Clone Name	rbags26c12
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation fact...	561	e-157
2	ref|NM_186038.2| Oryza sativa (japonica cultivar-group), mRNA	192	7e-46
3	ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group...	192	7e-46
4	dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clon...	192	7e-46
5	dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clon...	192	7e-46
6	dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clon...	192	7e-46
7	dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA...	192	7e-46
8	gb|BT016181.1| Zea mays clone Contig14 mRNA sequence	149	1e-32
9	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	121	2e-24
10	dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic D...	121	2e-24
11	gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence	117	4e-23
12	emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elong...	105	1e-19
13	gb|BT016185.1| Zea mays clone Contig18 mRNA sequence	82	2e-12
14	gb|BT016424.1| Zea mays clone Contig257 mRNA sequence	78	3e-11
15	gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence	74	5e-10
16	gb|AY103717.1| Zea mays PCO098989 mRNA sequence	72	2e-09
17	gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated...	70	7e-09
18	gb|AY480020.1| Capsicum annuum putative elongation factor 1B alp...	70	7e-09
19	gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulate...	70	7e-09
20	gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongatio...	62	2e-06
21	gb|DQ191626.1| Solanum tuberosum unknown mRNA	62	2e-06
22	dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongatio...	62	2e-06
23	emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5...	62	2e-06
24	gb|AY111648.1| Zea mays CL2935_1 mRNA sequence	60	7e-06
25	ref|NM_121956.2| Arabidopsis thaliana translation elongation fac...	58	3e-05
26	emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongatio...	58	3e-05
27	gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1...	58	3e-05
28	gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1...	58	3e-05
29	emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
30	emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
31	emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
32	emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
33	emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
34	gb|AY909456.1| Siniperca chuatsi clone C279 translation elongati...	58	3e-05
35	gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete s...	58	3e-05
36	ref|NM_127367.1| Arabidopsis thaliana translation elongation fac...	56	1e-04
37	emb|BX071583.1|CNS09REB Single read from an extremity of a full-...	56	1e-04
38	emb|BX071358.1|CNS09R82 Single read from an extremity of a full-...	56	1e-04
39	emb|BX071357.1|CNS09R81 Single read from an extremity of a full-...	56	1e-04
40	emb|BX068711.1|CNS09P6J Single read from an extremity of a full-...	56	1e-04
41	emb|BX068710.1|CNS09P6I Single read from an extremity of a full-...	56	1e-04
42	emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-...	56	1e-04
43	emb|BX063619.1|CNS09L93 Single read from an extremity of a full-...	56	1e-04
44	emb|BX063618.1|CNS09L92 Single read from an extremity of a full-...	56	1e-04
45	emb|BX063276.1|CNS09KZK Single read from an extremity of a full-...	56	1e-04
46	emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-...	56	1e-04
47	emb|BX053674.1|CNS09DKU Single read from an extremity of a full-...	56	1e-04
48	emb|BX053673.1|CNS09DKT Single read from an extremity of a full-...	56	1e-04
49	emb|BX052417.1|CNS09CLX Single read from an extremity of a full-...	56	1e-04
50	emb|BX052416.1|CNS09CLW Single read from an extremity of a full-...	56	1e-04
51	emb|BX052150.1|CNS09CEI Single read from an extremity of a full-...	56	1e-04
52	emb|BX052149.1|CNS09CEH Single read from an extremity of a full-...	56	1e-04
53	emb|BX052078.1|CNS09CCI Single read from an extremity of a full-...	56	1e-04
54	emb|BX052058.1|CNS09CBY Single read from an extremity of a full-...	56	1e-04
55	emb|BX047220.1|CNS098LK Single read from an extremity of a full-...	56	1e-04
56	emb|BX047219.1|CNS098LJ Single read from an extremity of a full-...	56	1e-04
57	emb|BX046233.1|CNS097U5 Single read from an extremity of a full-...	56	1e-04
58	emb|BX046232.1|CNS097U4 Single read from an extremity of a full-...	56	1e-04
59	emb|BX042348.1|CNS094U8 Single read from an extremity of a full-...	56	1e-04
60	emb|BX042347.1|CNS094U7 Single read from an extremity of a full-...	56	1e-04
61	emb|BX041605.1|CNS0949L Single read from an extremity of a full-...	56	1e-04
62	emb|BX041604.1|CNS0949K Single read from an extremity of a full-...	56	1e-04
63	emb|BX041307.1|CNS0941B Single read from an extremity of a full-...	56	1e-04
64	emb|BX039708.1|CNS092SW Single read from an extremity of a full-...	56	1e-04
65	emb|BX039707.1|CNS092SV Single read from an extremity of a full-...	56	1e-04
66	emb|BX037290.1|CNS090XQ Single read from an extremity of a full-...	56	1e-04
67	emb|BX036523.1|CNS090CF Single read from an extremity of a full-...	56	1e-04
68	emb|BX036522.1|CNS090CE Single read from an extremity of a full-...	56	1e-04
69	emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-...	56	1e-04
70	emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-...	56	1e-04
71	emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-...	56	1e-04
72	emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-...	56	1e-04
73	emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-...	56	1e-04
74	emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-...	56	1e-04
75	emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-...	56	1e-04
76	emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-...	56	1e-04
77	emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-...	56	1e-04
78	emb|BX032179.1|CNS08WZR Single read from an extremity of a full-...	56	1e-04
79	emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-...	56	1e-04
80	emb|BX032163.1|CNS08WZB Single read from an extremity of a full-...	56	1e-04
81	emb|BX029545.1|CNS08UYL Single read from an extremity of a full-...	56	1e-04
82	emb|BX029544.1|CNS08UYK Single read from an extremity of a full-...	56	1e-04
83	emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-...	56	1e-04
84	emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-...	56	1e-04
85	emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-...	56	1e-04
86	emb|BX027135.1|CNS08T3N Single read from an extremity of a full-...	56	1e-04
87	emb|BX027134.1|CNS08T3M Single read from an extremity of a full-...	56	1e-04
88	emb|BX026630.1|CNS08SPM Single read from an extremity of a full-...	56	1e-04
89	emb|BX026629.1|CNS08SPL Single read from an extremity of a full-...	56	1e-04
90	emb|BX026387.1|CNS08SIV Single read from an extremity of a full-...	56	1e-04
91	emb|BX026386.1|CNS08SIU Single read from an extremity of a full-...	56	1e-04
92	emb|BX025444.1|CNS08RSO Single read from an extremity of a full-...	56	1e-04
93	emb|BX025443.1|CNS08RSN Single read from an extremity of a full-...	56	1e-04
94	emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-...	56	1e-04
95	emb|BX024401.1|CNS08QZP Single read from an extremity of a full-...	56	1e-04
96	emb|BX024400.1|CNS08QZO Single read from an extremity of a full-...	56	1e-04
97	emb|BX023680.1|CNS08QFO Single read from an extremity of a full-...	56	1e-04
98	emb|BX023679.1|CNS08QFN Single read from an extremity of a full-...	56	1e-04
99	emb|BX019648.1|CNS08NBO Single read from an extremity of a full-...	56	1e-04
100	emb|BX019647.1|CNS08NBN Single read from an extremity of a full-...	56	1e-04
101	emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-...	56	1e-04
102	emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-...	56	1e-04
103	emb|BX018057.1|CNS08M3H Single read from an extremity of a full-...	56	1e-04
104	emb|BX018056.1|CNS08M3G Single read from an extremity of a full-...	56	1e-04
105	emb|BX016732.1|CNS08L2O Single read from an extremity of a full-...	56	1e-04
106	emb|BX016731.1|CNS08L2N Single read from an extremity of a full-...	56	1e-04
107	emb|BX016339.1|CNS08KRR Single read from an extremity of a full-...	56	1e-04
108	emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-...	56	1e-04
109	emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-...	56	1e-04
110	emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-...	56	1e-04
111	emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-...	56	1e-04
112	emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-...	56	1e-04
113	emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-...	56	1e-04
114	emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-...	56	1e-04
115	emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-...	56	1e-04
116	emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-...	56	1e-04
117	emb|BX010493.1|CNS08G9D Single read from an extremity of a full-...	56	1e-04
118	emb|BX010492.1|CNS08G9C Single read from an extremity of a full-...	56	1e-04
119	emb|BX010211.1|CNS08G1J Single read from an extremity of a full-...	56	1e-04
120	emb|BX010113.1|CNS08FYT Single read from an extremity of a full-...	56	1e-04
121	emb|BX010112.1|CNS08FYS Single read from an extremity of a full-...	56	1e-04
122	emb|BX009646.1|CNS08FLU Single read from an extremity of a full-...	56	1e-04
123	emb|BX008302.1|CNS08EKI Single read from an extremity of a full-...	56	1e-04
124	emb|BX008301.1|CNS08EKH Single read from an extremity of a full-...	56	1e-04
125	gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map...	56	1e-04
126	gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma...	56	1e-04
127	gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1...	56	1e-04
128	gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1...	56	1e-04
129	emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
130	emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
131	emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
132	gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete s...	56	1e-04
133	ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448 ...	56	1e-04
134	gb|DQ191662.1| Solanum tuberosum elongation factor-like protein ...	54	4e-04
135	emb|BX037291.1|CNS090XR Single read from an extremity of a full-...	54	4e-04
136	emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation fa...	54	4e-04
137	gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1	54	4e-04
138	ref|NM_102762.2| Arabidopsis thaliana translation elongation fac...	52	0.002
139	ref|XM_479153.1| Oryza sativa (japonica cultivar-group), mRNA	52	0.002
140	ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group...	52	0.002
141	gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi...	52	0.002
142	emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Co...	52	0.002
143	emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Co...	52	0.002
144	emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Co...	52	0.002
145	gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F1...	52	0.002
146	dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D...	52	0.002
147	dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongat...	52	0.002
148	dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
149	dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
150	dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
151	dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mR...	52	0.002
152	ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4...	50	0.007
153	ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD...	50	0.007
154	emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chr...	50	0.007
155	emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor ...	50	0.007
156	gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA...	50	0.007
157	dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534	50	0.007
158	emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library	50	0.007
159	emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library	50	0.007
160	emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library	50	0.007
161	emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library	50	0.007
162	emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library	50	0.007
163	emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library	50	0.007
164	emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library	50	0.007
165	emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library	50	0.007
166	gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA...	50	0.007
167	ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM011...	48	0.027
168	emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-...	48	0.027
169	emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-...	48	0.027
170	emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta	48	0.027
171	gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Can...	48	0.027
172	emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Co...	48	0.027
173	gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translati...	46	0.11
174	gb|BC046042.1| Danio rerio eukaryotic translation elongation fac...	46	0.11
175	gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosom...	46	0.11
176	gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosom...	46	0.11
177	gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome...	46	0.11
178	emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in...	46	0.11
179	gb|AY444796.1| Pisum sativum translational elongation factor 1 s...	46	0.11
180	gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNIN...	46	0.11
181	emb|BX029538.1|CNS08UYE Single read from an extremity of a full-...	46	0.11
182	emb|AJ237772.1|OLA237772 Oryzias latipes mRNA for elongation fac...	46	0.11
183	ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation fa...	46	0.11
184	ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation fa...	46	0.11
185	ref|NM_199949.2| Danio rerio eukaryotic translation elongation f...	46	0.11
186	gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complet...	46	0.11
187	gb|BC096865.1| Danio rerio cold inducible RNA binding protein, m...	46	0.11
188	gb|BC071464.1| Danio rerio eukaryotic translation elongation fac...	46	0.11
189	ref|XM_532345.2| PREDICTED: Canis familiaris similar to eukaryot...	44	0.43
190	ref|XM_851661.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.43
191	ref|XM_851616.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.43
192	ref|XM_851583.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.43
193	ref|XM_851537.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.43
194	ref|XM_851498.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.43
195	ref|XM_851462.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.43
196	emb|AL353136.21| Human DNA sequence from clone RP11-133K18 on ch...	44	0.43
197	gb|AY321330.1| Rattus norvegicus Ac2-067 mRNA, complete cds	44	0.43
198	emb|AJ291984.1|PFL291984 Platichthys flesus partial mRNA for tra...	44	0.43
199	emb|AL645962.22| Mouse DNA sequence from clone RP23-217L7 on chr...	44	0.43
200	emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23	44	0.43
201	gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	44	0.43
202	emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7	44	0.43
203	emb|AL116212.1|CNS01D0C Botrytis cinerea strain T4 cDNA library	44	0.43
204	emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Co...	44	0.43
205	emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Co...	44	0.43
206	emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Co...	44	0.43
207	emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Co...	44	0.43
208	emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14	44	0.43
209	ref|XM_342043.2| PREDICTED: Rattus norvegicus similar to eukaryo...	44	0.43
210	ref|NM_210904.1| Eremothecium gossypii AFR003Cp (AFR003C), mRNA	44	0.43
211	gb|AC170424.1| Rhesus Macaque BAC CH250-53N5 (Children's Hospit...	42	1.7
212	ref|XM_524853.1| PREDICTED: Pan troglodytes similar to Elongatio...	42	1.7
213	ref|XM_414267.1| PREDICTED: Gallus gallus similar to ring finger...	42	1.7
214	gb|DQ440296.1| Aedes aegypti clone AET-374 elongation factor 1 b...	42	1.7
215	gb|BC021729.1| Homo sapiens similar to hypothetical protein FLJ2...	42	1.7
216	gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence	42	1.7
217	gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CI...	42	1.7
218	emb|CR733792.2|CNS0GSZ3 Tetraodon nigroviridis full-length cDNA	42	1.7
219	emb|CR728524.2|CNS0GP2Q Tetraodon nigroviridis full-length cDNA	42	1.7
220	emb|CR720100.2|CNS0GIKQ Tetraodon nigroviridis full-length cDNA	42	1.7
221	emb|CR722642.2|CNS0GKJC Tetraodon nigroviridis full-length cDNA	42	1.7
222	emb|CR719902.2|CNS0GIF8 Tetraodon nigroviridis full-length cDNA	42	1.7
223	emb|CR703454.2|CNS0G5QI Tetraodon nigroviridis full-length cDNA	42	1.7
224	emb|CR701463.2|CNS0G477 Tetraodon nigroviridis full-length cDNA	42	1.7
225	emb|CR698877.2|CNS0G27D Tetraodon nigroviridis full-length cDNA	42	1.7
226	emb|CR691105.2|CNS0FW7H Tetraodon nigroviridis full-length cDNA	42	1.7
227	emb|CR688433.2|CNS0FU59 Tetraodon nigroviridis full-length cDNA	42	1.7
228	emb|CR687149.2|CNS0FT5L Tetraodon nigroviridis full-length cDNA	42	1.7
229	emb|CR687009.2|CNS0FT1P Tetraodon nigroviridis full-length cDNA	42	1.7
230	emb|CR686677.2|CNS0FSSH Tetraodon nigroviridis full-length cDNA	42	1.7
231	emb|CR685114.3|CNS0FRL2 Tetraodon nigroviridis full-length cDNA	42	1.7
232	emb|CR683419.2|CNS0FQ9Z Tetraodon nigroviridis full-length cDNA	42	1.7
233	emb|CR681006.2|CNS0FOEY Tetraodon nigroviridis full-length cDNA	42	1.7
234	emb|CR680575.2|CNS0FO2Z Tetraodon nigroviridis full-length cDNA	42	1.7
235	emb|CR680242.2|CNS0FNTQ Tetraodon nigroviridis full-length cDNA	42	1.7
236	emb|CR679939.2|CNS0FNLB Tetraodon nigroviridis full-length cDNA	42	1.7
237	emb|CR677929.1|CNS0FM1T Tetraodon nigroviridis full-length cDNA	42	1.7
238	emb|CR677980.2|CNS0FM38 Tetraodon nigroviridis full-length cDNA	42	1.7
239	emb|CR677281.2|CNS0FLJX Tetraodon nigroviridis full-length cDNA	42	1.7
240	emb|CR677181.2|CNS0FLH5 Tetraodon nigroviridis full-length cDNA	42	1.7
241	emb|CR676468.2|CNS0FKXC Tetraodon nigroviridis full-length cDNA	42	1.7
242	emb|CR676870.2|CNS0FL8I Tetraodon nigroviridis full-length cDNA	42	1.7
243	emb|CR674225.2|CNS0FJ7B Tetraodon nigroviridis full-length cDNA	42	1.7
244	emb|CR673965.2|CNS0FJ03 Tetraodon nigroviridis full-length cDNA	42	1.7
245	emb|CR673115.2|CNS0FICH Tetraodon nigroviridis full-length cDNA	42	1.7
246	emb|CR672809.2|CNS0FI3Z Tetraodon nigroviridis full-length cDNA	42	1.7
247	emb|CR672714.2|CNS0FI1C Tetraodon nigroviridis full-length cDNA	42	1.7
248	emb|CR672557.2|CNS0FHWZ Tetraodon nigroviridis full-length cDNA	42	1.7
249	emb|CR672233.2|CNS0FHNZ Tetraodon nigroviridis full-length cDNA	42	1.7
250	emb|CR671039.2|CNS0FGQT Tetraodon nigroviridis full-length cDNA	42	1.7
251	emb|CR671013.2|CNS0FGQ3 Tetraodon nigroviridis full-length cDNA	42	1.7
252	emb|CR671520.2|CNS0FH46 Tetraodon nigroviridis full-length cDNA	42	1.7
253	emb|CR670534.2|CNS0FGCS Tetraodon nigroviridis full-length cDNA	42	1.7
254	emb|CR668627.2|CNS0FEVT Tetraodon nigroviridis full-length cDNA	42	1.7
255	emb|CR668461.2|CNS0FER7 Tetraodon nigroviridis full-length cDNA	42	1.7
256	emb|CR668249.2|CNS0FELB Tetraodon nigroviridis full-length cDNA	42	1.7
257	emb|CR667660.2|CNS0FE4Y Tetraodon nigroviridis full-length cDNA	42	1.7
258	emb|CR666943.2|CNS0FDL1 Tetraodon nigroviridis full-length cDNA	42	1.7
259	emb|CR666424.2|CNS0FD6M Tetraodon nigroviridis full-length cDNA	42	1.7
260	emb|CR666052.2|CNS0FCWA Tetraodon nigroviridis full-length cDNA	42	1.7
261	emb|CR665436.2|CNS0FCF6 Tetraodon nigroviridis full-length cDNA	42	1.7
262	emb|CR664496.2|CNS0FBP2 Tetraodon nigroviridis full-length cDNA	42	1.7
263	emb|CR664813.2|CNS0FBXV Tetraodon nigroviridis full-length cDNA	42	1.7
264	emb|CR664774.2|CNS0FBWS Tetraodon nigroviridis full-length cDNA	42	1.7
265	emb|CR663967.2|CNS0FBAD Tetraodon nigroviridis full-length cDNA	42	1.7
266	emb|CR663903.2|CNS0FB8L Tetraodon nigroviridis full-length cDNA	42	1.7
267	emb|CR663679.2|CNS0FB2D Tetraodon nigroviridis full-length cDNA	42	1.7
268	emb|CR663217.2|CNS0FAPJ Tetraodon nigroviridis full-length cDNA	42	1.7
269	emb|CR662504.2|CNS0FA5Q Tetraodon nigroviridis full-length cDNA	42	1.7
270	emb|CR662807.2|CNS0FAE5 Tetraodon nigroviridis full-length cDNA	42	1.7
271	emb|CR661271.2|CNS0F97H Tetraodon nigroviridis full-length cDNA	42	1.7
272	emb|CR658047.2|CNS0F6PX Tetraodon nigroviridis full-length cDNA	42	1.7
273	emb|CR659461.2|CNS0F7T7 Tetraodon nigroviridis full-length cDNA	42	1.7
274	emb|CR659404.2|CNS0F7RM Tetraodon nigroviridis full-length cDNA	42	1.7
275	emb|CR658737.2|CNS0F793 Tetraodon nigroviridis full-length cDNA	42	1.7
276	emb|CR658693.2|CNS0F77V Tetraodon nigroviridis full-length cDNA	42	1.7
277	emb|CR657178.2|CNS0F61S Tetraodon nigroviridis full-length cDNA	42	1.7
278	emb|CR657080.2|CNS0F5Z2 Tetraodon nigroviridis full-length cDNA	42	1.7
279	emb|CR657622.2|CNS0F6E4 Tetraodon nigroviridis full-length cDNA	42	1.7
280	emb|CR657582.2|CNS0F6D0 Tetraodon nigroviridis full-length cDNA	42	1.7
281	emb|CR657548.2|CNS0F6C2 Tetraodon nigroviridis full-length cDNA	42	1.7
282	emb|CR655077.2|CNS0F4FF Tetraodon nigroviridis full-length cDNA	42	1.7
283	emb|CR652367.2|CNS0F2C5 Tetraodon nigroviridis full-length cDNA	42	1.7
284	emb|CR652169.2|CNS0F26N Tetraodon nigroviridis full-length cDNA	42	1.7
285	emb|CR649960.2|CNS0F0HA Tetraodon nigroviridis full-length cDNA	42	1.7
286	emb|CR649944.2|CNS0F0GU Tetraodon nigroviridis full-length cDNA	42	1.7
287	emb|CR648239.2|CNS0EZ5H Tetraodon nigroviridis full-length cDNA	42	1.7
288	emb|CR645624.2|CNS0EX4U Tetraodon nigroviridis full-length cDNA	42	1.7
289	emb|CR642727.2|CNS0EUWD Tetraodon nigroviridis full-length cDNA	42	1.7
290	emb|CR642517.2|CNS0EUQJ Tetraodon nigroviridis full-length cDNA	42	1.7
291	emb|CR642045.2|CNS0EUDF Tetraodon nigroviridis full-length cDNA	42	1.7
292	emb|CR641777.2|CNS0EU5Z Tetraodon nigroviridis full-length cDNA	42	1.7
293	emb|CR637840.2|CNS0ER4M Tetraodon nigroviridis full-length cDNA	42	1.7
294	emb|CR636750.2|CNS0EQAC Tetraodon nigroviridis full-length cDNA	42	1.7
295	emb|CR635662.2|CNS0EPG4 Tetraodon nigroviridis full-length cDNA	42	1.7
296	emb|CR634289.2|CNS0EODZ Tetraodon nigroviridis full-length cDNA	42	1.7
297	emb|CR634173.2|CNS0EOAR Tetraodon nigroviridis full-length cDNA	42	1.7
298	emb|AL731568.7| Human DNA sequence from clone RP11-367B6 on chro...	42	1.7
299	emb|AL590229.3| Human DNA sequence from clone RP11-192B18 on chr...	42	1.7
300	emb|AL512627.6| Human DNA sequence from clone RP11-21A16 on chro...	42	1.7
301	emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on ch...	42	1.7
302	gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome	42	1.7
303	emb|AL833768.1|HSM805081 Homo sapiens mRNA; cDNA DKFZp666K117 (f...	42	1.7
304	gb|AC022098.9| Homo sapiens chromosome 19 clone CTB-55O6, comple...	42	1.7
305	gb|AC099507.3| Homo sapiens chromosome 5 clone RP11-24H18, compl...	42	1.7
306	gb|AC087490.6| Homo sapiens chromosome 15, clone RP11-810H22, co...	42	1.7
307	gb|AC103750.2| Homo sapiens chromosome 15, clone RP11-494F2, com...	42	1.7
308	gb|AC010362.6| Homo sapiens chromosome 5 clone CTD-2037I18, comp...	42	1.7
309	gb|AC098976.2| Homo sapiens BAC clone RP11-751L19 from 4, comple...	42	1.7
310	ref|XM_944722.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.7
311	ref|XM_944719.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.7
312	ref|XM_944718.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.7
313	ref|XM_940654.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.7
314	ref|XM_934766.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.7
315	ref|XM_934764.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.7
316	ref|XM_934762.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.7
317	ref|XM_058967.12| PREDICTED: Homo sapiens similar to Elongation ...	42	1.7
318	ref|XM_695588.1| PREDICTED: Danio rerio similar to Elongation fa...	42	1.7
319	gb|AC009075.7| Homo sapiens chromosome 16 clone RP11-328J14, com...	42	1.7
320	dbj|AB169168.1| Macaca fascicularis testis cDNA, clone: QtsA-177...	42	1.7
321	dbj|AB179332.1| Macaca fascicularis testis cDNA clone: QtsA-1773...	42	1.7
322	gb|AC010429.6|AC010429 Homo sapiens chromosome 5 clone CTD-2199L...	42	1.7
323	gb|AC008220.5|AC008220 Drosophila melanogaster, chromosome 3R, r...	42	1.7
324	gb|AC007975.7|AC007975 Drosophila melanogaster, chromosome 3R, r...	42	1.7
325	ref|NM_145293.2| Homo sapiens similar to hypothetical protein FL...	42	1.7
326	dbj|BS000210.2| Pan troglodytes chromosome 22 clone:RP43-018H16,...	42	1.7
327	emb|AL590078.2|HS381K22 Homo sapiens chromosome 9 BAC RP11-381K2...	42	1.7
328	emb|CR848705.13| Zebrafish DNA sequence from clone DKEY-8O15 in ...	42	1.7
329	gb|AE003776.2| Drosophila melanogaster chromosome 3R, section 11...	42	1.7
330	dbj|AP001011.6| Homo sapiens genomic DNA, chromosome 18 clone:RP...	42	1.7
331	gb|AC002525.1|AC002525 Human PAC clone 257C22A from 13q12-q13, c...	42	1.7
332	ref|NM_121249.2| Arabidopsis thaliana translation elongation fac...	40	6.7
333	gb|AC102320.6| Mus musculus chromosome 1, clone RP24-459A11, com...	40	6.7
334	gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosom...	40	6.7
335	gb|BC081500.1| Danio rerio zgc:103635, mRNA (cDNA clone MGC:1036...	40	6.7
336	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	6.7
337	gb|BC097116.1| Danio rerio zgc:114052, mRNA (cDNA clone MGC:1140...	40	6.7
338	gb|AC119971.8| Mus musculus chromosome 16, clone RP24-480D8, com...	40	6.7
339	gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosom...	40	6.7
340	gb|AC141874.4| Mus musculus BAC clone RP24-327L10 from chromosom...	40	6.7
341	gb|AC145586.4| Mus musculus BAC clone RP24-167J1 from chromosome...	40	6.7
342	gb|AC145267.5| Mus musculus BAC clone RP24-161F7 from chromosome...	40	6.7
343	gb|AC129209.4| Mus musculus BAC clone RP24-318B5 from chromosome...	40	6.7
344	gb|L25599.1| Caenorhabditis elegans cosmid F54H12, complete sequ...	40	6.7
345	gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chrom...	40	6.7
346	gb|AC145346.3| Mus musculus BAC clone RP24-76G8 from chromosome ...	40	6.7
347	gb|AC140401.4| Mus musculus BAC clone RP24-89O8 from chromosome ...	40	6.7
348	gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosom...	40	6.7
349	gb|AC145742.3| Mus musculus BAC clone RP24-225F21 from chromosom...	40	6.7
350	gb|AC142265.4| Mus musculus BAC clone RP24-360F24 from chromosom...	40	6.7
351	gb|AC183681.2| Pan troglodytes BAC clone CH251-278I15 from chrom...	40	6.7
352	gb|AC184101.1| Mus musculus BAC clone RP24-534I7 from chromosome...	40	6.7
353	gb|AC102333.10| Mus musculus chromosome 18, clone RP24-542P12, c...	40	6.7
354	emb|AJ249596.1|ATH249596 Arabidopsis thaliana mRNA for elongatio...	40	6.7
355	ref|NM_001030147.1| Danio rerio zgc:114052 (zgc:114052), mRNA	40	6.7
356	gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, com...	40	6.7
357	gb|AC147126.2| Mus musculus BAC clone RP24-561J22 from chromosom...	40	6.7
358	gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosom...	40	6.7
359	gb|AC144582.3| Mus musculus BAC clone RP24-323J22 from chromosom...	40	6.7
360	gb|AC140678.2| Mus musculus BAC clone RP24-553I16 from chromosom...	40	6.7
361	gb|AC142412.3| Mus musculus BAC clone RP24-75E18 from chromosome...	40	6.7
362	gb|AC130834.4| Mus musculus BAC clone RP24-119M1 from chromosome...	40	6.7
363	gb|AC140439.3| Mus musculus BAC clone RP24-172C23 from chromosom...	40	6.7
364	gb|AC140427.3| Mus musculus BAC clone RP24-173G7 from chromosome...	40	6.7
365	gb|AC144855.3| Mus musculus BAC clone RP24-179H2 from chromosome...	40	6.7
366	gb|AC140394.3| Mus musculus BAC clone RP24-181E19 from chromosom...	40	6.7
367	gb|AC147159.2| Mus musculus BAC clone RP24-259B7 from chromosome...	40	6.7
368	gb|AC144552.3| Mus musculus BAC clone RP24-271M6 from chromosome...	40	6.7
369	gb|AC145564.4| Mus musculus BAC clone RP24-482K19 from chromosom...	40	6.7
370	gb|AC140474.3| Mus musculus BAC clone RP24-406O7 from chromosome...	40	6.7
371	gb|AC144409.3| Mus musculus BAC clone RP24-302I24 from chromosom...	40	6.7
372	gb|AC135808.4| Mus musculus BAC clone RP24-316N5 from chromosome...	40	6.7
373	gb|AC141470.4| Mus musculus BAC clone RP24-566E24 from chromosom...	40	6.7
374	ref|XM_381184.1| Gibberella zeae PH-1 chromosome 1 hypothetical ...	40	6.7
375	ref|XM_570842.1| Cryptococcus neoformans var. neoformans JEC21 h...	40	6.7
376	gb|AC106738.3| Homo sapiens chromosome 16 clone CTD-3032H12, com...	40	6.7
377	gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complet...	40	6.7
378	emb|CR693558.2|CNS0FY3M Tetraodon nigroviridis full-length cDNA	40	6.7
379	gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, c...	40	6.7
380	gb|AC175493.3| Mus musculus BAC clone RP24-70B12 from chromosome...	40	6.7
381	emb|AL158080.21| Human DNA sequence from clone RP13-399N6 on chr...	40	6.7
382	gb|AC175667.3| Mus musculus BAC clone RP24-372I14 from chromosom...	40	6.7
383	gb|AC046185.14| Homo sapiens chromosome 17, clone RP11-51F16, co...	40	6.7
384	emb|AL080315.18|HSDJ6P5 Human DNA sequence from clone RP1-6P5 on...	40	6.7
385	emb|AL078602.14|HSJ360M22 Human DNA sequence from clone RP3-360M...	40	6.7
386	gb|AC161175.5| Mus musculus chromosome 18, clone RP23-2J13, comp...	40	6.7
387	gb|AC142409.4| Mus musculus BAC clone RP24-185L20 from chromosom...	40	6.7
388	gb|AC098614.3| Homo sapiens chromosome 3 clone RP11-222K16, comp...	40	6.7
389	gb|AC184103.1| Mus musculus chromosome UNK clone CH35-73N5, comp...	40	6.7
390	gb|AC182253.3| Mus musculus BAC clone RP24-320A8 from chromosome...	40	6.7
391	gb|AC182448.2| Mus musculus BAC clone RP24-490J20 from chromosom...	40	6.7
392	gb|AC179922.3| Mus musculus BAC clone RP24-571K5 from chromosome...	40	6.7
393	gb|AC103706.2| Homo sapiens chromosome 8, clone RP11-629O1, comp...	40	6.7
394	gb|AC182761.2| Mus musculus BAC clone RP24-91P5 from chromosome ...	40	6.7
395	gb|AC175744.2| Mus musculus BAC clone RP24-163J18 from chromosom...	40	6.7
396	gb|AC093608.3| Homo sapiens BAC clone RP11-700C8 from 4, complet...	40	6.7
397	gb|AC079925.6| Homo sapiens BAC clone RP11-544E17 from 4, comple...	40	6.7
398	gb|BT024774.1| Arabidopsis thaliana At5g12110 mRNA, complete cds	40	6.7
399	gb|AC175818.2| Mus musculus BAC clone RP24-566J3 from chromosome...	40	6.7
400	gb|AF366456.1|AF366456 Allium cepa clone API063 maintainer line ...	40	6.7
401	gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255...	40	6.7
402	gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome...	40	6.7
403	gb|AF129078.2|AF129078 Homo sapiens chromosome 21 clone PAC B222...	40	6.7
404	ref|NM_070415.3| Caenorhabditis elegans Y41E3.10 (Y41E3.10) mRNA...	40	6.7
405	ref|NM_066336.2| Caenorhabditis elegans F54H12.6 (F54H12.6) mRNA...	40	6.7
406	gb|AC175461.3| Mus musculus BAC clone RP24-64J17 from chromosome...	40	6.7
407	gb|AC175710.2| Mus musculus BAC clone RP24-44O16 from chromosome...	40	6.7
408	emb|BX908741.7| Mouse DNA sequence from clone RP23-189F6 on chro...	40	6.7
409	gb|AC090524.1|AC090524 Caenorhabditis briggsae cosmid CB019H23, ...	40	6.7
410	gb|AC159235.2| Mus musculus BAC clone RP24-432L4 from chromosome...	40	6.7
411	gb|AC145572.4| Mus musculus BAC clone RP24-95P13 from chromosome...	40	6.7
412	gb|AC009107.11| Homo sapiens chromosome 16 clone RP11-459F6, com...	40	6.7
413	gb|AC139712.1| Homo sapiens BAC clone RP11-754G3 from 2, complet...	40	6.7
414	ref|XM_343580.2| PREDICTED: Rattus norvegicus eukaryotic transla...	40	6.7
415	gb|BT002990.1| Arabidopsis thaliana clone RAFL15-16-K06 (R20516)...	40	6.7
416	gb|AC173708.4| Mus musculus BAC clone RP24-140O8 from chromosome...	40	6.7
417	gb|AC175389.2| Mus musculus BAC clone RP24-152N3 from chromosome...	40	6.7
418	ref|NM_001005596.1| Danio rerio zgc:103635 (zgc:103635), mRNA	40	6.7
419	gb|AC175033.2| Mus musculus BAC clone RP24-283I7 from chromosome...	40	6.7
420	dbj|AP004006.5| Oryza sativa (japonica cultivar-group) genomic D...	40	6.7
421	dbj|AP004259.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.7
422	emb|BX255896.4| Zebrafish DNA sequence from clone CH211-249O11 i...	40	6.7
423	gb|BC081476.1| Danio rerio im:7233939, mRNA (cDNA clone IMAGE:72...	40	6.7
424	emb|AL954170.4| Mouse DNA sequence from clone RP23-467H15 on chr...	40	6.7
425	dbj|AB007727.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	6.7
426	gb|AF212832.5| Homo sapiens chromosome 8 clone CTC-806C5 map 8q2...	40	6.7
427	gb|AF155238.4| Homo sapiens chromosome 8 clone GS1-180I23 map 8q...	40	6.7
428	emb|AJ249598.1|ATH249598 Arabidopsis thaliana mRNA for elongatio...	40	6.7
429	gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete se...	40	6.7
430	gb|AF207955.1|AF207955 Homo sapiens chromosome 21q22.1 PAC N2139...	40	6.7
431	emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047	40	6.7
432	gb|AC005877.3|AC005877 citb_19_o_18, complete sequence	40	6.7
433	emb|AL929003.17| Zebrafish DNA sequence from clone DKEY-235D18 i...	40	6.7
434	emb|CR388084.7| Zebrafish DNA sequence from clone CH211-234D12 i...	40	6.7
435	gb|AC007073.2|AC007073 Homo sapiens chromosome 4 clone C0310G15 ...	40	6.7
436	dbj|AP000642.5| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	6.7
437	emb|Z95559.1|CEY41E3 Caenorhabditis elegans YAC Y41E3, complete ...	40	6.7
438	gb|DQ306840.1| Hevea brasiliensis isolate SSH111 mRNA sequence	40	6.7
439	gb|DQ306812.1| Hevea brasiliensis isolate SSH83 mRNA sequence	40	6.7
440	gb|AC142490.3| Mus musculus BAC clone RP24-362J19 from Y, comple...	40	6.7
441	gb|AC145575.3| Mus musculus BAC clone RP24-103M14 from Y, comple...	40	6.7
442	gb|AC140421.4| Mus musculus BAC clone RP24-441H14 from Y, comple...	40	6.7
443	gb|AC131661.4| Mus musculus BAC clone RP23-251N10 from 1, comple...	40	6.7
444	dbj|AP005638.2| Homo sapiens genomic DNA, chromosome 11 clone:CM...	40	6.7
445	emb|AL772282.9| Mouse DNA sequence from clone RP23-328F3 on chro...	40	6.7

---

>dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation factor 1 beta', complete cds
          Length = 884

 Score =  561 bits (283), Expect = e-157
 Identities = 343/360 (95%), Gaps = 6/360 (1%)
 Strand = Plus / Minus

                                                                       
Query: 134 accaatcccagtaccaagaatccagcagcaacaggtgagcggacaaagattctagatctt 193
           ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 704 accaatcccagtaccaagaatccagcagcaacaggtgggcgaacaaagattctagatctt 645

                                                                       
Query: 194 gttgaaggcaacgatgtcacacgactggacgtactcgttgatgggcgcctcgcagagcac 253
           |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 644 gttgaaggcaacgatgtcacacgactggacatactcgttgatgggcgcctcacagagcac 585

                                                                       
Query: 254 ttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggag 313
           ||||||||| || ||||||||  |    ||||| || |||||||||||||||||||||||
Sbjct: 584 ttcctcaat-ag-gtgtcgacgca----aggtcgtcgatgatcgtcagcatgatctggag 531

                                                                       
Query: 314 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 373
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 530 cttcttgatgccataacccacaggcataagcttagatgcaccccaggtgagaccctccat 471

                                                                       
Query: 374 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 470 ttgaacactgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 411

                                                                       
Query: 434 gatgtccatgaggacagaggatttgccactttctttcttctttgcaggcttggcagcctc 493
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 gatgtccatgaggacggaggatttgccactttctttcttctttgcaggcttggcagcctc 351



 Score =  196 bits (99), Expect = 5e-47
 Identities = 121/127 (95%), Gaps = 1/127 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtttcgcc-ttacaaactgctcagcaattcaactatttaaaggtaacagacattcaag 59
           |||||||||| |||||||| ||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 848 atgtttcgccattacaaaccgctcagcaattcaactatttaaaggtagcaggcattcaag 789

                                                                       
Query: 60  accagggcttgactcaaaaacaaaaccagtagcatttctgtaagaggggtaactaaatgg 119
           |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 788 accagggcatcactcaaaaacaaaaccagtagcatttctgtaagaggggtaactaaatgg 729

                  
Query: 120 gacgaca 126
           |||||||
Sbjct: 728 gacgaca 722

---

>ref|NM_186038.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 998

 Score =  192 bits (97), Expect = 7e-46
 Identities = 178/205 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 333 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 392
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                                       
Query: 393 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 452
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 501

                                    
Query: 453 gatttgccactttctttcttctttg 477
           ||||| || ||||||||||||||||
Sbjct: 500 gattttccgctttctttcttctttg 476

---

>ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group), P0453E03.111 mRNA
          Length = 1000

 Score =  192 bits (97), Expect = 7e-46
 Identities = 178/205 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 333 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 392
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                                       
Query: 393 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 452
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 503

                                    
Query: 453 gatttgccactttctttcttctttg 477
           ||||| || ||||||||||||||||
Sbjct: 502 gattttccgctttctttcttctttg 478

---

>dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107E20, full
           insert sequence
          Length = 1028

 Score =  192 bits (97), Expect = 7e-46
 Identities = 178/205 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 683 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 624

                                                                       
Query: 333 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 392
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 623 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 564

                                                                       
Query: 393 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 452
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 563 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 504

                                    
Query: 453 gatttgccactttctttcttctttg 477
           ||||| || ||||||||||||||||
Sbjct: 503 gattttccgctttctttcttctttg 479

---

>dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001M09, full
           insert sequence
          Length = 998

 Score =  192 bits (97), Expect = 7e-46
 Identities = 178/205 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 333 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 392
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                                       
Query: 393 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 452
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 501

                                    
Query: 453 gatttgccactttctttcttctttg 477
           ||||| || ||||||||||||||||
Sbjct: 500 gattttccgctttctttcttctttg 476

---

>dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-B01, full
           insert sequence
          Length = 1000

 Score =  192 bits (97), Expect = 7e-46
 Identities = 178/205 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 333 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 392
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                                       
Query: 393 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 452
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 503

                                    
Query: 453 gatttgccactttctttcttctttg 477
           ||||| || ||||||||||||||||
Sbjct: 502 gattttccgctttctttcttctttg 478

---

>dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta', complete cds
          Length = 956

 Score =  192 bits (97), Expect = 7e-46
 Identities = 178/205 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 641 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 582

                                                                       
Query: 333 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 392
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 581 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 522

                                                                       
Query: 393 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 452
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 521 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 462

                                    
Query: 453 gatttgccactttctttcttctttg 477
           ||||| || ||||||||||||||||
Sbjct: 461 gattttccgctttctttcttctttg 437

---

>gb|BT016181.1| Zea mays clone Contig14 mRNA sequence
          Length = 1084

 Score =  149 bits (75), Expect = 1e-32
 Identities = 138/159 (86%)
 Strand = Plus / Minus

                                                                       
Query: 314 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 373
           |||||||||||| || || |||||||  ||||| ||||| ||||| || |||||||||||
Sbjct: 628 cttcttgatgccgtatccaacaggcacaagctttgatgctccccaagtcagaccctccat 569

                                                                       
Query: 374 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
            || |||| ||||||||||||||||| ||||||||| |||||||||||||||||||| ||
Sbjct: 568 ctggacactgcggacagcctcctccagcttcttcatatcagtctcatcgtcccatggttt 509

                                                  
Query: 434 gatgtccatgaggacagaggatttgccactttctttctt 472
            |  ||||| ||||| |||||||| ||||||||||||||
Sbjct: 508 tacatccataaggacggaggatttaccactttctttctt 470



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 184 tctagatcttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggc 239
           |||||||||||||||| || || ||||| ||   |||||||||||| |||||||||
Sbjct: 758 tctagatcttgttgaaagccacaatgtcgcaactctggacgtactcattgatgggc 703

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                            
Query: 349      atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 408
                |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 27890071 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 27890012

                                                                 
Query: 409      tgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggattt 457
                | |||||||| ||||||||||| ||||  ||||  |||||||| |||||
Sbjct: 27890011 tatcagtctcgtcgtcccatggtttgacatccaacaggacagatgattt 27889963



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                            
Query: 273      acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
                |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 27890238 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 27890179

                       
Query: 333      acaggca 339
                |||||||
Sbjct: 27890178 acaggca 27890172



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 406      tcatgtcagtctcatcgtcccatggcttga 435
                ||||||||||||||||||||||||| ||||
Sbjct: 25261256 tcatgtcagtctcatcgtcccatggtttga 25261285



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 455      tttgccactttctttcttct 474
                ||||||||||||||||||||
Sbjct: 18633489 tttgccactttctttcttct 18633470

---

>dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E03
          Length = 159980

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                         
Query: 349   atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 408
             |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 53429 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 53370

                                                              
Query: 409   tgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggattt 457
             | |||||||| ||||||||||| ||||  ||||  |||||||| |||||
Sbjct: 53369 tatcagtctcgtcgtcccatggtttgacatccaacaggacagatgattt 53321



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                         
Query: 273   acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 332
             |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 53596 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 53537

                    
Query: 333   acaggca 339
             |||||||
Sbjct: 53536 acaggca 53530

---

>gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence
          Length = 951

 Score =  117 bits (59), Expect = 4e-23
 Identities = 134/159 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 373
           |||||||||||| || || ||||| |  ||||| ||||| ||||| || |||||||||||
Sbjct: 615 cttcttgatgccgtatccaacagggacaagctttgatgctccccaagtcagaccctccat 556

                                                                       
Query: 374 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
            || |||| | ||||||||||||||| ||||||||| |||||||||||||||||||| ||
Sbjct: 555 ctggacactggggacagcctcctccagcttcttcatatcagtctcatcgtcccatggttt 496

                                                  
Query: 434 gatgtccatgaggacagaggatttgccactttctttctt 472
            |  ||||| ||| | |||||||| ||||| ||||||||
Sbjct: 495 tacatccataaggccggaggatttcccactctctttctt 457

---

>emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elongation factor 1 beta
           (eEF1Bbeta 25 gene)
          Length = 1000

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagcttc 317
           ||||| |||||||| ||||| || |||||||||||||| |||| ||| ||||||||||||
Sbjct: 701 tcaatcagagtgtcaacagagacaaggtcatcaatgatggtcatcataatctggagcttc 642

                                                    
Query: 318 ttgatgccataacccacaggcatgagcttagatgcacccca 358
           ||||||||||| || || ||||||||||| || ||||||||
Sbjct: 641 ttgatgccatatccaactggcatgagcttggaagcacccca 601



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 186 tagatcttgttgaaggcaacgatgtcacacgactggacgtactcgtt 232
           ||||| |||||||||||||| ||||||||   ||||| |||||||||
Sbjct: 773 tagattttgttgaaggcaacaatgtcacagctctggatgtactcgtt 727

---

>gb|BT016185.1| Zea mays clone Contig18 mRNA sequence
          Length = 1070

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 197/249 (79%)
 Strand = Plus / Minus

                                                                       
Query: 185 ctagatcttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggcgcctc 244
           ||||||||||||||||||||| ||||| ||   ||| ||||||||||| |  ||| |  |
Sbjct: 821 ctagatcttgttgaaggcaactatgtcgcagctctgcacgtactcgttcactggctcagc 762

                                                                       
Query: 245 gcagagcacttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcat 304
           ||| ||    ||||||||||||||||||||||| || ||||| || | ||| |||| |||
Sbjct: 761 gcacagatagtcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcat 702

                                                                       
Query: 305 gatctggagcttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgag 364
           ||| || ||||||||||| ||||| || || || |  ||||| ||||| ||||||   ||
Sbjct: 701 gatttgcagcttcttgataccatatccaactgggacaagcttggatgcgccccagagcag 642

                                                                       
Query: 365 accctccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtc 424
            || ||||| || ||||  |  ||||| ||||| | |||   ||||||||||||||||||
Sbjct: 641 cccttccatctggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtc 582

                    
Query: 425 ccatggctt 433
           |||||||||
Sbjct: 581 ccatggctt 573

---

>gb|BT016424.1| Zea mays clone Contig257 mRNA sequence
          Length = 1064

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 144/179 (80%)
 Strand = Plus / Minus

                                                                       
Query: 255 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 314
           ||||||||||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 723 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 664

                                                                       
Query: 315 ttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccatt 374
           |||||||| ||||| || || || |  ||||| ||||| ||||||   || || ||||| 
Sbjct: 663 ttcttgataccatatccaactgggacaagcttggatgcgccccagagcagcccttccatc 604

                                                                      
Query: 375 tgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
           || ||||  |  ||||| ||||| | |||   |||||||||||||||||||||||||||
Sbjct: 603 tggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcccatggctt 545

---

>gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence
          Length = 459

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||| |||||||||||||   |||||||||| |||||||| ||||||||||| | 
Sbjct: 308 aacactgcgaacagcctcctccagtctcttcatgtcggtctcatcatcccatggcttaac 249

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| |||||||| || ||||| |||||
Sbjct: 248 atccatgagcacagaggactttccactctcttt 216

---

>gb|AY103717.1| Zea mays PCO098989 mRNA sequence
          Length = 1312

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 185 ctagatcttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggcgcctc 244
           ||||||||||||||||||||| ||||| ||   ||| ||||||||||| |  ||| |  |
Sbjct: 987 ctagatcttgttgaaggcaactatgtcgcaactctgtacgtactcgttaactggctcagc 928

                                                                       
Query: 245 gcagagcacttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcat 304
           ||| ||    ||||||||||||||||||||||| || ||||| || | ||| |||| |||
Sbjct: 927 gcacagatagtcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcat 868

                                   
Query: 305 gatctggagcttcttgatgccata 328
           ||| || ||||||||||| |||||
Sbjct: 867 gatttgcagcttcttgataccata 844



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 407 catgtcagtctcatcgtcccatggctt 433
           |||||||||||||||||||||||||||
Sbjct: 765 catgtcagtctcatcgtcccatggctt 739

---

>gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated protein
           DDTFR10-like mRNA, complete cds
          Length = 928

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 405 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 464
           ||||| ||||||||||| |||||||||||||  |||||||| || ||||| ||||||  |
Sbjct: 541 ttcatatcagtctcatcatcccatggcttgacatccatgagaactgaggacttgccagat 482

                      
Query: 465 tctttcttctt 475
           |||||||||||
Sbjct: 481 tctttcttctt 471

---

>gb|AY480020.1| Capsicum annuum putative elongation factor 1B alpha-subunit mRNA,
           partial sequence
          Length = 728

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttc 404
           |||||||| ||||||   ||||| ||||| | ||||| ||| ||||||||||| |  |||
Sbjct: 577 ttagatgctccccagagaagaccttccatctcaacactgcgaacagcctcctcaagtttc 518

                                                                       
Query: 405 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 464
           ||||||||||| || || ||||| ||||| | |||||| || ||||| || || ||||| 
Sbjct: 517 ttcatgtcagtttcgtcatcccaaggcttaacgtccataagaacagatgactttccactc 458

                      
Query: 465 tctttcttctt 475
           |||||||||||
Sbjct: 457 tctttcttctt 447

---

>gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulated protein DDTFR10
           (DDTFR10) mRNA, complete cds
          Length = 988

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 405 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 464
           ||||| || |||||||| |||||||||||||  |||||||| |||||||| ||||||  |
Sbjct: 523 ttcatatcggtctcatcatcccatggcttgacatccatgagaacagaggacttgccagat 464

                      
Query: 465 tctttcttctt 475
           |||||||||||
Sbjct: 463 tctttcttctt 453



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 192 ttgttgaaggcaacgatgtcacacgactggacgtactcgttgat 235
           |||||||| ||||| ||||||||   ||| ||||||||||||||
Sbjct: 737 ttgttgaaagcaacaatgtcacaactctgaacgtactcgttgat 694

---

>gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongation factor 1B
           alpha-subunit0like mRNA, complete cds
          Length = 957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 369 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 428
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 545 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 486

                                                          
Query: 429 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 475
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 485 ggcttaacgtccataagaacggatgactttccactctctttcttctt 439



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 192 ttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggc 239
           |||||||||||||| || |||||   ||||||||| ||||||||||||
Sbjct: 722 ttgttgaaggcaacaatatcacagctctggacgtattcgttgatgggc 675

---

>gb|DQ191626.1| Solanum tuberosum unknown mRNA
          Length = 1088

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 369 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 428
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 529 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 470

                                                          
Query: 429 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 475
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 469 ggcttaacgtccataagaacggatgactttccactctctttcttctt 423



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 192 ttgttgaaggcaacgatgtcacacgactggacgtactcgttgatgggc 239
           |||||||||||||| || |||||   ||||||||| ||||||||||||
Sbjct: 706 ttgttgaaggcaacaatatcacagctctggacgtattcgttgatgggc 659

---

>dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongation factor, complete
           cds
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 386 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgag 445
           |||||||||||| |  |||| |||||| |||||||| |||||||| ||||  ||||  ||
Sbjct: 538 gacagcctcctcaagtttctgcatgtccgtctcatcatcccatggtttgacatccaatag 479

                                      
Query: 446 gacagaggatttgccactttctttctt 472
            ||||| ||||| ||||||||||||||
Sbjct: 478 aacagaagattttccactttctttctt 452

---

>emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5, COMPLETE SEQUENCE
          Length = 210708

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 387    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
              |||||||| |||| |||||||||||| |||||||| |||||||||||
Sbjct: 171387 acagcctcttccagcttcttcatgtctgtctcatcatcccatggctt 171433



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 387    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
              ||||| || |||| ||||||||| || |||||||| |||||||||||
Sbjct: 158087 acagcttcttccagcttcttcatatctgtctcatcatcccatggctt 158133



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 285    tcatcaatgatcgtcagcatgatctggagcttcttgat 322
              |||||||| || |||| ||||||||| |||||||||||
Sbjct: 171154 tcatcaataatggtcaacatgatctgcagcttcttgat 171191

---

>gb|AY111648.1| Zea mays CL2935_1 mRNA sequence
          Length = 1119

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 255 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 314
           ||||| ||||||||||| ||||| || |||||||| |  || |||| |||||| || |||
Sbjct: 391 tcctcgatgagagtgtcaacagagacaaggtcatcgacaatggtcatcatgatttgcagc 450

                         
Query: 315 ttcttgatgccata 328
           ||||||||||||||
Sbjct: 451 ttcttgatgccata 464



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 407 catgtcagtctcatcgtcccatggctt 433
           |||||||||||||||||||||||||||
Sbjct: 543 catgtcagtctcatcgtcccatggctt 569

---

>ref|NM_121956.2| Arabidopsis thaliana translation elongation factor AT5G19510 mRNA,
           complete cds
          Length = 945

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 557 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 498

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 497 atccatgagcacagaagactttccactctcttt 465

---

>emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongation factor 1B alpha-subunit
           (eEF1Balpha2 gene)
          Length = 680

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 485 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 426

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 425 atccatgagcacagaagactttccactctcttt 393

---

>gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 706

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 483 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 424

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 423 atccatgagcacagaagactttccactctcttt 391

---

>gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 881

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 522 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 463

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 462 atccatgagcacagaagactttccactctcttt 430

---

>emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB73ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 820

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 453 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 394

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 393 atccatgagtacagaagactttccactctcttt 361

---

>emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZA05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 481

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 480 atccatgagcacagaagactttccactctcttt 448

---

>emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 498 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 439

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 438 atccatgagcacagaagactttccactctcttt 406

---

>emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH19ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 868

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 481

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 480 atccatgagcacagaagactttccactctcttt 448

---

>emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZF03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 712

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 369 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttcac 310

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 309 atccatgagcacagaagactttccactctcttt 277

---

>gb|AY909456.1| Siniperca chuatsi clone C279 translation elongation factor eEF-1
           delta mRNA, partial cds
          Length = 391

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 305 gatctggagcttcttgatgccataacccacagg 337
           ||||||||||||||||||||| |||||||||||
Sbjct: 191 gatctggagcttcttgatgccgtaacccacagg 159

---

>gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete sequence
          Length = 849

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 377 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 497 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 438

                                            
Query: 437 gtccatgaggacagaggatttgccactttcttt 469
            |||||||| ||||| || || ||||| |||||
Sbjct: 437 atccatgagcacagaagactttccactctcttt 405

---

>ref|NM_127367.1| Arabidopsis thaliana translation elongation factor AT2G18110 mRNA,
           complete cds
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 775 atcttgttgaaggcaacaatgtcaca 750

---

>emb|BX071583.1|CNS09REB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 366 cttcatgtcggtttcatcgtcccatggcttgatgtc 401

---

>emb|BX071358.1|CNS09R82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 490 cttcatgtcggtttcatcgtcccatggcttgatgtc 525

---

>emb|BX071357.1|CNS09R81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 776 cttcatgtcggtttcatcgtcccatggcttgatgtc 741

---

>emb|BX068711.1|CNS09P6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 529

---

>emb|BX068710.1|CNS09P6I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746

---

>emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 775 cttcatgtcggtttcatcgtcccatggcttgatgtc 740

---

>emb|BX063619.1|CNS09L93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 301 cttcatgtcggtttcatcgtcccatggcttgatgtc 336

---

>emb|BX063618.1|CNS09L92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 85  cttcatgtcggtttcatcgtcccatggcttgatgtc 50

---

>emb|BX063276.1|CNS09KZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 363 cttcatgtcggtttcatcgtcccatggcttgatgtc 398

---

>emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX053674.1|CNS09DKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX053673.1|CNS09DKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX052417.1|CNS09CLX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 352 cttcatgtcggtttcatcgtcccatggcttgatgtc 387

---

>emb|BX052416.1|CNS09CLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 760 cttcatgtcggtttcatcgtcccatggcttgatgtc 725

---

>emb|BX052150.1|CNS09CEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 323 cttcatgtcggtttcatcgtcccatggcttgatgtc 358

---

>emb|BX052149.1|CNS09CEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 736 cttcatgtcggtttcatcgtcccatggcttgatgtc 701

---

>emb|BX052078.1|CNS09CCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 498 cttcatgtcggtttcatcgtcccatggcttgatgtc 533

---

>emb|BX052058.1|CNS09CBY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 813 cttcatgtcggtttcatcgtcccatggcttgatgtc 778

---

>emb|BX047220.1|CNS098LK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 140 cttcatgtcggtttcatcgtcccatggcttgatgtc 175

---

>emb|BX047219.1|CNS098LJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 743 cttcatgtcggtttcatcgtcccatggcttgatgtc 708

---

>emb|BX046233.1|CNS097U5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 615 cttcatgtcggtttcatcgtcccatggcttgatgtc 650

---

>emb|BX046232.1|CNS097U4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 786 cttcatgtcggtttcatcgtcccatggcttgatgtc 751

---

>emb|BX042348.1|CNS094U8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 598 cttcatgtcggtttcatcgtcccatggcttgatgtc 633

---

>emb|BX042347.1|CNS094U7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 521 cttcatgtcggtttcatcgtcccatggcttgatgtc 486

---

>emb|BX041605.1|CNS0949L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 245 cttcatgtcggtttcatcgtcccatggcttgatgtc 280

---

>emb|BX041604.1|CNS0949K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX041307.1|CNS0941B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 572

---

>emb|BX039708.1|CNS092SW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 258 cttcatgtcggtttcatcgtcccatggcttgatgtc 293

---

>emb|BX039707.1|CNS092SV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 279 cttcatgtcggtttcatcgtcccatggcttgatgtc 244

---

>emb|BX037290.1|CNS090XQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX036523.1|CNS090CF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 112

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 9   cttcatgtcggtttcatcgtcccatggcttgatgtc 44

---

>emb|BX036522.1|CNS090CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 102

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 61  cttcatgtcggtttcatcgtcccatggcttgatgtc 26

---

>emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 459

---

>emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 479 cttcatgtcggtttcatcgtcccatggcttgatgtc 514

---

>emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562

---

>emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 594 cttcatgtcggtttcatcgtcccatggcttgatgtc 629

---

>emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 469 cttcatgtcggtttcatcgtcccatggcttgatgtc 504

---

>emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 752 cttcatgtcggtttcatcgtcccatggcttgatgtc 717

---

>emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|BX032179.1|CNS08WZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 599 cttcatgtcggtttcatcgtcccatggcttgatgtc 634

---

>emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 586 cttcatgtcggtttcatcgtcccatggcttgatgtc 551

---

>emb|BX032163.1|CNS08WZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 555 cttcatgtcggtttcatcgtcccatggcttgatgtc 590

---

>emb|BX029545.1|CNS08UYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 550 cttcatgtcggtttcatcgtcccatggcttgatgtc 585

---

>emb|BX029544.1|CNS08UYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746

---

>emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 81  cttcatgtcggtttcatcgtcccatggcttgatgtc 116

---

>emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 309 cttcatgtcggtttcatcgtcccatggcttgatgtc 344

---

>emb|BX027135.1|CNS08T3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638

---

>emb|BX027134.1|CNS08T3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX026630.1|CNS08SPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 600 cttcatgtcggtttcatcgtcccatggcttgatgtc 635

---

>emb|BX026629.1|CNS08SPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX026387.1|CNS08SIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|BX026386.1|CNS08SIU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 445 cttcatgtcggtttcatcgtcccatggcttgatgtc 410

---

>emb|BX025444.1|CNS08RSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 500 cttcatgtcggtttcatcgtcccatggcttgatgtc 535

---

>emb|BX025443.1|CNS08RSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753

---

>emb|BX024401.1|CNS08QZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640

---

>emb|BX024400.1|CNS08QZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 780 cttcatgtcggtttcatcgtcccatggcttgatgtc 745

---

>emb|BX023680.1|CNS08QFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562

---

>emb|BX023679.1|CNS08QFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 806 cttcatgtcggtttcatcgtcccatggcttgatgtc 771

---

>emb|BX019648.1|CNS08NBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 380 cttcatgtcggtttcatcgtcccatggcttgatgtc 415

---

>emb|BX019647.1|CNS08NBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 797 cttcatgtcggtttcatcgtcccatggcttgatgtc 762

---

>emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753

---

>emb|BX018057.1|CNS08M3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 437 cttcatgtcggtttcatcgtcccatggcttgatgtc 472

---

>emb|BX018056.1|CNS08M3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 288 cttcatgtcggtttcatcgtcccatggcttgatgtc 253

---

>emb|BX016732.1|CNS08L2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 618 cttcatgtcggtttcatcgtcccatggcttgatgtc 653

---

>emb|BX016731.1|CNS08L2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 624 cttcatgtcggtttcatcgtcccatggcttgatgtc 589

---

>emb|BX016339.1|CNS08KRR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 518 cttcatgtcggtttcatcgtcccatggcttgatgtc 553

---

>emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743

---

>emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 298 cttcatgtcggtttcatcgtcccatggcttgatgtc 333

---

>emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759

---

>emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 264 cttcatgtcggtttcatcgtcccatggcttgatgtc 299

---

>emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 655 cttcatgtcggtttcatcgtcccatggcttgatgtc 620

---

>emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 787 cttcatgtcggtttcatcgtcccatggcttgatgtc 752

---

>emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 606 cttcatgtcggtttcatcgtcccatggcttgatgtc 641

---

>emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX010493.1|CNS08G9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638

---

>emb|BX010492.1|CNS08G9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579

---

>emb|BX010211.1|CNS08G1J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743

---

>emb|BX010113.1|CNS08FYT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640

---

>emb|BX010112.1|CNS08FYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579

---

>emb|BX009646.1|CNS08FLU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 727 cttcatgtcggtttcatcgtcccatggcttgatgtc 692

---

>emb|BX008302.1|CNS08EKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 496 cttcatgtcggtttcatcgtcccatggcttgatgtc 531

---

>emb|BX008301.1|CNS08EKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759

---

>gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map PhyB, complete
             sequence
          Length = 57550

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 387   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
             ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 54608 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 54663



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 189   atcttgttgaaggcaacgatgtcaca 214
             ||||||||||||||||| ||||||||
Sbjct: 54410 atcttgttgaaggcaacaatgtcaca 54435

---

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
            sequence
          Length = 88149

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 387  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 2484 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 2539



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 189  atcttgttgaaggcaacgatgtcaca 214
            ||||||||||||||||| ||||||||
Sbjct: 2286 atcttgttgaaggcaacaatgtcaca 2311

---

>gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110)
           mRNA, complete cds
          Length = 805

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 494 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 439



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 692 atcttgttgaaggcaacaatgtcaca 667

---

>gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110;
           F8D23.11) mRNA, complete cds
          Length = 928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 575 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 520



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 773 atcttgttgaaggcaacaatgtcaca 748

---

>emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 920

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 564 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 509



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 762 atcttgttgaaggcaacaatgtcaca 737

---

>emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH52ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 544 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 489



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 742 atcttgttgaaggcaacaatgtcaca 717

---

>emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 523 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 468

---

>gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete sequence
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 775 atcttgttgaaggcaacaatgtcaca 750

---

>ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448
           (ENSANGG00000010959), partial mRNA
          Length = 717

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || |||||||||||||||||||||||
Sbjct: 507 cttcatgtcggtttcatcgtcccatggcttgatgtc 472

---

>gb|DQ191662.1| Solanum tuberosum elongation factor-like protein mRNA, complete cds
          Length = 903

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 369 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 428
           ||||| |||||||| || ||| |||||||||  |||||||| || || ||||| ||||| 
Sbjct: 552 tccatctgaacaccacgaacaacctcctccagtttcttcatatcggtttcatcatcccaa 493

                                                          
Query: 429 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 475
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 492 ggcttaacgtccataagaacggatgactttccactctctttcttctt 446

---

>emb|BX037291.1|CNS090XR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 743

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 405 ttcatgtcagtctcatcgtcccatggcttgatgtc 439
           |||||||| || |||||||||||||||||||||||
Sbjct: 608 ttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation factor 1 beta
          Length = 1996

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 387  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 441
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 1632 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatcca 1578



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 189  atcttgttgaaggcaacgatgtcaca 214
            ||||||||||||||||| ||||||||
Sbjct: 1830 atcttgttgaaggcaacaatgtcaca 1805

---

>gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1
          Length = 35369

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                        
Query: 377  aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
            |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 6435 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 6494

                           
Query: 437  gtccatgaggacaga 451
             |||||||| |||||
Sbjct: 6495 atccatgagcacaga 6509

---

>ref|NM_102762.2| Arabidopsis thaliana translation elongation factor AT1G30230 mRNA,
           complete cds
          Length = 1028

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 568 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 519



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 766 atcttgttgaaggcaacaatgtcaca 741

---

>ref|XM_479153.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 406 tcatgtcagtctcatcgtcccatggcttga 435
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 tctagatcttgttgaaggcaacgatgtc 211
           |||||||||||||||| ||||| |||||
Sbjct: 798 tctagatcttgttgaacgcaacaatgtc 771

---

>ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group), P0616D06.117 mRNA
          Length = 1363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 406 tcatgtcagtctcatcgtcccatggcttga 435
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 tctagatcttgttgaaggcaacgatgtc 211
           |||||||||||||||| ||||| |||||
Sbjct: 793 tctagatcttgttgaacgcaacaatgtc 766

---

>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 369   tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 428
             ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 11090 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 11149

                           
Query: 429   ggcttgatgtccat 442
             ||||| | ||||||
Sbjct: 11150 ggcttaacgtccat 11163



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 254   ttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctg 310
             |||||||||||| || || ||||| || |||||||| ||||| || |||||||||||
Sbjct: 10878 ttcctcaatgagggtatccacagagacaaggtcatcgatgatggtaagcatgatctg 10934

---

>emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 728

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 353 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 304



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 551 atcttgttgaaggcaacaatgtcaca 526

---

>emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 908

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 546 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 497



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 744 atcttgttgaaggcaacaatgtcaca 719

---

>emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH89ZB09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 559 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 510



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 757 atcttgttgaaggcaacaatgtcaca 732

---

>gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F12P21 genomic sequence, complete
             sequence
          Length = 55095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 387   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
             ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 19386 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 19337



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 189   atcttgttgaaggcaacgatgtcaca 214
             ||||||||||||||||| ||||||||
Sbjct: 19584 atcttgttgaaggcaacaatgtcaca 19559

---

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0616D06
          Length = 153800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 406   tcatgtcagtctcatcgtcccatggcttga 435
             ||||||||||||||||||||||||| ||||
Sbjct: 77927 tcatgtcagtctcatcgtcccatggtttga 77956

---

>dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongation factor 1 beta',
           complete cds
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtcca 441
           |||||||||||| ||||||||||| ||||||| |||||
Sbjct: 520 cttcatgtcagtttcatcgtcccagggcttgacgtcca 483

---

>dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023109L04, full
           insert sequence
          Length = 1364

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 406 tcatgtcagtctcatcgtcccatggcttga 435
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 tctagatcttgttgaaggcaacgatgtc 211
           |||||||||||||||| ||||| |||||
Sbjct: 793 tctagatcttgttgaacgcaacaatgtc 766

---

>dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C03, full
           insert sequence
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 406 tcatgtcagtctcatcgtcccatggcttga 435
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 tctagatcttgttgaaggcaacgatgtc 211
           |||||||||||||||| ||||| |||||
Sbjct: 798 tctagatcttgttgaacgcaacaatgtc 771

---

>dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-G07, full
           insert sequence
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 406 tcatgtcagtctcatcgtcccatggcttga 435
           ||||||||||||||||||||||||| ||||
Sbjct: 193 tcatgtcagtctcatcgtcccatggtttga 164



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 tctagatcttgttgaaggcaacgatgtc 211
           |||||||||||||||| ||||| |||||
Sbjct: 415 tctagatcttgttgaacgcaacaatgtc 388

---

>dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta, complete cds
          Length = 1420

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 406 tcatgtcagtctcatcgtcccatggcttga 435
           ||||||||||||||||||||||||| ||||
Sbjct: 556 tcatgtcagtctcatcgtcccatggtttga 527



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 tctagatcttgttgaaggcaacgatgtc 211
           |||||||||||||||| ||||| |||||
Sbjct: 778 tctagatcttgttgaacgcaacaatgtc 751

---

>ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4 (novel KRAB box
            containing C2H2 type zinc finger protein) (LOC465235),
            mRNA
          Length = 3627

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 407  catgtcagtctcatcgtcccatggcttga 435
            ||||||||||||||||||||| |||||||
Sbjct: 3492 catgtcagtctcatcgtcccaaggcttga 3464

---

>ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD19), mRNA
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 407  catgtcagtctcatcgtcccatggcttga 435
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204

---

>emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chromosome 9 Contains the 5'
              end of the gene for coiled-coil protein (BICD2) (KIAA0699),
              a novel gene, a eukaryotic translation elongation factor 1
              delta (guanine nucleotide exchange protein) (EEF1D)
              pseudogene, the gene for a novel KRAB box-containing C2H2
              type zinc finger protein, a novel gene, a pseudogene
              similar to part of sorting nexin associated golgi protein 1
              (SNAG1), a novel pseudogene, a melanoma antigen pseudogene
              and three CpG islands, complete sequence
          Length = 182280

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 407    catgtcagtctcatcgtcccatggcttga 435
              ||||||||||||||||||||| |||||||
Sbjct: 106674 catgtcagtctcatcgtcccaaggcttga 106702

---

>emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor 1-beta
          Length = 1069

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 386 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgag 445
           |||||| ||||| | |||||||||||| || ||||| ||||||||||| |  ||||  | 
Sbjct: 581 gacagcttcctcaagcttcttcatgtctgtttcatcatcccatggcttcacatccaacaa 522

                                                        
Query: 446 gacagaggatttgccactttctttcttctttgcaggcttggcagc 490
           ||| || || |||||   |||||||||||| |||||||| |||||
Sbjct: 521 gaccgatgacttgcccgattctttcttcttagcaggcttagcagc 477

---

>gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:27029
            IMAGE:4837806), complete cds
          Length = 2351

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 407  catgtcagtctcatcgtcccatggcttga 435
            ||||||||||||||||||||| |||||||
Sbjct: 1366 catgtcagtctcatcgtcccaaggcttga 1394

---

>dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534
          Length = 1899

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 407  catgtcagtctcatcgtcccatggcttga 435
            ||||||||||||||||||||| |||||||
Sbjct: 994  catgtcagtctcatcgtcccaaggcttga 1022

---

>emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 348 catgtcggtctcatcgtcccatggcttga 320

---

>emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504

---

>emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 405 catgtcggtctcatcgtcccatggcttga 377

---

>emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 584 catgtcggtctcatcgtcccatggcttga 556

---

>emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 82  catgtcggtctcatcgtcccatggcttga 54

---

>emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 551 catgtcggtctcatcgtcccatggcttga 523

---

>emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504

---

>emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| ||||||||||||||||||||||
Sbjct: 548 catgtcggtctcatcgtcccatggcttga 520

---

>gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:47831
            IMAGE:5733799), complete cds
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 407  catgtcagtctcatcgtcccatggcttga 435
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204

---

>ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM01189.1) partial mRNA
          Length = 678

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| |||||||| ||||| |||||||||||
Sbjct: 465 cttcatgtcggtctcatcatcccagggcttgatgtc 430

---

>emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 591 cttcatgtcggtttcatcgtcccatgccttgatgtc 626

---

>emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 404 cttcatgtcagtctcatcgtcccatggcttgatgtc 439
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 611 cttcatgtcggtttcatcgtcccatgccttgatgtc 576

---

>emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta
          Length = 900

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 401 cttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||||||||||||||||||| ||||| || |||||
Sbjct: 525 cttcttcatgtcagtctcatcatcccacggtttgat 490



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 737 atcttgttgaaggcaacaatgtcaca 712

---

>gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 183896

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 77   aaacaaaaccagtagcatttctgt 100
            ||||||||||||||||||||||||
Sbjct: 7442 aaacaaaaccagtagcatttctgt 7465

---

>emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH68ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 558

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 442
           ||||| ||||| | |||||||||||| || ||||| ||||| |||||||| |||||
Sbjct: 201 acagcttcctctagcttcttcatgtccgtttcatcatcccacggcttgatatccat 146



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 399 atcttgttgaaggcaacaatgtcaca 374

---

>gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translation elongation
           factor 1 beta 2 (EEF1B2) mRNA, complete cds
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 305 gatctggagcttcttgatgccataacccacaggca 339
           |||||| ||||||||||||||||| || |||||||
Sbjct: 850 gatctgcagcttcttgatgccatagccaacaggca 816

---

>gb|BC046042.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:56277 IMAGE:5602371), complete cds
          Length = 806

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 305 gatctggagcttcttgatgccataacccacaggca 339
           |||||| ||||||||||||||||| || |||||||
Sbjct: 633 gatctgcagcttcttgatgccatagccaacaggca 599

---

>gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosome Y, complete sequence
          Length = 147674

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 70    gactcaaaaacaaaaccagtagc 92
             |||||||||||||||||||||||
Sbjct: 97310 gactcaaaaacaaaaccagtagc 97332

---

>gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosome Y, complete sequence
          Length = 172606

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 70     gactcaaaaacaaaaccagtagc 92
              |||||||||||||||||||||||
Sbjct: 145559 gactcaaaaacaaaaccagtagc 145537

---

>gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome Y, complete sequence
          Length = 143481

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 70    gactcaaaaacaaaaccagtagc 92
             |||||||||||||||||||||||
Sbjct: 38840 gactcaaaaacaaaaccagtagc 38862

---

>emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in linkage group 6,
             complete sequence
          Length = 95528

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 305   gatctggagcttcttgatgccataacccacaggca 339
             |||||| ||||||||||||||||| || |||||||
Sbjct: 89778 gatctgcagcttcttgatgccatagccaacaggca 89812

---

>gb|AY444796.1| Pisum sativum translational elongation factor 1 subunit Bbeta
           (eEF1Bbeta) mRNA, complete cds
          Length = 709

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 401 cttcttcatgtcagtctcatcgtccca 427
           ||||||||||||||| |||||||||||
Sbjct: 493 cttcttcatgtcagtttcatcgtccca 467

---

>gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNING: chimeric clone
           ****
          Length = 996

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 451
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 695 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 636

                  
Query: 452 ggatttg 458
           |||||||
Sbjct: 635 ggatttg 629

---

>emb|BX029538.1|CNS08UYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 404 cttcatgtcagtctcatcgtcccatggcttg 434
           ||||||||| || ||||||||||||||||||
Sbjct: 604 cttcatgtcggtttcatcgtcccatggcttg 634

---

>emb|AJ237772.1|OLA237772 Oryzias latipes mRNA for elongation factor 1 beta, partial
          Length = 283

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 304 tgatctggagcttcttgatgccataacccac 334
           ||||||| |||||||||||||| ||||||||
Sbjct: 148 tgatctgcagcttcttgatgccgtaacccac 118

---

>ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
           (EF-1-delta), transcript variant 2 (LOC565501), mRNA
          Length = 753

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 451
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 576 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 517

                  
Query: 452 ggatttg 458
           |||||||
Sbjct: 516 ggatttg 510

---

>ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
            (EF-1-delta), transcript variant 1 (LOC565501), mRNA
          Length = 1479

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 392  ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 451
            |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 1196 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 1137

                   
Query: 452  ggatttg 458
            |||||||
Sbjct: 1136 ggatttg 1130

---

>ref|NM_199949.2| Danio rerio eukaryotic translation elongation factor 1 beta 2
           (eef1b2), mRNA
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 305 gatctggagcttcttgatgccataacccacaggca 339
           |||||| ||||||||||||||||| || |||||||
Sbjct: 850 gatctgcagcttcttgatgccatagccaacaggca 816

---

>gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complete sequence
          Length = 198224

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 70     gactcaaaaacaaaaccagtagc 92
              |||||||||||||||||||||||
Sbjct: 102524 gactcaaaaacaaaaccagtagc 102546

---

>gb|BC096865.1| Danio rerio cold inducible RNA binding protein, mRNA (cDNA clone
           MGC:111981 IMAGE:7401032), complete cds
          Length = 919

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 451
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 616 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 557

                  
Query: 452 ggatttg 458
           |||||||
Sbjct: 556 ggatttg 550

---

>gb|BC071464.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:86802 IMAGE:6901030), complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 305 gatctggagcttcttgatgccataacccacaggca 339
           |||||| ||||||||||||||||| || |||||||
Sbjct: 635 gatctgcagcttcttgatgccatagccaacaggca 601

---

>ref|XM_532345.2| PREDICTED: Canis familiaris similar to eukaryotic translation
            elongation factor 1 delta, transcript variant 1
            (LOC475115), mRNA
          Length = 1959

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 414  gtctcatcgtcccatggcttgatgtccatgagga 447
            |||||||||||||| ||||||| ||||| |||||
Sbjct: 1685 gtctcatcgtcccaaggcttgacgtccaggagga 1652

---

>ref|XM_851661.1| PREDICTED: Canis familiaris similar to eukaryotic translation
            elongation factor 1 delta, transcript variant 8
            (LOC475115), mRNA
          Length = 1890

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 414  gtctcatcgtcccatggcttgatgtccatgagga 447
            |||||||||||||| ||||||| ||||| |||||
Sbjct: 1616 gtctcatcgtcccaaggcttgacgtccaggagga 1583

---

>ref|XM_851616.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 7
           (LOC475115), mRNA
          Length = 930

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 414 gtctcatcgtcccatggcttgatgtccatgagga 447
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 656 gtctcatcgtcccaaggcttgacgtccaggagga 623

---

>ref|XM_851583.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 6
           (LOC475115), mRNA
          Length = 891

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 414 gtctcatcgtcccatggcttgatgtccatgagga 447
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 617 gtctcatcgtcccaaggcttgacgtccaggagga 584

---

>ref|XM_851537.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 5
           (LOC475115), mRNA
          Length = 912

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 414 gtctcatcgtcccatggcttgatgtccatgagga 447
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 641 gtctcatcgtcccaaggcttgacgtccaggagga 608

---

>ref|XM_851498.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 4
           (LOC475115), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 414 gtctcatcgtcccatggcttgatgtccatgagga 447
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 605 gtctcatcgtcccaaggcttgacgtccaggagga 572

---

>ref|XM_851462.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 3
           (LOC475115), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 414 gtctcatcgtcccatggcttgatgtccatgagga 447
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 605 gtctcatcgtcccaaggcttgacgtccaggagga 572

---

>emb|AL353136.21| Human DNA sequence from clone RP11-133K18 on chromosome X Contains a
              pyruvate kinase muscle (PKM2) pseudogene and the gene for
              ectodysplasin A2 isoform receptor (XEDAR), complete
              sequence
          Length = 192505

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 76     aaaacaaaaccagtagcatttctgta 101
              |||| |||||||||||||||||||||
Sbjct: 186554 aaaaaaaaaccagtagcatttctgta 186529

---

>gb|AY321330.1| Rattus norvegicus Ac2-067 mRNA, complete cds
          Length = 808

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
           |||||| | |||| ||||||| |||||||||||||| |||||
Sbjct: 664 ctcctcgagcttcgtcatgtctgtctcatcgtcccaaggctt 623

---

>emb|AJ291984.1|PFL291984 Platichthys flesus partial mRNA for translation elongation factor
           1-delta (ef1D gene)
          Length = 430

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 441
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||
Sbjct: 342 ctcctccagcttcgccatgtccgtctcatcgtcccaaggtttgacgtcca 293

---

>emb|AL645962.22| Mouse DNA sequence from clone RP23-217L7 on chromosome 11 Contains the
             Olfr54 gene for olfactory receptor 54, the gene for a
             novel protein (olfactory receptor MOR126-2 (MOR126-2)) and
             the Zfp354a gene for zinc finger protein 354A, complete
             sequence
          Length = 82484

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 149   aagaatccagcagcaacaggtg 170
             ||||||||||||||||||||||
Sbjct: 37065 aagaatccagcagcaacaggtg 37044

---

>emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23
          Length = 936

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 685 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 644

---

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 414    gtctcatcgtcccatggcttgatgtccatg 443
              ||||| |||||||||||||||| |||||||
Sbjct: 442596 gtctcgtcgtcccatggcttgacgtccatg 442625

---

>emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7
          Length = 820

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 652 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 611

---

>emb|AL116212.1|CNS01D0C Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 407 catgtcagtctcatcgtcccatggcttga 435
           |||||| |||| |||||||||||||||||
Sbjct: 405 catgtcggtctnatcgtcccatggcttga 377

---

>emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 699

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 189 atcttgttgaaggcaacgatgtcaca 214
           ||||||||||||||||| ||||||||
Sbjct: 534 atcttgttgaaggcaacaatgtcaca 509



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||||| | ||||||||||| ||||||||| ||||| || |||||
Sbjct: 336 acagcttcctcaagcttcttcatgtaagtctcatcatcccacggtttgat 287

---

>emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL6ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||||| | ||||||||||| ||||||||| ||||| || |||||
Sbjct: 517 acagcttcctcaagcttcttcatgtgagtctcatcatcccacggtttgat 468

---

>emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 895

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 387 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||| ||||| | ||||||||||||||| ||||| ||||| || |||||
Sbjct: 533 acagcttcctcaagcttcttcatgtcagtttcatcatcccacggtttgat 484

---

>emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH57ZC11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 403 tcttcatgtcagtctcatcgtcccatggcttgat 436
           ||||||||||||||||||| ||||| || |||||
Sbjct: 596 tcttcatgtcagtctcatcatcccacggtttgat 563



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 190 tcttgttgaaggcaacgatgtcaca 214
           |||||||||||||||| ||||||||
Sbjct: 819 tcttgttgaaggcaacaatgtcaca 795

---

>emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14
          Length = 978

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 731 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 690

---

>ref|XM_342043.2| PREDICTED: Rattus norvegicus similar to eukaryotic translation
           elongation factor 1 beta 2 (LOC361750), mRNA
          Length = 672

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 392 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 433
           |||||| | |||| ||||||| |||||||||||||| |||||
Sbjct: 474 ctcctcgagcttcgtcatgtctgtctcatcgtcccaaggctt 433

---

>ref|NM_210904.1| Eremothecium gossypii AFR003Cp (AFR003C), mRNA
          Length = 621

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 414 gtctcatcgtcccatggcttgatgtccatg 443
           ||||| |||||||||||||||| |||||||
Sbjct: 401 gtctcgtcgtcccatggcttgacgtccatg 372

---

>gb|AC170424.1| Rhesus Macaque  BAC CH250-53N5 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 175619

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 81     aaaaccagtagcatttctgta 101
              |||||||||||||||||||||
Sbjct: 109571 aaaaccagtagcatttctgta 109551

---

>ref|XM_524853.1| PREDICTED: Pan troglodytes similar to Elongation factor 1-delta
            (EF-1-delta) (Antigen NY-CO-4) (LOC469470), mRNA
          Length = 3660

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 407  catgtcagtctcatcgtcccatggcttga 435
            |||||| |||||||||||||| |||||||
Sbjct: 1332 catgtccgtctcatcgtcccaaggcttga 1304

---

>ref|XM_414267.1| PREDICTED: Gallus gallus similar to ring finger protein 123
            (LOC415923), mRNA
          Length = 7740

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 398  caacttcttcatgtcagtctcatcgtccc 426
            |||||||||||| ||||||||| ||||||
Sbjct: 5546 caacttcttcatctcagtctcagcgtccc 5574

---

>gb|DQ440296.1| Aedes aegypti clone AET-374 elongation factor 1 beta/delta chain
           mRNA, complete cds
          Length = 798

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 405 ttcatgtcagtctcatcgtcccatggcttgatgtcca 441
           |||||||| || || || |||||||||||||||||||
Sbjct: 587 ttcatgtcggtttcgtcatcccatggcttgatgtcca 551

---

>gb|BC021729.1| Homo sapiens similar to hypothetical protein FLJ20897, mRNA (cDNA
           clone IMAGE:5267252)
          Length = 1330

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 409 tgtcagtctcatcgtcccatggcttgatgtcca 441
           |||| |||||||||||||| ||||||| |||||
Sbjct: 995 tgtccgtctcatcgtcccaaggcttgaagtcca 963

---

>gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence
          Length = 208866

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 27    aattcaactatttaaaggtaa 47
             |||||||||||||||||||||
Sbjct: 14426 aattcaactatttaaaggtaa 14446

---

>gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-259H10, complete
             sequence
          Length = 189134

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 392   ctcctccaacttcttcatgtcagtc 416
             |||||||||| ||||||||||||||
Sbjct: 14005 ctcctccaacctcttcatgtcagtc 14029

---

>emb|CR733792.2|CNS0GSZ3 Tetraodon nigroviridis full-length cDNA
          Length = 370

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 340 ttctagatcttgttgaaggca 320

---

>emb|CR728524.2|CNS0GP2Q Tetraodon nigroviridis full-length cDNA
          Length = 571

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 541 ttctagatcttgttgaaggca 521

---

>emb|CR720100.2|CNS0GIKQ Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR722642.2|CNS0GKJC Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 724 ttctagatcttgttgaaggca 704

---

>emb|CR719902.2|CNS0GIF8 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 720 ttctagatcttgttgaaggca 700

---

>emb|CR703454.2|CNS0G5QI Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR701463.2|CNS0G477 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 485 ttctagatcttgttgaaggca 465

---

>emb|CR698877.2|CNS0G27D Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR691105.2|CNS0FW7H Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR688433.2|CNS0FU59 Tetraodon nigroviridis full-length cDNA
          Length = 936

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 907 ttctagatcttgttgaaggca 887

---

>emb|CR687149.2|CNS0FT5L Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR687009.2|CNS0FT1P Tetraodon nigroviridis full-length cDNA
          Length = 752

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 722 ttctagatcttgttgaaggca 702

---

>emb|CR686677.2|CNS0FSSH Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1022 ttctagatcttgttgaaggca 1002

---

>emb|CR685114.3|CNS0FRL2 Tetraodon nigroviridis full-length cDNA
          Length = 746

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR683419.2|CNS0FQ9Z Tetraodon nigroviridis full-length cDNA
          Length = 1053

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1024 ttctagatcttgttgaaggca 1004

---

>emb|CR681006.2|CNS0FOEY Tetraodon nigroviridis full-length cDNA
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1031 ttctagatcttgttgaaggca 1011

---

>emb|CR680575.2|CNS0FO2Z Tetraodon nigroviridis full-length cDNA
          Length = 752

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 722 ttctagatcttgttgaaggca 702

---

>emb|CR680242.2|CNS0FNTQ Tetraodon nigroviridis full-length cDNA
          Length = 1040

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1010 ttctagatcttgttgaaggca 990

---

>emb|CR679939.2|CNS0FNLB Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR677929.1|CNS0FM1T Tetraodon nigroviridis full-length cDNA
          Length = 1032

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1011 ttctagatcttgttgaaggca 991

---

>emb|CR677980.2|CNS0FM38 Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1042 ttctagatcttgttgaaggca 1022

---

>emb|CR677281.2|CNS0FLJX Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR677181.2|CNS0FLH5 Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR676468.2|CNS0FKXC Tetraodon nigroviridis full-length cDNA
          Length = 1048

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1018 ttctagatcttgttgaaggca 998

---

>emb|CR676870.2|CNS0FL8I Tetraodon nigroviridis full-length cDNA
          Length = 968

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 938 ttctagatcttgttgaaggca 918

---

>emb|CR674225.2|CNS0FJ7B Tetraodon nigroviridis full-length cDNA
          Length = 1034

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1018 ttctagatcttgttgaaggca 998

---

>emb|CR673965.2|CNS0FJ03 Tetraodon nigroviridis full-length cDNA
          Length = 1031

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1001 ttctagatcttgttgaaggca 981

---

>emb|CR673115.2|CNS0FICH Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR672809.2|CNS0FI3Z Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1014 ttctagatcttgttgaaggca 994

---

>emb|CR672714.2|CNS0FI1C Tetraodon nigroviridis full-length cDNA
          Length = 1043

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1013 ttctagatcttgttgaaggca 993

---

>emb|CR672557.2|CNS0FHWZ Tetraodon nigroviridis full-length cDNA
          Length = 1046

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 183  ttctagatcttgttgaaggca 203
            |||||||||||||||||||||
Sbjct: 1016 ttctagatcttgttgaaggca 996

---

>emb|CR672233.2|CNS0FHNZ Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 723 ttctagatcttgttgaaggca 703

---

>emb|CR671039.2|CNS0FGQT Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 ttctagatcttgttgaaggca 203
           |||||||||||||||||||||
Sbjct: 724 ttctagatcttgttgaaggca 704


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,996,302
Number of Sequences: 3902068
Number of extensions: 6996302
Number of successful extensions: 138078
Number of sequences better than 10.0: 445
Number of HSP's better than 10.0 without gapping: 446
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 137073
Number of HSP's gapped (non-prelim): 1005
length of query: 493
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 471
effective length of database: 17,147,199,772
effective search space: 8076331092612
effective search space used: 8076331092612
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---