1-70A9 on chromosome 6q16.3-22.1 Contains
              the gene for a novel protein (FLJ30976), complete sequence
          Length = 135079

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 540    gctcttcttcctcttcttcctc 561
              ||||||||||||||||||||||
Sbjct: 121625 gctcttcttcctcttcttcctc 121646

to top

>gb|AY117246.1| Arabidopsis thaliana unknown protein (At4g33680) mRNA, complete cds
          Length = 1417

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 550 ctcttcttcctcatccactttc 571
           ||||||||||||||||||||||
Sbjct: 36  ctcttcttcctcatccactttc 57

to top

>gb|AY096729.1| Arabidopsis thaliana putative histone deacetylase (At3g44750) mRNA,
           complete cds
          Length = 769

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 330 ctcttcttcctcttcttcctca 309

to top

>gb|AY074284.1| Arabidopsis thaliana unknown protein (At1g60210) mRNA, complete cds
          Length = 2893

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 542  tcttcttcctcttcttcctcat 563
            ||||||||||||||||||||||
Sbjct: 1593 tcttcttcctcttcttcctcat 1572

to top

>gb|AY065396.1| Arabidopsis thaliana putative histone deacetylase (At3g44750) mRNA,
           complete cds
          Length = 977

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 392 ctcttcttcctcttcttcctca 371

to top

>gb|AY065256.1| Arabidopsis thaliana unknown protein (At4g33680) mRNA, complete cds
          Length = 1562

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 550 ctcttcttcctcatccactttc 571
           ||||||||||||||||||||||
Sbjct: 81  ctcttcttcctcatccactttc 102

to top

>gb|AY059785.1| Arabidopsis thaliana putative kinase (At5g14270) mRNA, complete cds
          Length = 2880

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 546  cttcctcttcttcctcatccactttcataaacagtccaagct 587
            ||||||| || ||||||||   ||||||||||||||||||||
Sbjct: 2417 cttcctcctcatcctcatcttgtttcataaacagtccaagct 2376

to top

>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence
          Length = 992211

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 536   catggctcttcttcctcttcttcctc 561
             |||| |||||||||||||||||||||
Sbjct: 88371 catgcctcttcttcctcttcttcctc 88346

to top

>ref|NM_001016482.2| Xenopus tropicalis tubby like protein 1 (tulp1), mRNA
          Length = 1822

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 542 tcttcttcctcttcttcctcat 563
           ||||||||||||||||||||||
Sbjct: 749 tcttcttcctcttcttcctcat 728

to top

>gb|BC022031.2| Homo sapiens chromosome 6 open reading frame 199, mRNA (cDNA clone
           MGC:26954 IMAGE:4822343), complete cds
          Length = 2584

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 540 gctcttcttcctcttcttcctc 561
           ||||||||||||||||||||||
Sbjct: 698 gctcttcttcctcttcttcctc 677

to top

>emb|AL163817.1|ATF18O22 Arabidopsis thaliana DNA chromosome 5, BAC clone F18O22 (ESSA project)
          Length = 100269

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 546   cttcctcttcttcctcatccactttcataaacagtccaagct 587
             ||||||| || ||||||||   ||||||||||||||||||||
Sbjct: 27208 cttcctcctcatcctcatcttgtttcataaacagtccaagct 27167

to top

>emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 80
          Length = 192861

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 550  ctcttcttcctcatccactttc 571
            ||||||||||||||||||||||
Sbjct: 8149 ctcttcttcctcatccactttc 8128

to top

>emb|AL031394.1|ATT16L1 Arabidopsis thaliana DNA chromosome 4, BAC clone T16L1 (ESSAII project)
          Length = 98124

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 550   ctcttcttcctcatccactttc 571
             ||||||||||||||||||||||
Sbjct: 55367 ctcttcttcctcatccactttc 55346

to top

>gb|BC085751.1| Rattus norvegicus nucleolin, mRNA (cDNA clone MGC:93572
           IMAGE:7109097), complete cds
          Length = 2501

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 544 ttcttcctcttcttcctcatcc 565
           ||||||||||||||||||||||
Sbjct: 954 ttcttcctcttcttcctcatcc 933

to top

>emb|CR858094.1| Pongo pygmaeus mRNA; cDNA DKFZp459L1130 (from clone DKFZp459L1130)
          Length = 3477

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 583 ctcttcttcctcttcttcctca 562

to top

>dbj|AB210152.1| Pan troglodytes DDX16 gene for DEAD/H (Asp-Glu-Ala-Asp/His) box
            polypeptide 16, complete cds, cell_line: Ericka
          Length = 21145

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 541  ctcttcttcctcttcttcctca 562
            ||||||||||||||||||||||
Sbjct: 2878 ctcttcttcctcttcttcctca 2857

to top

>dbj|AB210151.1| Pan troglodytes DDX16 gene for DEAD/H (Asp-Glu-Ala-Asp/His) box
            polypeptide 16, complete cds, cell_line: Borie
          Length = 21145

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 541  ctcttcttcctcttcttcctca 562
            ||||||||||||||||||||||
Sbjct: 2878 ctcttcttcctcttcttcctca 2857

to top

>dbj|AK092103.1| Homo sapiens cDNA FLJ34784 fis, clone NT2NE2004255
          Length = 2364

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 540  gctcttcttcctcttcttcctc 561
            ||||||||||||||||||||||
Sbjct: 1539 gctcttcttcctcttcttcctc 1518

to top

>dbj|AK055538.1| Homo sapiens cDNA FLJ30976 fis, clone HHDPC2000055, weakly similar
           to ADENYLATE KINASE, CHLOROPLAST (EC 2.7.4.3)
          Length = 2522

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 540 gctcttcttcctcttcttcctc 561
           ||||||||||||||||||||||
Sbjct: 670 gctcttcttcctcttcttcctc 649

to top

>gb|AC069025.5| Homo sapiens chromosome 10 clone RP11-526G5, complete sequence
          Length = 211583

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 540    gctcttcttcctcttcttcctcatcc 565
              |||| |||||||||||||||||||||
Sbjct: 194711 gctcctcttcctcttcttcctcatcc 194736

to top

>gb|AF195545.1| Arabidopsis thaliana putative histone deacetylase (HD2A) mRNA,
           complete cds
          Length = 914

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 541 ctcttcttcctcttcttcctca 562
           ||||||||||||||||||||||
Sbjct: 378 ctcttcttcctcttcttcctca 357

to top

>dbj|AK161740.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
            library, clone:5830436C05 product:Huntington disease gene
            homolog, full insert sequence
          Length = 3977

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 544  ttcttcctcttcttcctcatcc 565
            ||||||||||||||||||||||
Sbjct: 2278 ttcttcctcttcttcctcatcc 2257

to top

>gb|AY056423.1| Arabidopsis thaliana AT4g33680/T16L1_170 mRNA, complete cds
          Length = 1589

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 550 ctcttcttcctcatccactttc 571
           ||||||||||||||||||||||
Sbjct: 87  ctcttcttcctcatccactttc 108

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 541     ctcttcttcctcttcttcctca 562
               ||||||||||||||||||||||
Sbjct: 9535530 ctcttcttcctcttcttcctca 9535551



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 541     ctcttcttcctcttcttcctc 561
               |||||||||||||||||||||
Sbjct: 9535521 ctcttcttcctcttcttcctc 9535541



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 545      tcttcctcttcttcctcatc 564
                ||||||||||||||||||||
Sbjct: 12996215 tcttcctcttcttcctcatc 12996196



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 545     tcttcctcttcttcctcatc 564
               ||||||||||||||||||||
Sbjct: 6690497 tcttcctcttcttcctcatc 6690516

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                              
Query: 542      tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
                |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 23569264 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 23569309



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                         
Query: 1        cttcctcgactacatnanaaatttgaatttacagcaggaag 41
                ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 23568753 cttcctccactacatca-aaattcgaatttacagcaggaag 23568792



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 538      tggctcttcttcctcttcttcctc 561
                ||||||||||||||| ||||||||
Sbjct: 35576066 tggctcttcttcctcctcttcctc 35576043



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 544      ttcttcctcttcttcctcat 563
                ||||||||||||||||||||
Sbjct: 27885852 ttcttcctcttcttcctcat 27885871

to top

>gb|AC091946.5| Homo sapiens chromosome 5 clone RP11-360I2, complete sequence
          Length = 199128

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 536   catggctcttcttcctcttctt 557
             ||||||||||||||||||||||
Sbjct: 53217 catggctcttcttcctcttctt 53196

to top

>ref|XM_217807.3| PREDICTED: Rattus norvegicus zinc finger protein 541 (predicted)
            (Znf541_predicted), mRNA
          Length = 5238

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 540  gctcttcttcctcttcttcctc 561
            ||||||||||||||||||||||
Sbjct: 5206 gctcttcttcctcttcttcctc 5185

to top

>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 541    ctcttcttcctcttcttcctca 562
              ||||||||||||||||||||||
Sbjct: 844750 ctcttcttcctcttcttcctca 844729

to top

>dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1791_B03
          Length = 166214

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 542    tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
              |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 134947 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 134992



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                       
Query: 1      cttcctcgactacatnanaaatttgaatttacagcaggaag 41
              ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 134436 cttcctccactacatca-aaattcgaatttacagcaggaag 134475

to top

>dbj|AP004124.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1669_F01
          Length = 140019

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 542   tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
             |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 10364 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 10409



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                     
Query: 1    cttcctcgactacatnanaaatttgaatttacagcaggaag 41
            ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 9853 cttcctccactacatca-aaattcgaatttacagcaggaag 9892

to top

>dbj|AB023029.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K24C1
          Length = 29498

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 548 tcctcttcttcctcatccactt 569
           ||||||||||||||||||||||
Sbjct: 546 tcctcttcttcctcatccactt 567

to top

>dbj|AK121891.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105C13, full
            insert sequence
          Length = 3190

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                     
Query: 1    cttcctcgactacatnanaaatttgaatttacagcaggaag 41
            ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 3005 cttcctccactacatca-aaattcgaatttacagcaggaag 2966



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 542  tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
            |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 2494 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 2449

to top

>dbj|AK101873.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033070G06, full
            insert sequence
          Length = 2915

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                     
Query: 1    cttcctcgactacatnanaaatttgaatttacagcaggaag 41
            ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 2730 cttcctccactacatca-aaattcgaatttacagcaggaag 2691



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 542  tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
            |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 2219 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 2174

to top

>dbj|AK099539.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013032G15, full
            insert sequence
          Length = 3101

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                     
Query: 1    cttcctcgactacatnanaaatttgaatttacagcaggaag 41
            ||||||| ||||||| | ||||| |||||||||||||||||
Sbjct: 3004 cttcctccactacatca-aaattcgaatttacagcaggaag 2965



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 542  tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
            |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 2493 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 2448

to top

>emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ia
          Length = 1923819

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 540     gctcttcttcctcttcttcctc 561
               ||||||||||||||||||||||
Sbjct: 1623743 gctcttcttcctcttcttcctc 1623722



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 541     ctcttcttcctcttcttcctc 561
               |||||||||||||||||||||
Sbjct: 1745799 ctcttcttcctcttcttcctc 1745779



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 541     ctcttcttcctcttcttcctc 561
               |||||||||||||||||||||
Sbjct: 1611598 ctcttcttcctcttcttcctc 1611578



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 997597 ctcttcttcctcttcttcctc 997577



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 945971 ctcttcttcctcttcttcctc 945991



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 542     tcttcttcctcttcttcctc 561
               ||||||||||||||||||||
Sbjct: 1611606 tcttcttcctcttcttcctc 1611587



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 542     tcttcttcctcttcttcctc 561
               ||||||||||||||||||||
Sbjct: 1610745 tcttcttcctcttcttcctc 1610726



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 539     ggctcttcttcctcttcttc 558
               ||||||||||||||||||||
Sbjct: 1564502 ggctcttcttcctcttcttc 1564483



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 997605 tcttcttcctcttcttcctc 997586



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 946020 tcttcttcctcttcttcctc 946039



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 612495 tcttcttcctcttcttcctc 612476



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 478863 tcttcttcctcttcttcctc 478882



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 478830 tcttcttcctcttcttcctc 478849



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 542    tcttcttcctcttcttcctcatccactt 569
              |||||||| ||||||||||| |||||||
Sbjct: 273706 tcttcttcgtcttcttcctcctccactt 273679

to top

>emb|CT574568.2| Pan troglodytes chromosome X clone PTB-081L12 map Xq28, complete sequence
          Length = 199100

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 543    cttcttcctcttcttcctcatc 564
              ||||||||||||||||||||||
Sbjct: 128765 cttcttcctcttcttcctcatc 128786

to top

>gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome 8, complete sequence
          Length = 249808

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 542    tcttcttcctcttcttcctcatccactttc 571
              |||||||||||||||||||| ||| |||||
Sbjct: 233524 tcttcttcctcttcttcctcttcctctttc 233495



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 189422 ctcttcttcctcttcttcctc 189402

to top

>emb|X00551.1|SCCR17 Yeast gene for subunit VI of ubiquinol-cytochrome c reductase (EC
           1.10.2.2)
          Length = 797

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 543 cttcttcctcttcttcctcatc 564
           ||||||||||||||||||||||
Sbjct: 329 cttcttcctcttcttcctcatc 308

to top

>emb|CR760884.2| Xenopus tropicalis finished cDNA, clone TTpA003j24
          Length = 1822

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 542 tcttcttcctcttcttcctcat 563
           ||||||||||||||||||||||
Sbjct: 749 tcttcttcctcttcttcctcat 728

to top

>emb|CR760273.2| Xenopus tropicalis finished cDNA, clone TNeu097k05
          Length = 2320

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 545  tcttcctcttcttcctcatcca 566
            ||||||||||||||||||||||
Sbjct: 1120 tcttcctcttcttcctcatcca 1099

to top

>gb|AC107689.7| Mus musculus chromosome 3, clone RP24-283F19, complete sequence
          Length = 168704

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 540    gctcttcttcctcttcttcctcatcc 565
              |||||||||||||||| |||||||||
Sbjct: 100189 gctcttcttcctcttcctcctcatcc 100164

to top

>dbj|AP000767.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-878E11, complete
             sequence
          Length = 190524

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 541   ctcttcttcctcttcttcctca 562
             ||||||||||||||||||||||
Sbjct: 56613 ctcttcttcctcttcttcctca 56592

to top

>gb|DQ332617.1| Synthetic construct Saccharomyces cerevisiae clone FLH144064.01X
           QCR6 gene, complete sequence
          Length = 444

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 543 cttcttcctcttcttcctcatc 564
           ||||||||||||||||||||||
Sbjct: 220 cttcttcctcttcttcctcatc 199

to top

>gb|DQ331645.1| Synthetic construct Saccharomyces cerevisiae clone FLH202681.01X
           UBP10 gene, complete sequence
          Length = 2379

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 540 gctcttcttcctcttcttcctc 561
           ||||||||||||||||||||||
Sbjct: 931 gctcttcttcctcttcttcctc 910

to top

>gb|BT001972.1| Arabidopsis thaliana clone U19063 unknown protein (At1g60210) mRNA,
            complete cds
          Length = 2731

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 542  tcttcttcctcttcttcctcat 563
            ||||||||||||||||||||||
Sbjct: 1565 tcttcttcctcttcttcctcat 1544

to top

>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 541     ctcttcttcctcttcttcctca 562
               ||||||||||||||||||||||
Sbjct: 1539979 ctcttcttcctcttcttcctca 1539958

to top

>gb|U24233.1|MMU24233 Mus musculus huntingtin (Hd) mRNA, complete cds
          Length = 10033

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 544  ttcttcctcttcttcctcatcc 565
            ||||||||||||||||||||||
Sbjct: 7990 ttcttcctcttcttcctcatcc 7969

to top

>gb|AE000512.1| Thermotoga maritima MSB8, complete genome
          Length = 1860725

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 542     tcttcttcctcttcttcctcat 563
               ||||||||||||||||||||||
Sbjct: 1268284 tcttcttcctcttcttcctcat 1268305



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 542    tcttcttcctcttcttcctca 562
              |||||||||||||||||||||
Sbjct: 862968 tcttcttcctcttcttcctca 862948

to top

>emb|AL832162.1|HSM803469 Homo sapiens mRNA; cDNA DKFZp686K0714 (from clone DKFZp686K0714)
          Length = 2585

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 540 gctcttcttcctcttcttcctc 561
           ||||||||||||||||||||||
Sbjct: 672 gctcttcttcctcttcttcctc 651

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 541     ctcttcttcctcttcttcctca 562
               ||||||||||||||||||||||
Sbjct: 9607227 ctcttcttcctcttcttcctca 9607248



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 541     ctcttcttcctcttcttcctc 561
               |||||||||||||||||||||
Sbjct: 9607218 ctcttcttcctcttcttcctc 9607238



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 545      tcttcctcttcttcctcatc 564
                ||||||||||||||||||||
Sbjct: 13076394 tcttcctcttcttcctcatc 13076375



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 545     tcttcctcttcttcctcatc 564
               ||||||||||||||||||||
Sbjct: 6756964 tcttcctcttcttcctcatc 6756983

to top

>gb|AC004473.1|T13D8 Arabidopsis thaliana chromosome 1 BAC T13D8, complete sequence
          Length = 116177

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 542   tcttcttcctcttcttcctcat 563
             ||||||||||||||||||||||
Sbjct: 42188 tcttcttcctcttcttcctcat 42209

to top

>emb|BX000983.15| Mouse DNA sequence from clone RP24-260C8 on chromosome 11, complete
            sequence
          Length = 29694

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 542  tcttcttcctcttcttcctcatccactttc 571
            |||||||||||||||||||| ||| |||||
Sbjct: 7045 tcttcttcctcttcttcctcctcctctttc 7074

to top

>gb|AC135085.3| Mus musculus BAC clone RP24-317P24 from 1, complete sequence
          Length = 214594

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 542    tcttcttcctcttcttcctcat 563
              ||||||||||||||||||||||
Sbjct: 194500 tcttcttcctcttcttcctcat 194521

to top

>gb|AC003051.1|AC003051 Homo sapiens chromosome 17, clone 289A8, complete sequence
          Length = 120387

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 541   ctcttcttcctcttcttcctca 562
             ||||||||||||||||||||||
Sbjct: 26066 ctcttcttcctcttcttcctca 26045

to top

>gb|L28827.1|MUSHDH Mouse Huntington's Disease gene homologue (Hdh) mRNA, complete cds
          Length = 9998

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 544  ttcttcctcttcttcctcatcc 565
            ||||||||||||||||||||||
Sbjct: 7949 ttcttcctcttcttcctcatcc 7928

to top

>gb|U40455.1|HSU40455 Human chromosome X cosmid, clones 196B12, 9H11 and 43H9, repeat units
             and sequence tagged sites
          Length = 106000

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 543   cttcttcctcttcttcctcatc 564
             ||||||||||||||||||||||
Sbjct: 86945 cttcttcctcttcttcctcatc 86924

to top

>gb|L23313.1|MUSHDPROB Mouse alternatively spliced HD protein mRNA, complete cds
          Length = 8552

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 544  ttcttcctcttcttcctcatcc 565
            ||||||||||||||||||||||
Sbjct: 6537 ttcttcctcttcttcctcatcc 6516

to top

>gb|L23312.1|MUSHDPROA Mouse HD protein mRNA, complete cds
          Length = 9992

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 544  ttcttcctcttcttcctcatcc 565
            ||||||||||||||||||||||
Sbjct: 7977 ttcttcctcttcttcctcatcc 7956

to top

>dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI complete DNA sequence
          Length = 270148

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 543    cttcttcctcttcttcctcatc 564
              ||||||||||||||||||||||
Sbjct: 224537 cttcttcctcttcttcctcatc 224558

to top

>dbj|AB060276.1| Oryza sativa mRNA for kinase-like protein, complete cds
          Length = 2145

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 542  tcttcttcctcttcttcctcatccactttcataaacagtccaagct 587
            |||||||||||||| ||||||||  ||||||| || ||||| ||||
Sbjct: 2093 tcttcttcctcttcctcctcatctgctttcatgaagagtcccagct 2048

to top

>gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, complete sequence
          Length = 180660

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103796 ctcttcttcctcttcttcctc 103776



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103787 ctcttcttcctcttcttcctc 103767



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103778 ctcttcttcctcttcttcctc 103758



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103769 ctcttcttcctcttcttcctc 103749



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103760 ctcttcttcctcttcttcctc 103740



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103751 ctcttcttcctcttcttcctc 103731



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103742 ctcttcttcctcttcttcctc 103722



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103733 ctcttcttcctcttcttcctc 103713



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103724 ctcttcttcctcttcttcctc 103704



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103715 ctcttcttcctcttcttcctc 103695



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103706 ctcttcttcctcttcttcctc 103686



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103649 ctcttcttcctcttcttcctc 103629



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103640 ctcttcttcctcttcttcctc 103620



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103631 ctcttcttcctcttcttcctc 103611



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103622 ctcttcttcctcttcttcctc 103602



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103613 ctcttcttcctcttcttcctc 103593



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 103604 ctcttcttcctcttcttcctc 103584

to top

>gb|AC114642.6| Mus musculus chromosome 3, clone RP24-127D4, complete sequence
          Length = 189320

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 188619 ctcttcttcctcttcttcctc 188599

to top

>gb|AC110510.6| Mus musculus chromosome 1, clone RP24-503F14, complete sequence
          Length = 198372

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 9973 ctcttcttcctcttcttcctc 9953



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 9964 ctcttcttcctcttcttcctc 9944

to top

>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence
          Length = 152183

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 57220 ctcttcttcctcttcttcctc 57200



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 57543 tcttcttcctcttcttcctc 57524

to top

>gb|AC126598.13| Mus musculus chromosome 5, clone RP24-486L9, complete sequence
          Length = 168471

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 541   ctcttcttcctcttcttcctcatcc 565
             |||||||||||| ||||||||||||
Sbjct: 81619 ctcttcttcctcctcttcctcatcc 81643



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 81611 tcttcttcctcttcttcctc 81630

to top

>gb|DQ100962.1| Homo sapiens isolate P200H immunoglobulin heavy chain variable
           region (IGHV1-69) mRNA, IGHV1-69*09 allele, partial cds
          Length = 366

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 111 cacagtgcacatggaggtgagcagc 135
           ||||||| |||||||||||||||||
Sbjct: 231 cacagtgtacatggaggtgagcagc 255

to top

>gb|AC110904.8| Mus musculus chromosome 7, clone RP24-174I24, complete sequence
          Length = 150036

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 545    tcttcctcttcttcctcatcc 565
              |||||||||||||||||||||
Sbjct: 105071 tcttcctcttcttcctcatcc 105091

to top

>gb|AY726636.1| Xenopus laevis Brg1 mRNA, complete cds
          Length = 5031

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 2063 ctcttcttcctcttcttcctc 2043

to top

>gb|AC140431.4| Mus musculus BAC clone RP24-172K3 from chromosome 7, complete sequence
          Length = 172958

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 23331 ctcttcttcctcttcttcctc 23311



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 23718 tcttcttcctcttcttcctc 23699



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 23339 tcttcttcctcttcttcctc 23320

to top

>gb|AC161810.10| Mus musculus chromosome 3, clone RP24-363L5, complete sequence
          Length = 151433

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 119955 ctcttcttcctcttcttcctc 119975



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 119946 ctcttcttcctcttcttcctc 119966

to top

>gb|AC121304.7| Mus musculus chromosome 3, clone RP24-63C3, complete sequence
          Length = 192911

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99815 ctcttcttcctcttcttcctc 99795



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99806 ctcttcttcctcttcttcctc 99786



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99797 ctcttcttcctcttcttcctc 99777



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99692 ctcttcttcctcttcttcctc 99672



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99683 ctcttcttcctcttcttcctc 99663



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99674 ctcttcttcctcttcttcctc 99654



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99665 ctcttcttcctcttcttcctc 99645



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99656 ctcttcttcctcttcttcctc 99636



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99647 ctcttcttcctcttcttcctc 99627



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99638 ctcttcttcctcttcttcctc 99618



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99602 ctcttcttcctcttcttcctc 99582

to top

>gb|AC163610.4| Mus musculus BAC clone RP23-59P17 from chromosome 13, complete sequence
          Length = 237111

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 85777 ctcttcttcctcttcttcctc 85757

to top

>gb|AC157087.2| Mus musculus BAC clone RP23-287O24 from chromosome 9, complete sequence
          Length = 226149

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 112624 ctcttcttcctcttcttcctc 112604

to top

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
             sequence
          Length = 166185

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 81363 ctcttcttcctcttcttcctc 81383

to top

>gb|AC142244.11| Mus musculus chromosome 1, clone RP23-79H24, complete sequence
          Length = 132061

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 72278 ctcttcttcctcttcttcctc 72298

to top

>ref|XM_511457.1| PREDICTED: Pan troglodytes similar to Dopamine- and cAMP-regulated
            neuronal phosphoprotein (DARPP-32) (LOC454632), mRNA
          Length = 2550

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 541  ctcttcttcctcttcttcctcatcc 565
            |||||||||||||||||| ||||||
Sbjct: 2343 ctcttcttcctcttcttcatcatcc 2319

to top

>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence
          Length = 175318

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 47269 ctcttcttcctcttcttcctc 47289



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 47260 ctcttcttcctcttcttcctc 47280



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 47251 ctcttcttcctcttcttcctc 47271



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 47170 ctcttcttcctcttcttcctc 47190



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 47161 ctcttcttcctcttcttcctc 47181



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 47137 ctcttcttcctcttcttcctc 47157



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 47005 ctcttcttcctcttcttcctc 47025



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 46975 ctcttcttcctcttcttcctc 46995



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 46997 tcttcttcctcttcttcctc 47016

to top

>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence
          Length = 174746

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 151572 ctcttcttcctcttcttcctc 151592



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 151489 ctcttcttcctcttcttcctc 151509



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 151564 tcttcttcctcttcttcctc 151583

to top

>gb|AC160027.16| Mus musculus 10 BAC RP23-192N23 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 207847

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 49091 ctcttcttcctcttcttcctc 49071

to top

>gb|AC115691.8| Mus musculus chromosome 18, clone RP24-286B14, complete sequence
          Length = 175016

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 74904 ctcttcttcctcttcttcctc 74924



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 155923 tcttcttcctcttcttcctc 155904

to top

>gb|AC115011.27| Mus musculus chromosome 1, clone RP24-192A11, complete sequence
          Length = 173802

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 36169 ctcttcttcctcttcttcctc 36189

to top

>ref|XM_631827.1| Dictyostelium discoideum hypothetical protein (DDB0187717), partial
            mRNA
          Length = 3255

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 3243 ctcttcttcctcttcttcctc 3223



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 542  tcttcttcctcttcttcctc 561
            ||||||||||||||||||||
Sbjct: 3251 tcttcttcctcttcttcctc 3232

to top

>gb|AC165224.9| Mus musculus chromosome 5, clone RP24-389L10, complete sequence
          Length = 155046

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 66419 ctcttcttcctcttcttcctc 66399

to top

>gb|AC115006.12| Mus musculus chromosome 8, clone RP24-184D21, complete sequence
          Length = 163874

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 51767 ctcttcttcctcttcttcctc 51787

to top

>gb|AC123713.13| Mus musculus chromosome 7, clone RP23-391D20, complete sequence
          Length = 183590

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 43333 ctcttcttcctcttcttcctc 43313



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 43324 ctcttcttcctcttcttcctc 43304



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 545   tcttcctcttcttcctcatc 564
             ||||||||||||||||||||
Sbjct: 79507 tcttcctcttcttcctcatc 79526



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 43341 tcttcttcctcttcttcctc 43322

to top

>ref|XM_642353.1| Dictyostelium discoideum SMAD/FHA domain-containing protein
            (DDB0220692), partial mRNA
          Length = 2190

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 2049 ctcttcttcctcttcttcctc 2029



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 2040 ctcttcttcctcttcttcctc 2020



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 545 tcttcctcttcttcctcatc 564
           ||||||||||||||||||||
Sbjct: 992 tcttcctcttcttcctcatc 973

to top

>gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, complete sequence
          Length = 156107

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 97509 ctcttcttcctcttcttcctc 97529



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 541   ctcttcttcctcttcttcct 560
             ||||||||||||||||||||
Sbjct: 97518 ctcttcttcctcttcttcct 97537



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 97501 tcttcttcctcttcttcctc 97520

to top

>ref|XM_636607.1| Dictyostelium discoideum hypothetical protein (DDB0205848), partial
            mRNA
          Length = 2592

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 542  tcttcttcctcttcttcctca 562
            |||||||||||||||||||||
Sbjct: 2437 tcttcttcctcttcttcctca 2457

to top

>ref|XM_636112.1| Dictyostelium discoideum hypothetical protein (DDB0205232), partial
           mRNA
          Length = 1869

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 540 gctcttcttcctcttcttcctcatc 564
           ||||||||||||||||||| |||||
Sbjct: 175 gctcttcttcctcttcttcgtcatc 151

to top

>ref|XM_635360.1| Dictyostelium discoideum hypothetical protein (DDB0204240), partial
            mRNA
          Length = 2823

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 1188 ctcttcttcctcttcttcctc 1168

to top

>ref|XM_630095.1| Dictyostelium discoideum hypothetical protein (DDB0183869), partial
            mRNA
          Length = 1827

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 1548 ctcttcttcctcttcttcctc 1528



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 1539 ctcttcttcctcttcttcctc 1519

to top

>gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosome 6, complete sequence
          Length = 218586

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 217243 ctcttcttcctcttcttcctc 217223



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 217251 tcttcttcctcttcttcctc 217232

to top

>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete
            sequence
          Length = 162597

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 8128 ctcttcttcctcttcttcctc 8148



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 8119 ctcttcttcctcttcttcctc 8139



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 8110 ctcttcttcctcttcttcctc 8130



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 8101 ctcttcttcctcttcttcctc 8121



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 8092 ctcttcttcctcttcttcctc 8112



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 8083 ctcttcttcctcttcttcctc 8103



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 542  tcttcttcctcttcttcctc 561
            ||||||||||||||||||||
Sbjct: 8315 tcttcttcctcttcttcctc 8334



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 542  tcttcttcctcttcttcctc 561
            ||||||||||||||||||||
Sbjct: 8075 tcttcttcctcttcttcctc 8094

to top

>gb|AC164302.2| Mus musculus BAC clone RP23-286N12 from chromosome 16, complete
             sequence
          Length = 192765

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 82522 ctcttcttcctcttcttcctc 82502

to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 164347 ctcttcttcctcttcttcctc 164367



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 164323 ctcttcttcctcttcttcctc 164343



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 164299 ctcttcttcctcttcttcctc 164319



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 164257 ctcttcttcctcttcttcctc 164277

to top

>gb|AC169129.2| Mus musculus BAC clone RP23-259N3 from chromosome 7, complete sequence
          Length = 190493

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 305   tccccccttcccttcccttcc 325
             |||||||||||||||||||||
Sbjct: 57205 tccccccttcccttcccttcc 57185

to top

>ref|XM_509822.1| PREDICTED: Pan troglodytes similar to KIAA0360 (LOC452766), mRNA
          Length = 3378

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 545  tcttcctcttcttcctcatcc 565
            |||||||||||||||||||||
Sbjct: 2681 tcttcctcttcttcctcatcc 2661

to top

>ref|XM_507879.1| PREDICTED: Pan troglodytes similar to Pro-neuregulin-3 precursor
           (Pro-NRG3) (LOC450561), mRNA
          Length = 654

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 541 ctcttcttcctcttcttcctc 561
           |||||||||||||||||||||
Sbjct: 363 ctcttcttcctcttcttcctc 383

to top

>ref|XM_473891.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 960

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 540 gctcttcttcctcttcttcctcatc 564
           |||||||||||||||| ||||||||
Sbjct: 763 gctcttcttcctcttcatcctcatc 739

to top

>gb|AC169504.1| Mus musculus BAC clone RP23-416K3 from chromosome 17, complete sequence
          Length = 215554

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 75617 ctcttcttcctcttcttcctc 75637

to top

>ref|NM_005407.1| Homo sapiens sal-like 2 (Drosophila) (SALL2), mRNA
          Length = 4931

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 545  tcttcctcttcttcctcatcc 565
            |||||||||||||||||||||
Sbjct: 2609 tcttcctcttcttcctcatcc 2589

to top

>ref|NM_003048.3| Homo sapiens solute carrier family 9 (sodium/hydrogen exchanger),
            member 2 (SLC9A2), mRNA
          Length = 5446

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 223  actgtcttcattctgggaata 243
            |||||||||||||||||||||
Sbjct: 1553 actgtcttcattctgggaata 1573

to top

>gb|AC002534.1| Arabidopsis thaliana BAC T32N15 from chromosome III near 54 cM,
             complete sequence
          Length = 101371

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 61601 ctcttcttcctcttcttcctc 61621

to top

>ref|NM_012330.1| Homo sapiens MYST histone acetyltransferase (monocytic leukemia) 4
            (MYST4), mRNA
          Length = 6537

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 4416 ctcttcttcctcttcttcctc 4396



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 542  tcttcttcctcttcttcctc 561
            ||||||||||||||||||||
Sbjct: 3611 tcttcttcctcttcttcctc 3592

to top

>gb|BC083067.1| Mus musculus high mobility group box 1, mRNA (cDNA clone MGC:103168
           IMAGE:5372544), complete cds
          Length = 1252

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 541 ctcttcttcctcttcttcctcatcc 565
           |||||||||||| ||||||||||||
Sbjct: 684 ctcttcttcctcctcttcctcatcc 660

to top

>gb|BC085090.1| Mus musculus high mobility group box 1, mRNA (cDNA clone MGC:103169
           IMAGE:6485915), complete cds
          Length = 1283

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 541 ctcttcttcctcttcttcctcatcc 565
           |||||||||||| ||||||||||||
Sbjct: 717 ctcttcttcctcctcttcctcatcc 693

to top

>gb|AC166646.4| Mus musculus chromosome 3, clone RP24-400P18, complete sequence
          Length = 176864

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67267 ctcttcttcctcttcttcctc 67287



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67258 ctcttcttcctcttcttcctc 67278



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67249 ctcttcttcctcttcttcctc 67269



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67240 ctcttcttcctcttcttcctc 67260



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67231 ctcttcttcctcttcttcctc 67251



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67222 ctcttcttcctcttcttcctc 67242



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67213 ctcttcttcctcttcttcctc 67233



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67204 ctcttcttcctcttcttcctc 67224



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67195 ctcttcttcctcttcttcctc 67215



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67186 ctcttcttcctcttcttcctc 67206



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67177 ctcttcttcctcttcttcctc 67197



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 67168 ctcttcttcctcttcttcctc 67188

to top

>gb|AC133489.32| Mus musculus strain C57BL/6J clone rp23-74a5, complete sequence
          Length = 225524

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 201267 ctcttcttcctcttcttcctc 201247

to top

>gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, complete sequence
          Length = 194854

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 541    ctcttcttcctcttcttcctcatcc 565
              |||||| ||||||||||||||||||
Sbjct: 152414 ctcttcctcctcttcttcctcatcc 152438

to top

>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence
          Length = 176668

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 541   ctcttcttcctcttcttcctcatccactt 569
             ||||||||||| ||||||||| |||||||
Sbjct: 63519 ctcttcttccttttcttcctcttccactt 63491



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 545   tcttcctcttcttcctcatcc 565
             |||||||||||||||||||||
Sbjct: 27141 tcttcctcttcttcctcatcc 27161



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26826 ctcttcttcctcttcttcctc 26846



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26817 ctcttcttcctcttcttcctc 26837



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26808 ctcttcttcctcttcttcctc 26828



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26799 ctcttcttcctcttcttcctc 26819



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26775 ctcttcttcctcttcttcctc 26795



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26766 ctcttcttcctcttcttcctc 26786



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26757 ctcttcttcctcttcttcctc 26777



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26748 ctcttcttcctcttcttcctc 26768



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26739 ctcttcttcctcttcttcctc 26759



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 26731 tcttcttcctcttcttcctc 26750



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 26704 tcttcttcctcttcttcctc 26723

to top

>gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, complete sequence
          Length = 212923

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 52710 ctcttcttcctcttcttcctc 52690



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 52701 ctcttcttcctcttcttcctc 52681



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 52718 tcttcttcctcttcttcctc 52699

to top

>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold
          Length = 1743090

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 826973 ctcttcttcctcttcttcctc 826953



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 826943 ctcttcttcctcttcttcctc 826923



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 826934 ctcttcttcctcttcttcctc 826914



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 826951 tcttcttcctcttcttcctc 826932

to top

>gb|AC115868.12| Mus musculus chromosome 7, clone RP24-329F21, complete sequence
          Length = 181717

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 81345 ctcttcttcctcttcttcctc 81365



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 81336 ctcttcttcctcttcttcctc 81356



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 81328 tcttcttcctcttcttcctc 81347

to top

>gb|AC113469.9| Mus musculus chromosome 8, clone RP23-261B5, complete sequence
          Length = 198937

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83166 ctcttcttcctcttcttcctc 83146



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83157 ctcttcttcctcttcttcctc 83137



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83148 ctcttcttcctcttcttcctc 83128



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83139 ctcttcttcctcttcttcctc 83119



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83130 ctcttcttcctcttcttcctc 83110



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83121 ctcttcttcctcttcttcctc 83101



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83112 ctcttcttcctcttcttcctc 83092



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 83103 ctcttcttcctcttcttcctc 83083



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 83174 tcttcttcctcttcttcctc 83155

to top

>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence
          Length = 191054

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 44005 ctcttcttcctcttcttcctc 43985

to top

>gb|AF106329.1| Escherichia coli plasmid F putative methyltransferase, putative
            antirestriction protein, single stranded DNA binding
            protein (ssb), PsiB (psiB), and PsiA (psiA) genes,
            complete cds; flmB gene, complete sequence; FlmC (flmC),
            FlmA (flmA), and X genes, complete cds; and unknown genes
          Length = 13310

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 541  ctcttcttcctcttcttcctc 561
            |||||||||||||||||||||
Sbjct: 5190 ctcttcttcctcttcttcctc 5210

to top

>gb|AC157991.5| Mus musculus chromosome 18, clone RP23-335B10, complete sequence
          Length = 198636

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26504 ctcttcttcctcttcttcctc 26484



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26495 ctcttcttcctcttcttcctc 26475



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 25749 tcttcttcctcttcttcctc 25730

to top

>gb|AC162171.7| Mus musculus chromosome 5, clone RP23-143N11, complete sequence
          Length = 229553

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 305    tccccccttcccttcccttcc 325
              |||||||||||||||||||||
Sbjct: 195068 tccccccttcccttcccttcc 195088



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 166567 tcttcttcctcttcttcctc 166586

to top

>gb|AF259072.1| Mus musculus T-cell receptor alpha locus BAC clone MBAC1058 from 14D1-D2,
              complete sequence
          Length = 170356

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 305    tccccccttcccttcccttcc 325
              |||||||||||||||||||||
Sbjct: 133859 tccccccttcccttcccttcc 133879

to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 76871 ctcttcttcctcttcttcctc 76891



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 76862 ctcttcttcctcttcttcctc 76882

to top

>gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 13, complete
              sequence
          Length = 787999

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 541    ctcttcttcctcttcttcctcatcc 565
              |||||||||||| ||||||||||||
Sbjct: 397492 ctcttcttcctcatcttcctcatcc 397516

to top

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
              sequence
          Length = 1438950

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 942799 ctcttcttcctcttcttcctc 942779



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 541    ctcttcttcctcttcttcct 560
              ||||||||||||||||||||
Sbjct: 556692 ctcttcttcctcttcttcct 556673

to top

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
              sequence
          Length = 2300533

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 439895 ctcttcttcctcttcttcctc 439875



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 542     tcttcttcctcttcttcctc 561
               ||||||||||||||||||||
Sbjct: 1398485 tcttcttcctcttcttcctc 1398466

to top

>gb|AE000658.1|HUAE000658 Homo sapiens T-cell receptor alpha delta locus from bases 1 to 250529
             (section 1 of 5) of the Complete Nucleotide Sequence
          Length = 250529

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 545   tcttcctcttcttcctcatcc 565
             |||||||||||||||||||||
Sbjct: 29179 tcttcctcttcttcctcatcc 29199

to top

>gb|AF469174.1| Cryptosporidium parvum strain cpa16 microsatellite sequence
          Length = 238

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 541 ctcttcttcctcttcttcctc 561
           |||||||||||||||||||||
Sbjct: 121 ctcttcttcctcttcttcctc 101



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 542 tcttcttcctcttcttcctc 561
           ||||||||||||||||||||
Sbjct: 129 tcttcttcctcttcttcctc 110

to top

>gb|AC166800.5| Mus musculus chromosome 1, clone RP24-260I21, complete sequence
          Length = 162752

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 29535 ctcttcttcctcttcttcctc 29555

to top

>gb|AC102124.16| Mus musculus chromosome 18, clone RP23-188D1, complete sequence
          Length = 222450

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 196508 ctcttcttcctcttcttcctc 196488



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 196499 ctcttcttcctcttcttcctc 196479



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 195753 tcttcttcctcttcttcctc 195734

to top

>gb|AC128597.3| Rattus norvegicus  BAC CH230-62C6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 198520

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 127187 ctcttcttcctcttcttcctc 127207

to top

>gb|AC119266.14| Mus musculus chromosome 13, clone RP24-321G8, complete sequence
          Length = 174035

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 108356 ctcttcttcctcttcttcctc 108376

to top

>gb|AC101391.15| Mus musculus chromosome 5, clone RP23-119E13, complete sequence
          Length = 209590

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171595 ctcttcttcctcttcttcctc 171575



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171586 ctcttcttcctcttcttcctc 171566



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171577 ctcttcttcctcttcttcctc 171557



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171568 ctcttcttcctcttcttcctc 171548



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171559 ctcttcttcctcttcttcctc 171539



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171550 ctcttcttcctcttcttcctc 171530



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171541 ctcttcttcctcttcttcctc 171521



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171532 ctcttcttcctcttcttcctc 171512



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171466 ctcttcttcctcttcttcctc 171446



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171457 ctcttcttcctcttcttcctc 171437



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171448 ctcttcttcctcttcttcctc 171428



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171439 ctcttcttcctcttcttcctc 171419



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171430 ctcttcttcctcttcttcctc 171410



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171421 ctcttcttcctcttcttcctc 171401



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171412 ctcttcttcctcttcttcctc 171392



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171280 ctcttcttcctcttcttcctc 171260



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171271 ctcttcttcctcttcttcctc 171251



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171262 ctcttcttcctcttcttcctc 171242



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171253 ctcttcttcctcttcttcctc 171233



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171244 ctcttcttcctcttcttcctc 171224



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171235 ctcttcttcctcttcttcctc 171215



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171226 ctcttcttcctcttcttcctc 171206



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171103 ctcttcttcctcttcttcctc 171083



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171094 ctcttcttcctcttcttcctc 171074



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171085 ctcttcttcctcttcttcctc 171065



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 171076 ctcttcttcctcttcttcctc 171056



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 171603 tcttcttcctcttcttcctc 171584



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 171288 tcttcttcctcttcttcctc 171269



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 171111 tcttcttcctcttcttcctc 171092

to top

>gb|AF235097.2| Homo sapiens chromosome X multiple clones map p11.23, complete sequence
          Length = 140335

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26707 ctcttcttcctcttcttcctc 26727



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 26698 ctcttcttcctcttcttcctc 26718

to top

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 542    tcttcttcctcttcttcctca 562
              |||||||||||||||||||||
Sbjct: 524669 tcttcttcctcttcttcctca 524689



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 542    tcttcttcctcttcttcctca 562
              |||||||||||||||||||||
Sbjct: 236671 tcttcttcctcttcttcctca 236691



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 541    ctcttcttcctcttcttcct 560
              ||||||||||||||||||||
Sbjct: 736346 ctcttcttcctcttcttcct 736365



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tcttcttcctcttcttcctc 561
              ||||||||||||||||||||
Sbjct: 736338 tcttcttcctcttcttcctc 736357

to top

>gb|AC165090.3| Mus musculus BAC clone RP23-95H4 from chromosome 8, complete sequence
          Length = 252334

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 56855 ctcttcttcctcttcttcctc 56875



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 56846 ctcttcttcctcttcttcctc 56866



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 56838 tcttcttcctcttcttcctc 56857

to top

>gb|AC154279.2| Mus musculus BAC clone RP24-271E12 from chromosome 17, complete
             sequence
          Length = 173729

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 541   ctcttcttcctcttcttcctcatcc 565
             ||||||||||||||| |||||||||
Sbjct: 18123 ctcttcttcctcttcatcctcatcc 18099

to top

>gb|AC144519.4| Mus musculus BAC clone RP24-325A1 from chromosome 6, complete sequence
          Length = 195499

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 64285 ctcttcttcctcttcttcctc 64265



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 64234 ctcttcttcctcttcttcctc 64214



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 64225 ctcttcttcctcttcttcctc 64205



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 64216 ctcttcttcctcttcttcctc 64196

to top

>gb|AC167171.2| Mus musculus BAC clone RP23-409H8 from chromosome 13, complete sequence
          Length = 203840

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99917 ctcttcttcctcttcttcctc 99937



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 99908 ctcttcttcctcttcttcctc 99928

to top

>gb|AC164303.2| Mus musculus BAC clone RP24-530J21 from chromosome 14, complete sequence
          Length = 164905

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 134443 ctcttcttcctcttcttcctc 134423

to top

>gb|AC154025.12| Mus musculus 6 BAC RP24-539J4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 165821

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 305   tccccccttcccttcccttcc 325
             |||||||||||||||||||||
Sbjct: 93458 tccccccttcccttcccttcc 93438

to top

>gb|AC111023.12| Mus musculus chromosome 19, clone RP23-221A9, complete sequence
          Length = 228107

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 178472 ctcttcttcctcttcttcctc 178492

to top

>gb|U49944.2| Caenorhabditis elegans cosmid C39E6, complete sequence
          Length = 33880

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 22515 ctcttcttcctcttcttcctc 22535

to top

>gb|AC102714.16| Mus musculus chromosome 5, clone RP24-298D13, complete sequence
          Length = 165774

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 541    ctcttcttcctcttcttcctcatcc 565
              |||||||||||| ||||||||||||
Sbjct: 108554 ctcttcttcctcctcttcctcatcc 108578

to top

>gb|AC113092.25| Mus musculus chromosome 6, clone RP23-309N11, complete sequence
          Length = 186431

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 168723 ctcttcttcctcttcttcctc 168743

to top

>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence
          Length = 256158

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 541    ctcttcttcctcttcttcctcatcc 565
              |||||||||||| ||||||||||||
Sbjct: 134365 ctcttcttcctcctcttcctcatcc 134341

to top

>gb|AC115718.14| Mus musculus chromosome 8, clone RP23-247P3, complete sequence
          Length = 232751

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 164379 ctcttcttcctcttcttcctc 164359



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 164370 ctcttcttcctcttcttcctc 164350

to top

>gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, complete sequence
          Length = 211158

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 13371 ctcttcttcctcttcttcctc 13351



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 13362 ctcttcttcctcttcttcctc 13342



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 13095 ctcttcttcctcttcttcctc 13075

to top

>gb|AC102874.7| Mus musculus chromosome 1, clone RP24-500O1, complete sequence
          Length = 166507

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 96033 ctcttcttcctcttcttcctc 96013



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 96024 ctcttcttcctcttcttcctc 96004

to top

>ref|XM_875023.1| PREDICTED: Bos taurus similar to Dingo protein isoform 1, transcript
            variant 5 (LOC526125), mRNA
          Length = 6765

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 542  tcttcttcctcttcttcctca 562
            |||||||||||||||||||||
Sbjct: 4020 tcttcttcctcttcttcctca 4000

to top

>ref|XM_604484.2| PREDICTED: Bos taurus similar to Dingo protein isoform 1, transcript
            variant 1 (LOC526125), mRNA
          Length = 6825

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 542  tcttcttcctcttcttcctca 562
            |||||||||||||||||||||
Sbjct: 4080 tcttcttcctcttcttcctca 4060

to top

>gb|AC100726.7| Mus musculus chromosome 19, clone RP24-245B11, complete sequence
          Length = 176074

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 72338 ctcttcttcctcttcttcctc 72318

to top

>gb|BC080271.1| Mus musculus solute carrier family 4 (anion exchanger), member 3,
           mRNA (cDNA clone MGC:90734 IMAGE:6831942), complete cds
          Length = 4092

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 541 ctcttcttcctcttcttcctc 561
           |||||||||||||||||||||
Sbjct: 646 ctcttcttcctcttcttcctc 626

to top

>gb|AC117784.13| Mus musculus chromosome 15, clone RP24-545F24, complete sequence
          Length = 190734

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 71863 ctcttcttcctcttcttcctc 71843



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 71854 ctcttcttcctcttcttcctc 71834



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 71845 ctcttcttcctcttcttcctc 71825



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 71836 ctcttcttcctcttcttcctc 71816



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 71827 ctcttcttcctcttcttcctc 71807



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 71818 ctcttcttcctcttcttcctc 71798

to top

>gb|AC114512.5| Rattus norvegicus 5 BAC CH230-5N9 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 247588

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 228924 ctcttcttcctcttcttcctc 228944



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 228915 ctcttcttcctcttcttcctc 228935

to top

>gb|AC121292.9| Mus musculus chromosome 1, clone RP23-172B15, complete sequence
          Length = 193192

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 179005 ctcttcttcctcttcttcctc 179025

to top

>gb|AC131989.8| Mus musculus chromosome 14, clone RP24-186N15, complete sequence
          Length = 180932

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 129517 ctcttcttcctcttcttcctc 129537

to top

>gb|AC161409.11| Mus musculus chromosome 7, clone RP23-292B24, complete sequence
          Length = 185365

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 91343 ctcttcttcctcttcttcctc 91363



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 91334 ctcttcttcctcttcttcctc 91354



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 542   tcttcttcctcttcttcctc 561
             ||||||||||||||||||||
Sbjct: 91326 tcttcttcctcttcttcctc 91345

to top

>ref|XM_425989.1| PREDICTED: Gallus gallus similar to nephew of atonal 3 (LOC428429),
           mRNA
          Length = 552

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 541 ctcttcttcctcttcttcctc 561
           |||||||||||||||||||||
Sbjct: 291 ctcttcttcctcttcttcctc 271

to top

>gb|AC102509.6| Mus musculus chromosome 7, clone RP24-327G7, complete sequence
          Length = 186990

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 541   ctcttcttcctcttcttcctcatcc 565
             |||||||||||| ||||||||||||
Sbjct: 37799 ctcttcttcctcctcttcctcatcc 37823

to top

>gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, complete sequence
          Length = 173306

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 82359 ctcttcttcctcttcttcctc 82339



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 82350 ctcttcttcctcttcttcctc 82330



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 82341 ctcttcttcctcttcttcctc 82321

to top

>gb|AC117826.10| Mus musculus chromosome 1, clone RP24-81K19, complete sequence
          Length = 227953

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ctcttcttcctcttcttcctc 561
              |||||||||||||||||||||
Sbjct: 199104 ctcttcttcctcttcttcctc 199124

to top

>gb|AC100986.9| Mus musculus chromosome 3, clone RP23-77E5, complete sequence
          Length = 112141

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 32936 ctcttcttcctcttcttcctc 32916



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 541   ctcttcttcctcttcttcctc 561
             |||||||||||||||||||||
Sbjct: 32927 ctcttcttcctcttcttcctc 32907


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,533,781
Number of Sequences: 3902068
Number of extensions: 6533781
Number of successful extensions: 305848
Number of sequences better than 10.0: 2256
Number of HSP's better than 10.0 without gapping: 2279
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 285303
Number of HSP's gapped (non-prelim): 20521
length of query: 590
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 567
effective length of database: 17,143,297,704
effective search space: 9720249798168
effective search space used: 9720249798168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result