ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags25l09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence Length = 564 Score = 123 bits (62), Expect = 3e-25 Identities = 71/73 (97%), Gaps = 1/73 (1%) Strand = Plus / Minus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 397 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc- 339 Query: 291 ngggaggacgagg 303 |||||||||||| Sbjct: 338 ggggaggacgagg 326
>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10, complete sequence Length = 187034 Score = 123 bits (62), Expect = 3e-25 Identities = 77/81 (95%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 176408 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 176349 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 176348 gctcgcc-ggggaggacgagg 176329
>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08, complete sequence Length = 119500 Score = 123 bits (62), Expect = 3e-25 Identities = 77/81 (95%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 27090 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 27031 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 27030 gctcgcc-ggggaggacgagg 27011
>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221) Length = 653 Score = 123 bits (62), Expect = 3e-25 Identities = 71/73 (97%), Gaps = 1/73 (1%) Strand = Plus / Minus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 463 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc- 405 Query: 291 ngggaggacgagg 303 |||||||||||| Sbjct: 404 ggggaggacgagg 392
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 123 bits (62), Expect = 3e-25 Identities = 77/81 (95%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 28392166 cctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 28392107 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 28392106 gctcgcc-ggggaggacgagg 28392087 Score = 111 bits (56), Expect = 1e-21 Identities = 71/75 (94%), Gaps = 1/75 (1%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 287 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 22480467 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 22480408 Query: 288 ccangggaggacgag 302 || ||||||||||| Sbjct: 22480407 cc-ggggaggacgag 22480394
>ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 459 Score = 121 bits (61), Expect = 1e-24 Identities = 76/80 (95%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 459 ctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 400 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 399 ctcgcc-ggggaggacgagg 381
>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B Length = 712 Score = 121 bits (61), Expect = 1e-24 Identities = 73/76 (96%), Gaps = 1/76 (1%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 287 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 519 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 460 Query: 288 ccangggaggacgagg 303 || |||||||||||| Sbjct: 459 cc-ggggaggacgagg 445
>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds Length = 592 Score = 121 bits (61), Expect = 1e-24 Identities = 76/80 (95%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 479 ctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 420 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 419 ctcgcc-ggggaggacgagg 401
>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds Length = 564 Score = 121 bits (61), Expect = 1e-24 Identities = 73/76 (96%), Gaps = 1/76 (1%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 287 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 410 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 351 Query: 288 ccangggaggacgagg 303 || |||||||||||| Sbjct: 350 cc-ggggaggacgagg 336
>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence Length = 574 Score = 117 bits (59), Expect = 2e-23 Identities = 59/59 (100%) Strand = Plus / Minus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 299 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 241
>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence Length = 706 Score = 117 bits (59), Expect = 2e-23 Identities = 59/59 (100%) Strand = Plus / Minus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 507 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 449
>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B Length = 492 Score = 117 bits (59), Expect = 2e-23 Identities = 68/70 (97%), Gaps = 1/70 (1%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc-gg 394 Query: 293 ggaggacgag 302 |||||||||| Sbjct: 393 ggaggacgag 384
>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds Length = 3209 Score = 117 bits (59), Expect = 2e-23 Identities = 71/74 (95%), Gaps = 1/74 (1%) Strand = Plus / Minus Query: 230 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 1699 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 1640 Query: 290 angggaggacgagg 303 |||||||||||| Sbjct: 1639 -tgggaggacgagg 1627
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 115 bits (58), Expect = 8e-23 Identities = 76/81 (93%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 24254625 cctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 24254566 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 24254565 gctcgcc-ggggaggacgagg 24254546 Score = 73.8 bits (37), Expect = 3e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 234 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||||||||||||| | |||||||||||||| |||||||||||||| Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctc 24251061
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 115 bits (58), Expect = 8e-23 Identities = 76/81 (93%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 2856597 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 2856656 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 2856657 gctcgcc-ggggaggacgagg 2856676 Score = 115 bits (58), Expect = 8e-23 Identities = 76/81 (93%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2673941 cctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcga 2673882 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 2673881 gctcgcc-ggggaggacgagg 2673862 Score = 111 bits (56), Expect = 1e-21 Identities = 68/71 (95%), Gaps = 1/71 (1%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 |||||||||||||||||||||||||||||||||||||||||||||||||||||| || | Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc-gg 17421792 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 17421793 ggaggacgagg 17421803 Score = 107 bits (54), Expect = 2e-20 Identities = 75/81 (92%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 2837045 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 2837104 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 2837105 gctcgcc-ggggaggacgagg 2837124 Score = 105 bits (53), Expect = 8e-20 Identities = 74/80 (92%), Gaps = 1/80 (1%) Strand = Plus / Plus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 2819235 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 2819294 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 2819295 ctcgcc-ggggaggacgagg 2819313 Score = 103 bits (52), Expect = 3e-19 Identities = 73/79 (92%), Gaps = 1/79 (1%) Strand = Plus / Plus Query: 225 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 284 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 36007433 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 36007492 Query: 285 tccccangggaggacgagg 303 || || |||||||||||| Sbjct: 36007493 tcgcc-ggggaggacgagg 36007510 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| | Sbjct: 2871656 cctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaa 2871597 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 2871596 gctcgcc-ggggaggacgagg 2871577 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 2843658 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 2843717 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 2843718 gctcgcc-ggggaggacgagg 2843737 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||| Sbjct: 2686264 cctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcga 2686205 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 2686204 gctcgcc-ggggaggacgagg 2686185
>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0030H07 Length = 168253 Score = 115 bits (58), Expect = 8e-23 Identities = 76/81 (93%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 63595 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 63654 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 63655 gctcgcc-ggggaggacgagg 63674 Score = 107 bits (54), Expect = 2e-20 Identities = 75/81 (92%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 44043 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 44102 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 44103 gctcgcc-ggggaggacgagg 44122 Score = 105 bits (53), Expect = 8e-20 Identities = 74/80 (92%), Gaps = 1/80 (1%) Strand = Plus / Plus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 26233 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 26292 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 26293 ctcgcc-ggggaggacgagg 26311 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| | Sbjct: 78654 cctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaa 78595 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 78594 gctcgcc-ggggaggacgagg 78575 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 50656 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 50715 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 50716 gctcgcc-ggggaggacgagg 50735
>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0434B04 Length = 167029 Score = 115 bits (58), Expect = 8e-23 Identities = 76/81 (93%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 123716 cctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcga 123657 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 123656 gctcgcc-ggggaggacgagg 123637 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||| Sbjct: 136039 cctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcga 135980 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 135979 gctcgcc-ggggaggacgagg 135960
>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0009G03 Length = 163526 Score = 115 bits (58), Expect = 8e-23 Identities = 76/81 (93%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 162274 cctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaa 162333 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 162334 gctcgcc-ggggaggacgagg 162353 Score = 107 bits (54), Expect = 2e-20 Identities = 75/81 (92%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 142722 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 142781 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 142782 gctcgcc-ggggaggacgagg 142801 Score = 105 bits (53), Expect = 8e-20 Identities = 74/80 (92%), Gaps = 1/80 (1%) Strand = Plus / Plus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 124912 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 124971 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 124972 ctcgcc-ggggaggacgagg 124990 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 149335 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 149394 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 149395 gctcgcc-ggggaggacgagg 149414
>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0605H02 Length = 175547 Score = 115 bits (58), Expect = 8e-23 Identities = 76/81 (93%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 120964 cctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 120905 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 120904 gctcgcc-ggggaggacgagg 120885 Score = 73.8 bits (37), Expect = 3e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 234 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||||||||||||| | |||||||||||||| |||||||||||||| Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctc 117400
>ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 113 bits (57), Expect = 3e-22 Identities = 75/80 (93%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 462 ctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaag 403 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 402 ctcgcc-ggggaggacgagg 384
>ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 113 bits (57), Expect = 3e-22 Identities = 75/80 (93%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 462 ctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgag 403 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 402 ctcgcc-ggggaggacgagg 384
>ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA Length = 453 Score = 113 bits (57), Expect = 3e-22 Identities = 75/80 (93%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 453 ctaagagctggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 394 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 393 ctcgcc-ggggaggacgagg 375
>ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 375 Score = 111 bits (56), Expect = 1e-21 Identities = 71/75 (94%), Gaps = 1/75 (1%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 287 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 371 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 312 Query: 288 ccangggaggacgag 302 || ||||||||||| Sbjct: 311 cc-ggggaggacgag 298
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 111 bits (56), Expect = 1e-21 Identities = 71/75 (94%), Gaps = 1/75 (1%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 287 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 69874 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 69815 Query: 288 ccangggaggacgag 302 || ||||||||||| Sbjct: 69814 cc-ggggaggacgag 69801
>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3) Length = 1728 Score = 111 bits (56), Expect = 1e-21 Identities = 74/79 (93%), Gaps = 1/79 (1%) Strand = Plus / Minus Query: 225 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 284 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 495 taagaagaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 436 Query: 285 tccccangggaggacgagg 303 || || |||||||||||| Sbjct: 435 tcgcc-ggggaggacgagg 418
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 111 bits (56), Expect = 1e-21 Identities = 68/71 (95%), Gaps = 1/71 (1%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 |||||||||||||||||||||||||||||||||||||||||||||||||||||| || | Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc-gg 75184 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 75185 ggaggacgagg 75195
>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA sequence Length = 940 Score = 107 bits (54), Expect = 2e-20 Identities = 69/73 (94%), Gaps = 1/73 (1%) Strand = Plus / Minus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || Sbjct: 772 gaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggcgagctcgcc- 714 Query: 291 ngggaggacgagg 303 |||||||||||| Sbjct: 713 ggggaggacgagg 701
>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214) Length = 580 Score = 107 bits (54), Expect = 2e-20 Identities = 75/81 (92%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 ||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||| Sbjct: 460 cctaagacgaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcga 401 Query: 283 gctccccangggaggacgagg 303 ||||||| |||||||||||| Sbjct: 400 gctcccc-ggggaggacgagg 381
>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full insert sequence Length = 288 Score = 107 bits (54), Expect = 2e-20 Identities = 75/81 (92%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 135 cctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcga 76 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 75 gctcgcc-ggggaggacgagg 56
>ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 105 bits (53), Expect = 8e-20 Identities = 71/76 (93%), Gaps = 1/76 (1%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 287 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 458 gaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcg 399 Query: 288 ccangggaggacgagg 303 || |||||||||||| Sbjct: 398 cc-ggggaggacgagg 384
>ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 105 bits (53), Expect = 8e-20 Identities = 74/80 (92%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 462 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgag 403 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 402 ctcgcc-ggggaggacgagg 384
>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA sequence Length = 764 Score = 105 bits (53), Expect = 8e-20 Identities = 74/80 (92%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 552 ctaagacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgag 493 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 492 ctcgcc-ggggaggacgagg 474
>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds Length = 678 Score = 105 bits (53), Expect = 8e-20 Identities = 74/80 (92%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 485 ctaagacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgag 426 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 425 ctcgcc-ggggaggacgagg 407
>ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 420 Score = 103 bits (52), Expect = 3e-19 Identities = 73/79 (92%), Gaps = 1/79 (1%) Strand = Plus / Minus Query: 225 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 284 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 419 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 360 Query: 285 tccccangggaggacgagg 303 || || |||||||||||| Sbjct: 359 tcgcc-ggggaggacgagg 342
>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence Length = 574 Score = 103 bits (52), Expect = 3e-19 Identities = 55/56 (98%) Strand = Plus / Minus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 519 gaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttggcgagctc 464
>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence Length = 568 Score = 103 bits (52), Expect = 3e-19 Identities = 67/71 (94%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 |||||||||||||||||| ||||||||||||||||||||||||||||||||||| || | Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgcc-gg 268 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 267 ggaggacgagg 257
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 103 bits (52), Expect = 3e-19 Identities = 67/71 (94%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || | Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgcc-gg 9465266 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 9465265 ggaggacgagg 9465255
>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4) Length = 2361 Score = 103 bits (52), Expect = 3e-19 Identities = 74/80 (92%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1378 ctaagaggaagtaaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 1319 Query: 284 ctccccangggaggacgagg 303 ||| ||| || ||||||||| Sbjct: 1318 ctcgcca-ggaaggacgagg 1300
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 103 bits (52), Expect = 3e-19 Identities = 67/71 (94%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || | Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgcc-gg 162666 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 162665 ggaggacgagg 162655
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 103 bits (52), Expect = 3e-19 Identities = 67/71 (94%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 ||||||||||||||| |||||||||||||||||||||||||||||||||||||| || | Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgcc-gg 9463387 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 9463386 ggaggacgagg 9463376
>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408C03 Length = 141273 Score = 103 bits (52), Expect = 3e-19 Identities = 73/79 (92%), Gaps = 1/79 (1%) Strand = Plus / Plus Query: 225 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 284 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 20158 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 20217 Query: 285 tccccangggaggacgagg 303 || || |||||||||||| Sbjct: 20218 tcgcc-ggggaggacgagg 20235
>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0031D11 Length = 138108 Score = 103 bits (52), Expect = 3e-19 Identities = 73/79 (92%), Gaps = 1/79 (1%) Strand = Plus / Plus Query: 225 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 284 ||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 106111 taagacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagc 106170 Query: 285 tccccangggaggacgagg 303 || || |||||||||||| Sbjct: 106171 tcgcc-ggggaggacgagg 106188
>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds Length = 552 Score = 99.6 bits (50), Expect = 5e-18 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand = Plus / Minus Query: 223 cctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcga 282 |||||| ||| || ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 479 cctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcga 420 Query: 283 gctccccangggaggacgagg 303 |||| || |||||||||||| Sbjct: 419 gctcgcc-ggggaggacgagg 400
>ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA Length = 468 Score = 97.6 bits (49), Expect = 2e-17 Identities = 73/80 (91%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| || Sbjct: 468 ctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaag 409 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 408 ctcgcc-ggggaggacgagg 390
>ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 97.6 bits (49), Expect = 2e-17 Identities = 73/80 (91%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||| || ||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 462 ctaagcggaagtaaacttggtgacggccttcgtgccctcggagacggcgtgcttggcgag 403 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 402 ctcgcc-ggggaggacgagg 384
>ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 97.6 bits (49), Expect = 2e-17 Identities = 73/80 (91%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 ||||| ||||||||| || |||||||||||||||||||| |||||||||||||||||||| Sbjct: 462 ctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgag 403 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 402 ctcgcc-ggggaggacgagg 384
>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds Length = 410 Score = 97.6 bits (49), Expect = 2e-17 Identities = 73/80 (91%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||||| || ||||||||||||||||||||||||||||| || ||||||||||||||||| Sbjct: 213 ctaagaagaagtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgag 154 Query: 284 ctccccangggaggacgagg 303 ||| || |||||||||||| Sbjct: 153 ctcgcc-ggggaggacgagg 135
>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence Length = 789 Score = 95.6 bits (48), Expect = 8e-17 Identities = 66/71 (92%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 |||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || | Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcc-tg 464 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 463 ggaggacgagg 453
>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds Length = 427 Score = 95.6 bits (48), Expect = 8e-17 Identities = 66/71 (92%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccang 292 ||||||||||||||||||||| || ||||||||||||||||||||||||||||| || | Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgcc-gg 231 Query: 293 ggaggacgagg 303 ||||||||||| Sbjct: 230 ggaggacgagg 220
>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds Length = 627 Score = 91.7 bits (46), Expect = 1e-15 Identities = 52/54 (96%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||||| |||||||||||||| |||||||||||||||||||||||||| Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctc 466
>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3 and H4 Length = 8592 Score = 91.7 bits (46), Expect = 1e-15 Identities = 55/58 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 2063 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccca 2006
>gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:81709 IMAGE:6865010), complete cds Length = 1379 Score = 91.7 bits (46), Expect = 1e-15 Identities = 55/58 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccca 335
>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and histone H3 gene, 3' end, gene cluster X1h3 Length = 8608 Score = 91.7 bits (46), Expect = 1e-15 Identities = 55/58 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 2073 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccca 2016
>ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC478743), mRNA Length = 1047 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 337
>ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC478743), mRNA Length = 487 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 337
>ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611482), mRNA Length = 386 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 374 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 318
>ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611465), mRNA Length = 388 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 320
>ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B histone family, member T (LOC488290), mRNA Length = 421 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 320
>ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B histone family, member R (LOC488288), mRNA Length = 384 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 316
>ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC488279), mRNA Length = 513 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 438 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 382
>ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488276), mRNA Length = 438 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 320
>ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B histone family, member T (LOC611158), mRNA Length = 883 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 307
>ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488296), mRNA Length = 381 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 313
>ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC611089), mRNA Length = 381 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 313
>ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-specific histone 2b (LOC488253), mRNA Length = 384 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 316
>ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-specific histone 2b (LOC488252), mRNA Length = 384 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 316
>ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC608682), mRNA Length = 342 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 330 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 274
>ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC608682), mRNA Length = 383 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 371 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 315
>ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B histone family, member T, transcript variant 3 (LOC488303), mRNA Length = 651 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 329
>ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B histone family, member T, transcript variant 2 (LOC488303), mRNA Length = 442 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 313
>ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC488267), mRNA Length = 440 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 321
>ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC488267), mRNA Length = 1108 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 321
>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 3 (LOC480760), mRNA Length = 862 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 712
>ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 2 (LOC480760), mRNA Length = 487 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 337
>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 1 (LOC480760), mRNA Length = 1422 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 712
>dbj|D10396.1|RICT20 Oryza sativa mRNA for histone H2B (T20 gene), partial sequence Length = 231 Score = 89.7 bits (45), Expect = 5e-15 Identities = 52/55 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcc 287 ||||||||||||||| |||||||| ||||||||||| |||||||||||||||||| Sbjct: 58 ggtgaacttggtgaccgccttggtnccctcggagacngcgtgcttggcgagctcc 4
>ref|XM_527282.1| PREDICTED: Pan troglodytes similar to HIST1H2BM protein (LOC471904), mRNA Length = 585 Score = 87.7 bits (44), Expect = 2e-14 Identities = 50/52 (96%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 424 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 373
>gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds Length = 375 Score = 87.7 bits (44), Expect = 2e-14 Identities = 53/56 (94%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||| |||| ||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 368 gaggtggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggcgag 313
>ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488309), partial mRNA Length = 705 Score = 85.7 bits (43), Expect = 7e-14 Identities = 49/51 (96%) Strand = Plus / Minus Query: 239 cttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 ||||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 363 cttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 313
>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429558), mRNA Length = 381 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctc 316
>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429457), partial mRNA Length = 628 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctc 563
>ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC616868), mRNA Length = 674 Score = 83.8 bits (42), Expect = 3e-13 Identities = 48/50 (96%) Strand = Plus / Minus Query: 240 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 371 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 322
>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC483173), mRNA Length = 2193 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 332
>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC483164), mRNA Length = 659 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 339
>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 1 (LOC483169), mRNA Length = 432 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 326
>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 2 (LOC483169), mRNA Length = 516 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 364
>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 5 (LOC483170), mRNA Length = 415 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 316
>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 4 (LOC483170), mRNA Length = 597 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 364
>emb|BX072512.1|CNS09S44 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 621 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 466 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 413
>emb|BX072414.1|CNS09S1E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 718 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 267 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 320
>emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 780 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 270 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 323
>emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 722 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 235 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 288
>emb|BX051496.1|CNS09BWC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 247 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 300
>emb|BX051495.1|CNS09BWB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 463 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 410
>emb|BX047440.1|CNS098RO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 444 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 391
>emb|BX038423.1|CNS091T7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 721 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 478 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 425
>emb|BX034441.1|CNS08YQL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 249 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 302
>emb|BX032827.1|CNS08XHR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 670 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 461 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 408
>emb|BX031663.1|CNS08WLF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 770 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 236 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 289
>emb|BX021771.1|CNS08OYN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32BB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 544 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 245 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 298
>emb|BX014617.1|CNS08JFX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 409 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 170 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 117
>emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 399
>emb|BX012776.1|CNS08I0S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 780 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 417
>emb|BX012380.1|CNS08HPS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA19CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 248 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 301
>emb|BX009211.1|CNS08F9R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15AA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 750 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 399
>emb|BX008532.1|CNS08EQW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 536 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 204 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 257
>emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B Length = 698 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 423 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 370
>emb|X14731.1|CMHIST2B Duck H2B histone gene Length = 1179 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 1042 ggtgtacttggtgaccgccttggtgccctcggagacggcgtgcttggccagctc 989
>gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDNA clone MGC:133641 IMAGE:8049327), complete cds Length = 503 Score = 83.8 bits (42), Expect = 3e-13 Identities = 48/50 (96%) Strand = Plus / Minus Query: 240 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 391 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 342
>ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC133641), mRNA Length = 503 Score = 83.8 bits (42), Expect = 3e-13 Identities = 48/50 (96%) Strand = Plus / Minus Query: 240 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||||||||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 391 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcccc 342
>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds Length = 425 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctc 316
>ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582 (ENSANGG00000022768), partial mRNA Length = 513 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 46 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 99
>ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097 (ENSANGG00000011608), mRNA Length = 671 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 420 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 367
>ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080 (ENSANGG00000011591), mRNA Length = 695 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 464 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 411
>ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674 (ENSANGG00000000607), partial mRNA Length = 363 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 351 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 298
>ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043 (ENSANGG00000013554), mRNA Length = 704 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 417
>ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106 (ENSANGG00000000104), partial mRNA Length = 321 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 309 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 256
>ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003 (ENSANGG00000000003), partial mRNA Length = 375 Score = 83.8 bits (42), Expect = 3e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 310
>emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09 Length = 484 Score = 83.8 bits (42), Expect = 3e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 375 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcccca 318
>gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:60248 IMAGE:6526835), complete cds Length = 844 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 353
>ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histone family, member F (LOC462509), mRNA Length = 843 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 369 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 313
>ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histone family, member R (LOC462500), mRNA Length = 572 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 381 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 325
>ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H2B 291B (LOC462491), mRNA Length = 643 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 419 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 363
>gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MGC:119806 IMAGE:40014271), complete cds Length = 441 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 390 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 334
>ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BFS), mRNA Length = 381 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 313
>ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA Length = 467 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 351
>gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:5132 IMAGE:3463930), complete cds Length = 845 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 411 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 355
>ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC616776), mRNA Length = 399 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| Sbjct: 382 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcccc 326
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 142538 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 142482 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 236019 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 235962 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 107478 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 107531 Score = 73.8 bits (37), Expect = 3e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| Sbjct: 183927 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctcccc 183871 Score = 65.9 bits (33), Expect = 7e-08 Identities = 51/57 (89%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||| ||||||||||||||||| || || ||||||||||| |||||||| Sbjct: 168164 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctcccc 168108 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 257344 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctcccc 257288 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Plus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||| |||||||| || ||||| || ||||||||||| ||||| Sbjct: 200280 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctc 200328 Score = 42.1 bits (21), Expect = 1.0 Identities = 45/53 (84%) Strand = Plus / Plus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 ||||||| || ||||| ||||||||||| || || ||||| || ||||||||| Sbjct: 27236 acttggtaactgccttagtgccctcggacacagcatgcttagccagctcccca 27288
>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6 Length = 91567 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 621 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 677 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Plus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 79045 acttggtgacggccttggtgccctcggacacggcgtgcttggc 79087 Score = 73.8 bits (37), Expect = 3e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| Sbjct: 86914 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccc 86858 Score = 73.8 bits (37), Expect = 3e-10 Identities = 52/57 (91%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| Sbjct: 55422 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccc 55478
>ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 1, mRNA Length = 523 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 362
>ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA Length = 820 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 411 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 355
>ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 2, mRNA Length = 829 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 418 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 362
>ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611126), mRNA Length = 751 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| Sbjct: 395 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcccc 339
>gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, complete cds Length = 1137 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 749 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 693
>gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, complete cds Length = 1137 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 748 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 692
>gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, complete cds Length = 1137 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 749 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 693
>emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA Length = 724 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||| |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 373 ggtgtacttggtcacggccttggtgccctcggacacggcgtgcttggccagctcccc 317
>emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA Length = 617 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||| |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 410 ggtgtacttggtcacggccttggtgccctcggacacggcgtgcttggccagctcccc 354
>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3 Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ, H2AFN, and H2BFN histone genes, the OR2B2 gene for olfactory receptor 2B2, histone H2B family member I pseudogene H2BFIP, a hypothetical protein pseudogene, ESTs, STSs, GSSs and CpG islands, complete sequence Length = 100374 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 57572 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 57516 Score = 73.8 bits (37), Expect = 3e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| Sbjct: 2771 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccc 2715
>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the 3' part of the HFE gene for haemochromatosis protein, two genes for novel histone 4 family members, two genes for novel histone 1 family members, three genes for novel histone 2B family members, a gene for a novel histone 2A family member, a novel pseudogene, STSs, GSSs, ESTs and CpG islands, complete sequence Length = 101099 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 64919 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 64863 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 29859 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 29912 Score = 65.9 bits (33), Expect = 7e-08 Identities = 51/57 (89%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||| ||||||||||||||||| || || ||||||||||| |||||||| Sbjct: 90545 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctcccc 90489
>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1 Contains a vomeronasal olfactory 1 receptor chromosome 6-2 (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the gene for a novel protein identical to H2B histone family member A (H2BFA), the gene for a novel protein identical to H2A histone family member I (H2AFI), a novel histone gene similar to H4F2 and three CpG islands, complete sequence Length = 89016 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 69735 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 69791 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| || |||||||| |||||||||||||| | ||||||| Sbjct: 55687 ggtgtacttggtgacggccttagtaccctcggacacggcgtgcttggccaactcccca 55744
>emb|BX038797.1|CNS0923L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3BD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 105 Score = 81.8 bits (41), Expect = 1e-12 Identities = 47/49 (95%) Strand = Plus / Plus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 45 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 93
>emb|BX008531.1|CNS08EQV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 499 Score = 81.8 bits (41), Expect = 1e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||||||||||||||||||||| |||||||||||||| ||||| Sbjct: 445 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctc 397
>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B Length = 1661 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 410 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 466
>emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone pJG4-5-15 Length = 808 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 397 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 341
>emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, clone pjG4-5-14 Length = 829 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 329
>gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:74942 IMAGE:6093977), complete cds Length = 859 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 353
>gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant 1, mRNA (cDNA clone MGC:116768 IMAGE:40002354), complete cds Length = 438 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 313
>gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant 2, mRNA (cDNA clone MGC:3802 IMAGE:3659807), complete cds Length = 814 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 394 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 338
>dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-13175, similar to human histone 1, H2bd (HIST1H2BD), transcript variant 2,mRNA, RefSeq: NM_138720.1 Length = 760 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 415 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 359
>ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (predicted) (Hist1h2bm_predicted), mRNA Length = 1023 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| Sbjct: 552 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcccc 496
>dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family protein, complete cds Length = 821 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 397 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 341
>emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (from clone DKFZp781B2436) Length = 1890 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctcccc 351
>dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, section 95/105 Length = 340000 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 298226 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 298170
>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6 Length = 20621 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 18936 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 18992 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| || |||||||| |||||||||||||| | ||||||| Sbjct: 4888 ggtgtacttggtgacggccttagtaccctcggacacggcgtgcttggccaactcccca 4945
>gb|BC108737.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:131989 IMAGE:4707078), complete cds Length = 880 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 353
>gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds Length = 1520 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || |||||||||||||| |||||||| Sbjct: 901 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccc 845
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 81.8 bits (41), Expect = 1e-12 Identities = 50/53 (94%) Strand = Plus / Minus Query: 234 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 1583 gtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 1531
>dbj|AP001051.1| Homo sapiens genomic DNA, chromosome 21, clone:KB161B12, MX1-D21S171 region, complete sequence Length = 84904 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 4500 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 4444
>dbj|AP001050.1| Homo sapiens genomic DNA, chromosome 21, clone:KB953G5, MX1-D21S171 region, complete sequence Length = 98992 Score = 81.8 bits (41), Expect = 1e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 76143 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 76087
>ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus similar to H2B histone family, member F (LOC586416), mRNA Length = 471 Score = 79.8 bits (40), Expect = 5e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| Sbjct: 368 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgag 313
>ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B 291B (LOC586394), mRNA Length = 375 Score = 79.8 bits (40), Expect = 5e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| Sbjct: 368 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgag 313
>emb|BX047441.1|CNS098RP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 259 Score = 79.8 bits (40), Expect = 5e-12 Identities = 46/48 (95%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 139 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggc 186
>emb|BX026873.1|CNS08SWD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 762 Score = 79.8 bits (40), Expect = 5e-12 Identities = 46/48 (95%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 248 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggc 295
>emb|BX013308.1|CNS08IFK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA20AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 79.8 bits (40), Expect = 5e-12 Identities = 46/48 (95%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 240 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggc 287
>emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone gene fragment L4 H2b Length = 627 Score = 79.8 bits (40), Expect = 5e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| Sbjct: 319 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgag 264
>emb|AJ306724.1|PPI306724 Pinus pinaster mRNA for putative histone H4 Length = 633 Score = 79.8 bits (40), Expect = 5e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 234 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||||||||||||||||||| |||||||| |||||||| ||||| ||||||||||| Sbjct: 463 gtgaacttggtgacggcctttgtgccctctgagacggcatgcttcgcgagctcccc 408
>gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence Length = 29552 Score = 79.8 bits (40), Expect = 5e-12 Identities = 52/56 (92%) Strand = Plus / Plus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||| |||||||||| |||||||| ||||||||||||||||||||||| ||||| Sbjct: 21705 gaggtgtacttggtgacagccttggttccctcggagacggcgtgcttggcaagctc 21760
>ref|NM_072796.1| Caenorhabditis elegans HIStone family member (his-8) (his-8) mRNA, complete cds Length = 372 Score = 79.8 bits (40), Expect = 5e-12 Identities = 52/56 (92%) Strand = Plus / Minus Query: 231 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||| |||||||||| |||||||| ||||||||||||||||||||||| ||||| Sbjct: 362 gaggtgtacttggtgacagccttggttccctcggagacggcgtgcttggcaagctc 307
>gb|M14143.1|SUPH2A1 P.miliaris histone H2B-2.2 gene, complete cds Length = 375 Score = 79.8 bits (40), Expect = 5e-12 Identities = 52/56 (92%) Strand = Plus / Plus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||| |||| |||||||||| |||||||||||||| |||||||||||||||||||| Sbjct: 8 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgag 63
>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence Length = 836 Score = 77.8 bits (39), Expect = 2e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 224 ctaagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||||| || |||||||||||||| ||||| ||||| || |||||||||||||||||||| Sbjct: 552 ctaagacgaagtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgag 493 Query: 284 ctc 286 ||| Sbjct: 492 ctc 490
>gb|BC067486.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MGC:79336 IMAGE:7002060), complete cds Length = 413 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 364 acttggtgacggccttggtgccctcggacacggcgtgcttggc 322
>gb|BC067489.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MGC:79339 IMAGE:7002066), complete cds Length = 413 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 364 acttggtgacggccttggtgccctcggacacggcgtgcttggc 322
>gb|BC067488.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MGC:79338 IMAGE:7002065), complete cds Length = 412 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 364 acttggtgacggccttggtgccctcggacacggcgtgcttggc 322
>gb|BC067487.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MGC:79337 IMAGE:7002064), complete cds Length = 413 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 364 acttggtgacggccttggtgccctcggacacggcgtgcttggc 322
>ref|NM_003521.2| Homo sapiens histone 1, H2bm (HIST1H2BM), mRNA Length = 446 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 364 acttggtgacggccttggtgccctcggacacggcgtgcttggc 322
>gb|AF531296.1| Homo sapiens histone H2B (HIST1H2BM) gene, complete cds Length = 1137 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 744 acttggtgacggccttggtgccctcggacacggcgtgcttggc 702
>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B (LOC587419), mRNA Length = 372 Score = 77.8 bits (39), Expect = 2e-11 Identities = 45/47 (95%) Strand = Plus / Minus Query: 240 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 ||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 353 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctc 307
>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific histone 2b (LOC589998), mRNA Length = 372 Score = 77.8 bits (39), Expect = 2e-11 Identities = 54/59 (91%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctc 307
>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2 Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs, STSs, GSSs and three CpG islands, complete sequence Length = 24706 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 3754 acttggtgacggccttggtgccctcggacacggcgtgcttggc 3712
>emb|Z83738.1|HSZ83738 H.sapiens hH2B/e gene Length = 693 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 482 acttggtgacggccttggtgccctcggacacggcgtgcttggc 440
>emb|Z46225.1|HTHISH2B H.tubulosa gene encoding histone H2B Length = 712 Score = 77.8 bits (39), Expect = 2e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||| ||||||||||||||||||||||||| ||||||||||| |||||||| Sbjct: 480 ggtgtacttggtgacggccttggtgccctcagagacggcgtgtttggcgag 430
>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b Length = 1497 Score = 77.8 bits (39), Expect = 2e-11 Identities = 54/59 (91%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 1357 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctc 1299
>gb|BC067485.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone IMAGE:7002057) Length = 413 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 364 acttggtgacggccttggtgccctcggacacggcgtgcttggc 322
>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA Length = 372 Score = 77.8 bits (39), Expect = 2e-11 Identities = 54/59 (91%) Strand = Plus / Minus Query: 228 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 365 gaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctc 307
>gb|BC066244.1| Homo sapiens histone 1, H2bm, mRNA (cDNA clone MGC:79335 IMAGE:7002058), complete cds Length = 413 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggc 280 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 364 acttggtgacggccttggtgccctcggacacggcgtgcttggc 322
>gb|U93853.1|ECU93853 Euplotes crassus histone H2B (H2B(2)) gene, complete cds Length = 1522 Score = 77.8 bits (39), Expect = 2e-11 Identities = 54/59 (91%) Strand = Plus / Minus Query: 225 taagaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 283 |||||||||||| |||||||||| |||||||| ||||| |||||||| ||||||||||| Sbjct: 1170 taagaggaggtgtacttggtgacagccttggttccctcagagacggcatgcttggcgag 1112
>gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA clone MGC:89948 IMAGE:7030528), complete cds Length = 540 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctcccca 352
>gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 H2be -like mRNA, complete sequence Length = 838 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 416 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 363
>gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IMAGE:40031316), partial cds Length = 435 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 368 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 315
>ref|XM_518889.1| PREDICTED: Pan troglodytes similar to histone H2b-616 (LOC463172), mRNA Length = 1009 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 391 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 334
>ref|XM_518295.1| PREDICTED: Pan troglodytes similar to H2B histone family, member T; histone family member (LOC462501), mRNA Length = 1521 Score = 75.8 bits (38), Expect = 7e-11 Identities = 47/50 (94%) Strand = Plus / Minus Query: 240 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 402 ttggtgacggccttggtgccctcggacacggcgtgcttggccaactcccc 353
>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733 IMAGE:40014260), complete cds Length = 459 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 317
>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734 IMAGE:40014264), complete cds Length = 459 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 317
>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701), mRNA Length = 399 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 387 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 334
>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA Length = 753 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 331
>ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427894), mRNA Length = 381 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 316
>ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427888), mRNA Length = 381 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 316
>ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427883), mRNA Length = 381 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 316
>ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC417956), mRNA Length = 841 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 576 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 523
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 267 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 320
>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419 IMAGE:3936695), complete cds Length = 2224 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 393 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 340
>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with apparent retained intron Length = 2210 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 381 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 328
>ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC615043), mRNA Length = 748 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 401 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 348
>ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC506306), mRNA Length = 485 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 400 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 347
>ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone family, member F, transcript variant 1 (LOC537985), mRNA Length = 2304 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 385 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 332
>ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA Length = 452 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 339
>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA Length = 2223 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 358
>ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA Length = 438 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 316
>ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA Length = 425 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 312
>gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IMAGE:4102077), with apparent retained intron Length = 1178 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 391 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 338
>ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone 3, H2ba (LOC482202), mRNA Length = 459 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||||||||||||||||||||| || ||||||||||| ||||| Sbjct: 384 ggtgtacttggtgacggccttggtgccctcggacaccgcgtgcttggccagctc 331
>gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA clone IMAGE:5209694), with apparent retained intron Length = 1740 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 370 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 317
>gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, complete cds Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 749 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 692
>gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, complete cds Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 748 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 695
>gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds Length = 435 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 391 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 338
>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of IgG, high affinity Ia, receptor for (CD64), a novel gene similar to histone 2, H2be (HIST2H2BE), a novel gene similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for histone 2, H4, the HIST2H3C gene for histone 2, H3c, the HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene (HIST2H2BC), a novel gene similar to histone 2, H2aa (HIST2H2AA), a novel gene similar to histone 2, H3c (HIST2H3C), a novel gene similar to histone 1, H4 (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for histone 2, H2ab, a novel protein similar to histone 2, a novel gene, the SV2A gene for synaptic vesicle glycoprotein 2A, the 3' end of the SF3B4 gene for splicing factor 3b, subunit 4, 49kDa and five CpG islands, complete sequence Length = 188956 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 148035 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 73723 Score = 73.8 bits (37), Expect = 3e-10 Identities = 46/49 (93%) Strand = Plus / Plus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 112186 Score = 73.8 bits (37), Expect = 3e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 105080
>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four novel genes, a novel gene (MGC57827), a ribosomal protein L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C) pseudogene, the HIST2H2BB gene for histone 2 H2bb, the FCGR1B gene for Fc fragment of IgG high affinity Ib receptor for (CD64) and three CpG islands, complete sequence Length = 189539 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 159202
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 99867 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 99920 Score = 67.9 bits (34), Expect = 2e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||| ||||||||||| |||||||||||||| ||||| Sbjct: 94140 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctc 94087
>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C gene for Fc fragment of IgG high affinity Ic receptor for (CD64), two novel genes, the HIST2H2BA gene for histone 2 H2ba, the gene for a novel protein similar to histone 2 H3c (HIST2H3C), a novel gene, a ribosomal protein L22 (RPL22) pseudogene, a novel gene and three CpG islands, complete sequence Length = 129426 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 68592 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 68645
>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2 Contains seventeen histone (pseudo)genes and gene RPS10P1 (40S Ribosomal protein S10 pseudogene 1), three CpG islands, ESTs, STSs and GSSs, complete sequence Length = 89301 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 57401 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 57344 Score = 73.8 bits (37), Expect = 3e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| ||||||||||||||||||||||||| || ||||||||||| || |||||||| Sbjct: 5309 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctcccc 5253 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccc 289 |||| |||||||||| |||||||||||||| || || ||||| ||||| |||||||| Sbjct: 78726 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctcccc 78670 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Plus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||||||||| |||||||| || ||||| || ||||||||||| ||||| Sbjct: 21662 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctc 21710
>emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||| |||||||||||||||||||| |||||||||||||| ||||| Sbjct: 693 ggtgtacttggtaacggccttggtgccctcggacacggcgtgcttggccagctc 640
>emb|BX014618.1|CNS08JFY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA22AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 610 Score = 75.8 bits (38), Expect = 7e-11 Identities = 44/46 (95%) Strand = Plus / Plus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg 278 |||| |||||||||||||||||||||||||||| |||||||||||| Sbjct: 177 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttg 222
>emb|Z80781.1|HSH2BJ H.sapiens H2B/j gene Length = 751 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 579 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 522
>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A Length = 2964 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 869 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 816
>emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B sequence Length = 1113 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 990 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 937
>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for gene HIST2H2BE, histone 2, H2be; complete cds, incl. stopcodon Length = 381 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 316
>ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2bk), mRNA Length = 540 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctcccca 352
>gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116762 IMAGE:40002316), complete cds Length = 425 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 312
>gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116765 IMAGE:40002319), complete cds Length = 425 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 312
>gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116763 IMAGE:40002317), complete cds Length = 425 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 312
>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767 IMAGE:40002353), complete cds Length = 430 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 316
>gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116764 IMAGE:40002318), complete cds Length = 425 Score = 75.8 bits (38), Expect = 7e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 |||| |||||||||||||||| ||||||||||| |||||||||||||| || |||||| Sbjct: 369 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttcccca 312
>emb|CR859861.1| Pongo pygmaeus mRNA; cDNA DKFZp469M064 (from clone DKFZp469M064) Length = 756 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 390 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 337
>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528) Length = 2237 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 358
>dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG2008321, highly similar to HISTONE H2B F Length = 2359 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 339
>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1 Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 695
>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene, hereditary haemochromatosis (HLA-H) gene, RoRet gene, and sodium phosphate transporter (NPT3) gene, complete cds Length = 246282 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 17523 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctc 17470 Score = 42.1 bits (21), Expect = 1.0 Identities = 45/53 (84%) Strand = Plus / Minus Query: 238 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcccca 290 ||||||| || ||||| ||||||||||| || || ||||| || ||||||||| Sbjct: 97765 acttggtaactgccttagtgccctcggacacagcatgcttagccagctcccca 97713
>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1 Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 695
>emb|CR353801.1| Gallus gallus finished cDNA, clone ChEST919h3 Length = 596 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 185 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 132
>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 695
>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 695
>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 749 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 696
>gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, complete cds Length = 1137 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 748 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctc 695
>emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4) Length = 705 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 594 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 541
>emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3) Length = 1467 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 1188 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 1135
>emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV Length = 1042 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| |||||||||||||||||||| ||||||||||| ||||| Sbjct: 602 ggtgtacttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctc 549
>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be (HIST2H2BE) mRNA, complete cds Length = 381 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 316
>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804 IMAGE:40014249), complete cds Length = 456 Score = 75.8 bits (38), Expect = 7e-11 Identities = 50/54 (92%) Strand = Plus / Minus Query: 233 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 286 |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctc 316 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,343,827 Number of Sequences: 3902068 Number of extensions: 1343827 Number of successful extensions: 20026 Number of sequences better than 10.0: 697 Number of HSP's better than 10.0 without gapping: 700 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 19107 Number of HSP's gapped (non-prelim): 919 length of query: 303 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 281 effective length of database: 17,147,199,772 effective search space: 4818363135932 effective search space used: 4818363135932 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
