>emb|AL590608.6| Human DNA sequence from clone RP11-363F12 on chromosome 6, complete
              sequence
          Length = 200337

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 107    ccatgccttgcctatttcta 126
              ||||||||||||||||||||
Sbjct: 141649 ccatgccttgcctatttcta 141668

>emb|AL356154.13| Human DNA sequence from clone RP11-102H24 on chromosome 10 Contains a
              replication protein A2 32kDa (RPA2) pseudogene, complete
              sequence
          Length = 157722

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 100    caccatcccatgccttgcct 119
              ||||||||||||||||||||
Sbjct: 154051 caccatcccatgccttgcct 154070

>gb|AC026370.31| Homo sapiens 12 BAC RP11-98F7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 89843

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 90    tctgctccttcaccatccca 109
             ||||||||||||||||||||
Sbjct: 31965 tctgctccttcaccatccca 31984

>emb|AL590502.12| Human DNA sequence from clone RP11-144G16 on chromosome 10, complete
             sequence
          Length = 175583

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   ccatgccttgcctatttcta 126
             ||||||||||||||||||||
Sbjct: 62821 ccatgccttgcctatttcta 62802

>gb|AC131909.8| Mus musculus chromosome 5, clone RP24-250G11, complete sequence
          Length = 145479

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 91     ctgctccttcaccatcccatgcc 113
              |||||||||| ||||||||||||
Sbjct: 131656 ctgctccttctccatcccatgcc 131634

>gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, complete sequence
          Length = 190200

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 91    ctgctccttcaccatcccatgcc 113
             |||||||||| ||||||||||||
Sbjct: 84333 ctgctccttctccatcccatgcc 84311

>gb|AC087329.10| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP23-383N15, Complete
              Sequence, complete sequence
          Length = 219559

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 80     aggcttacactctgctccttcac 102
              ||||||||| |||||||||||||
Sbjct: 136186 aggcttacagtctgctccttcac 136208

>ref|XM_785117.1| PREDICTED: Strongylocentrotus purpuratus similar to synleurin
           (LOC585284), partial mRNA
          Length = 813

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 101 accatcccatgccttgcct 119
           |||||||||||||||||||
Sbjct: 505 accatcccatgccttgcct 523

>gb|AC157093.4| Mus musculus 6 BAC RP24-338D12 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 185068

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    ctccttcaccatcccatgc 112
             |||||||||||||||||||
Sbjct: 48054 ctccttcaccatcccatgc 48072


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 772,539
Number of Sequences: 3902068
Number of extensions: 772539
Number of successful extensions: 52719
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52707
Number of HSP's gapped (non-prelim): 12
length of query: 128
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 107
effective length of database: 17,151,101,840
effective search space: 1835167896880
effective search space used: 1835167896880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)