Clone Name	rbags26a06
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|U49505.1|HVU49505 Hordeum vulgare profilin (Hvpro1) mRNA, com...	682	0.0
2	emb|X89826.1|TAPRO2GEN T.aestivum mRNA for profilin (clone TaPRO2)	369	6e-99
3	emb|X89825.1|TAPRO1GEN T.aestivum mRNA for profilin (clone TaPRO1)	361	1e-96
4	emb|X89827.1|TAPRO3GEN T.aestivum mRNA for profilin (clone TaPRO3)	357	2e-95
5	gb|AY103599.1| Zea mays PCO094927 mRNA sequence	228	1e-56
6	gb|AF032370.1|AF032370 Zea mays profilin (PRO4) mRNA, complete cds	228	1e-56
7	gb|BT018328.1| Zea mays clone EL01T0208F04.c mRNA sequence	214	2e-52
8	gb|AF201459.1|AF201459 Zea mays profilin 5 (PRO5) mRNA, complete...	214	2e-52
9	ref|XM_550652.1| Oryza sativa (japonica cultivar-group), mRNA	210	3e-51
10	dbj|AK121519.1| Oryza sativa (japonica cultivar-group) cDNA clon...	210	3e-51
11	dbj|AK058798.1| Oryza sativa (japonica cultivar-group) cDNA clon...	210	3e-51
12	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	133	6e-28
13	dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic D...	133	6e-28
14	dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic D...	133	6e-28
15	emb|Y09457.1|PPPROFIL3 P.pratense mRNA for profilin 3	105	1e-19
16	emb|X73279.1|ZMPRO1MR Z.mays ZmPRO1 mRNA for profilin 1	100	9e-18
17	emb|AJ507459.1|MDO507459 Malus x domestica mRNA for apple allerg...	100	9e-18
18	gb|AY109559.1| Zea mays CL2097_1 mRNA sequence	100	9e-18
19	emb|AJ565931.1|CME565931 Cucumis melo mRNA for profilin (cuc m 2...	98	3e-17
20	emb|AJ491881.1|PPE491881 Prunus persica mRNA for profilin, aller...	98	3e-17
21	gb|AF129425.1|AF129425 Prunus avium profilin mRNA, complete cds	98	3e-17
22	gb|AF377949.1|AF377949 Ananas comosus profilin mRNA, complete cds	92	2e-15
23	gb|AF129428.1|AF129428 Malus domestica GD4-5 profilin mRNA, comp...	92	2e-15
24	gb|AF129427.1|AF129427 Malus domestica GD4-2 profilin mRNA, comp...	92	2e-15
25	emb|Y09458.1|PPPROFIL4 P.pratense mRNA for profilin 4	90	8e-15
26	emb|AJ865015.1| Citrus sinensis mRNA for profilin allergen Cit s...	90	8e-15
27	gb|AY081850.1| Prunus dulcis profilin (pru du 4.1) mRNA, complet...	90	8e-15
28	gb|AF200184.1|AF200184 Lilium longiflorum profilin 1 mRNA, compl...	88	3e-14
29	emb|AJ507458.1|MDO507458 Malus x domestica mRNA for apple allerg...	86	1e-13
30	gb|AY081852.1| Prunus dulcis profilin (pru du 4.2) mRNA, complet...	86	1e-13
31	emb|Y09456.1|PPPROFIL2 P.pratense mRNA for profilin 2	82	2e-12
32	emb|X82120.1|NTPROFLN N.tabacum mRNA for profilin	80	8e-12
33	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	78	3e-11
34	dbj|AP002743.1| Oryza sativa (japonica cultivar-group) genomic D...	78	3e-11
35	emb|X93465.1|NTPRO2MR N.tabacum mRNA for profilin (clone NTPRO2)	76	1e-10
36	emb|AJ132397.1|HBR132397 Hevea brasiliensis mRNA for hevea brasi...	76	1e-10
37	ref|NM_195688.1| Oryza sativa (japonica cultivar-group) Profilin...	74	5e-10
38	ref|NM_195685.1| Oryza sativa (japonica cultivar-group) Profilin...	74	5e-10
39	emb|X77583.1|PPPROPXI P.pratense mRNA for profilin-Phl p XI	74	5e-10
40	gb|AF310253.1|AF310253 Oryza sativa profilin A mRNA, complete cds	74	5e-10
41	dbj|AK121412.1| Oryza sativa (japonica cultivar-group) cDNA clon...	74	5e-10
42	dbj|AK100089.1| Oryza sativa (japonica cultivar-group) cDNA clon...	74	5e-10
43	gb|AY792613.1| Malus x domestica clone M4-2-FS8 profilin 2 (Mal ...	72	2e-09
44	gb|AY792612.1| Malus x domestica clone M4-2-PM2 profilin 2 (Mal ...	72	2e-09
45	gb|AY792611.1| Malus x domestica clone M4-2-FS10 profilin 2 (Mal...	72	2e-09
46	gb|AY792610.1| Malus x domestica clone M4-2-PM7 profilin 2 (Mal ...	72	2e-09
47	emb|AJ491882.1|PPE491882 Prunus persica mRNA for profilin, aller...	70	8e-09
48	emb|AJ130969.1|NTA130969 Nicotiana tabacum pronp1 gene, exons 1-3	70	8e-09
49	gb|DQ400579.1| Mangifera indica profilin 2 mRNA, complete cds	70	8e-09
50	gb|AF377948.1|AF377948 Musa acuminata profilin mRNA, complete cds	70	8e-09
51	gb|AY082337.1| Chenopodium album pollen allergen Che a 2 mRNA, c...	70	8e-09
52	gb|U50195.1|SLU50195 Solanum lycopersicum profilin (LePro1) mRNA...	70	8e-09
53	emb|X73281.1|ZMPRO3MR Z.mays ZmPRO3 mRNA for profilin 3	66	1e-07
54	dbj|AK070595.1| Oryza sativa (japonica cultivar-group) cDNA clon...	66	1e-07
55	gb|AF126263.1|AF126263 Phalaenopsis sp. 'KCbutterfly' putative p...	66	1e-07
56	gb|AY898658.1| Crocus sativus profilin mRNA, complete cds	66	1e-07
57	gb|M65179.1|BELPRFLN B.verrucosa profilin (BetvII) mRNA, complet...	66	1e-07
58	gb|AY792617.1| Malus x domestica clone M4-5-FS4 profilin 3 (Mal ...	62	2e-06
59	gb|AY792616.1| Malus x domestica clone M4-5-FS5 profilin 3 (Mal ...	62	2e-06
60	gb|AY792615.1| Malus x domestica clone M4-5-PM2 profilin 3 (Mal ...	62	2e-06
61	gb|AY792614.1| Malus x domestica clone M4-5-PM7 profilin 3 (Mal ...	62	2e-06
62	emb|X73280.1|ZMPRO2MR Z.mays ZmPRO2 mRNA for profilin 2	62	2e-06
63	gb|DQ270547.1| Mangifera indica profilin 1 (Man i 3.01) mRNA, co...	62	2e-06
64	gb|AF092547.1|AF092547 Ricinus communis profilin (pro1) mRNA, co...	62	2e-06
65	gb|AY268424.1| Humulus scandens profilin-like protein (LCM9) mRN...	60	7e-06
66	emb|AJ417566.1|PDA417566 Phoenix dactylifera mRNA for profilin (...	60	7e-06
67	emb|Y12425.1|OEPROFIL1 Olea europaea mRNA for profilin 1	58	3e-05
68	gb|AC074354.8|AC074354 Genomic Sequence for Oryza sativa, Nippon...	58	3e-05
69	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	58	3e-05
70	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	58	3e-05
71	emb|X81982.1|PVPROFILN P.vulgaris mRNA for profilin	56	1e-04
72	emb|AJ421030.1|AVU421030 Artemisia vulgaris mRNA for profilin, i...	56	1e-04
73	gb|AY292385.2| Cucumis melo var. reticulatus profilin (Cu m2) mR...	54	5e-04
74	gb|AY292386.3| Cucumis melo var. reticulatus cultivar Mashadi pr...	54	5e-04
75	gb|AY292387.3| Cucumis melo var. reticulatus cultivar Mashadi pr...	54	5e-04
76	gb|AY271295.2| Cucumis melo var. reticulatus profilin (Cuc m2) m...	54	5e-04
77	emb|AJ223982.1|GMPRO1 Glycine max mRNA for profilin, PRO1	54	5e-04
78	emb|AJ223981.1|GMPRO2 Glycine max mRNA for profilin, PRO2	54	5e-04
79	gb|AF119367.1|AF119367 Hevea brasiliensis clone hevb 8.10 latex ...	54	5e-04
80	gb|AY109853.1| Zea mays CL2096_2 mRNA sequence	54	5e-04
81	ref|NM_125043.2| Arabidopsis thaliana PRF3 (PROFILIN 3); actin b...	52	0.002
82	ref|NM_127534.2| Arabidopsis thaliana PRF1 (PROFILIN 1); actin b...	52	0.002
83	gb|AY730591.1| Citrullus lanatus profilin mRNA, partial cds	52	0.002
84	gb|BT000885.1| Arabidopsis thaliana clone C105361 putative profi...	52	0.002
85	gb|AY034989.1| Arabidopsis thaliana putative profilin protein (A...	52	0.002
86	gb|BT000264.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA,...	52	0.002
87	gb|AY072427.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA,...	52	0.002
88	gb|U43592.1|U43592 Arabidopsis thaliana profilin (PRF3) mRNA, co...	52	0.002
89	gb|U43590.1|U43590 Arabidopsis thaliana profilin (PRF1) mRNA, co...	52	0.002
90	emb|BX818797.1|CNS0A9XS Arabidopsis thaliana Full-length cDNA Co...	52	0.002
91	emb|BX833469.1|CNS0A0EA Arabidopsis thaliana Full-length cDNA Co...	52	0.002
92	gb|AY084285.1| Arabidopsis thaliana clone 102364 mRNA, complete ...	52	0.002
93	dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	52	0.002
94	gb|AF200186.1|AF200186 Lilium longiflorum profilin 3 mRNA, compl...	52	0.002
95	gb|U43325.1|ATU43325 Arabidopsis thaliana profilin 1 mRNA, compl...	52	0.002
96	gb|AY726606.1| Arachis hypogaea profilin (PROF) mRNA, complete cds	50	0.007
97	gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map...	50	0.007
98	gb|AY268426.1| Ambrosia artemisiifolia profilin-like protein (D1...	50	0.007
99	gb|U43593.1|U43593 Arabidopsis thaliana profilin (PRF1) gene, co...	50	0.007
100	gb|U43322.1|ATU43322 Arabidopsis thaliana profilin 1 gene, compl...	50	0.007
101	emb|Y12430.1|OEPROFIL3 Olea europaea mRNA for profilin 3	48	0.028
102	gb|AF059616.1|AF059616 Arachis hypogaea profilin (Ara h 5) mRNA,...	48	0.028
103	ref|NM_119080.2| Arabidopsis thaliana PRF2 (PROFILIN 2); actin b...	46	0.11
104	ref|NM_119079.3| Arabidopsis thaliana PRF4; actin binding AT4G29...	46	0.11
105	gb|DQ228336.1| Solanum tuberosum clone 145G03 profilin-like prot...	46	0.11
106	gb|DQ207877.1| Solanum tuberosum clone 092D10 profilin-like mRNA...	46	0.11
107	gb|AY496123.1| Capsicum annuum profilin mRNA, complete cds	46	0.11
108	gb|AY114048.1| Arabidopsis thaliana putative profilin 2 protein ...	46	0.11
109	gb|AY074350.1| Arabidopsis thaliana putative profilin 2 protein ...	46	0.11
110	emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, ...	46	0.11
111	gb|BT024816.1| Arabidopsis thaliana At4g29340 gene, complete cds	46	0.11
112	gb|AY894660.1| Ambrosia artemisiifolia profilin isoallergen 1 mR...	46	0.11
113	gb|BT003946.1| Arabidopsis thaliana clone RAFL15-14-D07 (R20752)...	46	0.11
114	gb|AY086576.1| Arabidopsis thaliana clone 25886 mRNA, complete s...	46	0.11
115	gb|AY085179.1| Arabidopsis thaliana clone 13601 mRNA, complete s...	46	0.11
116	gb|AY900016.1| Petroselinum crispum profilin 5 (PRF5) mRNA, comp...	46	0.11
117	gb|AY879597.1| Cucumis melo profilin (m2) mRNA, complete cds and...	46	0.11
118	gb|U43326.1|ATU43326 Arabidopsis thaliana profilin 2 mRNA, compl...	46	0.11
119	gb|U43323.1|ATU43323 Arabidopsis thaliana profilin 2 and profili...	46	0.11
120	gb|AY268425.1| Ambrosia artemisiifolia profilin-like protein (A0...	44	0.44
121	gb|AY499654.1| Capsicum annuum profilin mRNA, partial cds	44	0.44
122	gb|AC101882.14| Mus musculus chromosome 10, clone RP23-394M6, co...	44	0.44
123	emb|Y15042.1|HBY15042 Hevea brasiliensis mRNA for profilin	44	0.44
124	emb|AJ417553.1|LES417553 Lycopersicon esculentum mRNA for profil...	44	0.44
125	gb|AF327623.1|AF327623 Corylus avellana clone 7 minor allergen h...	44	0.44
126	gb|AF327622.1|AF327622 Corylus avellana clone 6 minor allergen h...	44	0.44
127	gb|U43594.1|U43594 Arabidopsis thaliana profilin (PRF4) gene, co...	44	0.44
128	gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Can...	44	0.44
129	gb|AF119366.1|AF119366 Hevea brasiliensis clone hevb 8.8 latex p...	44	0.44
130	gb|DQ335252.1| Cinnamomum camphora profilin-like protein (Cin c ...	44	0.44
131	gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, compl...	42	1.7
132	dbj|AK133754.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	42	1.7
133	gb|AC158222.6| Mus musculus chromosome 8, clone RP23-117M15, com...	42	1.7
134	gb|AF352180.1|AF352180 Mus musculus pericentriolar material gene...	42	1.7
135	ref|NM_023662.1| Mus musculus pericentriolar material 1 (Pcm1), ...	42	1.7
136	dbj|AB029291.1| Mus musculus pcm-1 mRNA for pericentriolar mater...	42	1.7
137	ref|XM_422236.1| PREDICTED: Gallus gallus similar to KIAA1096 pr...	40	6.8
138	gb|AC154768.2| Mus musculus BAC clone RP24-444E21 from chromosom...	40	6.8
139	gb|AC123957.4| Mus musculus BAC clone RP23-302N2 from 12, comple...	40	6.8
140	emb|Y13271.1|MAPROFILN Mercurialis annua mRNA for profilin	40	6.8
141	emb|Y12429.1|OEPROFIL2 Olea europaea mRNA for profilin 2	40	6.8
142	gb|AC102657.13| Mus musculus chromosome 10, clone RP23-15N10, co...	40	6.8

---

>gb|U49505.1|HVU49505 Hordeum vulgare profilin (Hvpro1) mRNA, complete cds
          Length = 780

 Score =  682 bits (344), Expect = 0.0
 Identities = 366/374 (97%)
 Strand = Plus / Minus

                                                                       
Query: 130 ccttcgacacgtcaccaaccgacaaaccccaagctagattattcactgcatatatcatgc 189
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 630 ccttcgacacatcaccaaccgacaaaccccaagctagattattcactgcatatatcatgc 571

                                                                       
Query: 190 ggtacgccaagcggatagatgcaaagcccacaggagcaaacttagtcccagacgaccaaa 249
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 ggtacgccaagcagatagatgcaaagcccacaggagcaaacttagtcccagacgaccaaa 511

                                                                       
Query: 250 ataacaacatatcagggtgggcttagaaaccctgctcgaccaggtagtcgccaagcctct 309
           |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 ataacaacatatcaggggaggcttagaaaccctgctcgaccaggtagtcgccaagcctct 451

                                                                       
Query: 310 ccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaagaatcaggg 369
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 450 ccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccgagaatcaggg 391

                                                                       
Query: 370 ccatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccc 429
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 390 gcatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccc 331

                                                                       
Query: 430 caggttcaccttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 330 caggttcaccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaa 271

                         
Query: 490 natgtccgggttcg 503
            |||||||||||||
Sbjct: 270 gatgtccgggttcg 257



 Score =  149 bits (75), Expect = 1e-32
 Identities = 95/100 (95%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 1   taaagcagcagcagcaaccnacaagttacnntgacgcaggcaaatgtacattactcagcg 60
           |||||||||||||| |||| |||||||||  |||| ||||||||||||||||||||||||
Sbjct: 759 taaagcagcagcag-aacccacaagttaccatgac-caggcaaatgtacattactcagcg 702

                                                   
Query: 61  aaagagcagctgagtttgatacgacacgatgccaaacatt 100
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 701 aaagagcagctgagtttgatacgacacgatgccaaacatt 662

---

>emb|X89826.1|TAPRO2GEN T.aestivum mRNA for profilin (clone TaPRO2)
          Length = 492

 Score =  369 bits (186), Expect = 6e-99
 Identities = 205/212 (96%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 427 aggtagtcgccgagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 368

                                                                       
Query: 351 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 410
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 367 tagataccaagaatcagggccatgccggtcttcttgatagtaatgccaccggtgcccttc 308

                                                                       
Query: 411 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaagg 470
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 307 tttcctcggatgacaaccccaggttcaccttggatgaccatgtactttgtgcctccaagg 248

                                           
Query: 471 aaaanaccagttggtgcaanatgtccgggttc 502
           |||| ||||||||||||||  ||||| |||||
Sbjct: 247 aaaagaccagttggtgcaaggtgtccaggttc 216

---

>emb|X89825.1|TAPRO1GEN T.aestivum mRNA for profilin (clone TaPRO1)
          Length = 454

 Score =  361 bits (182), Expect = 1e-96
 Identities = 204/212 (96%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 418 aggtaatcgccgagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 359

                                                                       
Query: 351 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 410
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 358 tagataccaagaatcagggccatgccggtcttcttgatagtaatgccaccggtgcccttc 299

                                                                       
Query: 411 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaagg 470
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 298 tttcctcggatgacaaccccaggttcaccttggatgaccatgtactttgtgcctccaagg 239

                                           
Query: 471 aaaanaccagttggtgcaanatgtccgggttc 502
           |||| ||||||||||||||  ||||| |||||
Sbjct: 238 aaaagaccagttggtgcaaggtgtccaggttc 207

---

>emb|X89827.1|TAPRO3GEN T.aestivum mRNA for profilin (clone TaPRO3)
          Length = 489

 Score =  357 bits (180), Expect = 2e-95
 Identities = 214/226 (94%)
 Strand = Plus / Minus

                                                                       
Query: 277 aaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggag 336
           ||||||| |||| |||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 441 aaccctgatcgatcaggtaatcgccgagcctctccacgaccaaattgcactggccaggag 382

                                                                       
Query: 337 tcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgc 396
           ||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 381 tcatgggttcatcgtagataccaagaatcagggccatgccggtcttcttgatagtgatgc 322

                                                                       
Query: 397 caccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatt 456
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 321 caccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtact 262

                                                         
Query: 457 ttgtgcctccaaggaaaanaccagttggtgcaanatgtccgggttc 502
           |||||||||||||||||| ||||||||||||||  ||||| |||||
Sbjct: 261 ttgtgcctccaaggaaaagaccagttggtgcaaggtgtccaggttc 216

---

>gb|AY103599.1| Zea mays PCO094927 mRNA sequence
          Length = 883

 Score =  228 bits (115), Expect = 1e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
           |||||| |||||||||| |||||| ||||| ||||||||||| ||||  ||||| || ||
Sbjct: 530 ttagaagccctgctcgatcaggtaatcgccgagcctctccaccaccatgttgcattgccc 471

                                                                       
Query: 332 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
            |||||||| ||||| ||||||| ||||| ||||| || |||||| || |||||||||||
Sbjct: 470 tggagtcattggctcgtcgtagacaccaataatcaaggacatgccggttttcttgatagt 411

                                                                       
Query: 392 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 451
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 410 aatgcccccagtgcccttctttcctcggatgacaactccaggttcaccttggatcaccat 351

                                                 
Query: 452 gtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| ||||| ||||||| ||||| ||||||||||||||
Sbjct: 350 gtactttgtacctccaacgaaaagaccagttggtgcaa 313



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 56/60 (93%), Gaps = 1/60 (1%)
 Strand = Plus / Minus

                                                                       
Query: 37  caggcaaatgtacattactcagcgaaagagcagctgagttt-gatacgacacgatgccaa 95
           |||| |||||||||||||||||||||| ||||||||||||| |||||||| |||||||||
Sbjct: 761 cagggaaatgtacattactcagcgaaacagcagctgagtttcgatacgacgcgatgccaa 702



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 cccaagctagattattcactgcat 180
           ||||||||| ||||||||||||||
Sbjct: 651 cccaagctaaattattcactgcat 628

---

>gb|AF032370.1|AF032370 Zea mays profilin (PRO4) mRNA, complete cds
          Length = 798

 Score =  228 bits (115), Expect = 1e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
           |||||| |||||||||| |||||| ||||| ||||||||||| ||||  ||||| || ||
Sbjct: 478 ttagaagccctgctcgatcaggtaatcgccgagcctctccaccaccatgttgcattgccc 419

                                                                       
Query: 332 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
            |||||||| ||||| ||||||| ||||| ||||| || |||||| || |||||||||||
Sbjct: 418 tggagtcattggctcgtcgtagacaccaataatcaaggacatgccggttttcttgatagt 359

                                                                       
Query: 392 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 451
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 358 aatgcccccagtgcccttctttcctcggatgacaactccaggttcaccttggatcaccat 299

                                                 
Query: 452 gtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| ||||| ||||||| ||||| ||||||||||||||
Sbjct: 298 gtactttgtacctccaacgaaaagaccagttggtgcaa 261



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 56/60 (93%), Gaps = 1/60 (1%)
 Strand = Plus / Minus

                                                                       
Query: 37  caggcaaatgtacattactcagcgaaagagcagctgagttt-gatacgacacgatgccaa 95
           |||| |||||||||||||||||||||| ||||||||||||| |||||||| |||||||||
Sbjct: 709 cagggaaatgtacattactcagcgaaacagcagctgagtttcgatacgacgcgatgccaa 650



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 cccaagctagattattcactgcat 180
           ||||||||| ||||||||||||||
Sbjct: 599 cccaagctaaattattcactgcat 576

---

>gb|BT018328.1| Zea mays clone EL01T0208F04.c mRNA sequence
          Length = 958

 Score =  214 bits (108), Expect = 2e-52
 Identities = 191/219 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
           ||||||| ||||| |||| |||||| ||||| ||||||||||| |||| |||||| || |
Sbjct: 419 cttagaagccctgttcgatcaggtaatcgccgagcctctccaccaccatattgcattgcc 360

                                                                       
Query: 331 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 390
           | |||||||| |||||||| |||||||| | ||||| || |||||| || ||||||||||
Sbjct: 359 ctggagtcattggctcatcatagataccgataatcaaggacatgccagttttcttgatag 300

                                                                       
Query: 391 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 450
           ||||||| || |||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 299 taatgcctccagtgcccttctttcctcggatgacaactccaggttcaccttggatcacca 240

                                                  
Query: 451 tgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           |||| || || |||||||  |||| ||||||||||||||
Sbjct: 239 tgtacttcgtacctccaacaaaaagaccagttggtgcaa 201



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 37  caggcaaatgtacattactcagcgaaagagcagctgagtt 76
           |||| ||||||||||||||||| |||| ||||||||||||
Sbjct: 874 cagggaaatgtacattactcagggaaacagcagctgagtt 835

---

>gb|AF201459.1|AF201459 Zea mays profilin 5 (PRO5) mRNA, complete cds
          Length = 703

 Score =  214 bits (108), Expect = 2e-52
 Identities = 191/219 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
           ||||||| ||||| |||| |||||| ||||| ||||||||||| |||| |||||| || |
Sbjct: 475 cttagaagccctgttcgatcaggtaatcgccgagcctctccaccaccatattgcattgcc 416

                                                                       
Query: 331 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 390
           | |||||||| |||||||| |||||||| | ||||| || |||||| || ||||||||||
Sbjct: 415 ctggagtcattggctcatcatagataccgataatcaaggacatgccagttttcttgatag 356

                                                                       
Query: 391 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 450
           ||||||| || |||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 355 taatgcctccagtgcccttctttcctcggatgacaactccaggttcaccttggatcacca 296

                                                  
Query: 451 tgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           |||| || || |||||||  |||| ||||||||||||||
Sbjct: 295 tgtacttcgtacctccaacaaaaagaccagttggtgcaa 257

---

>ref|XM_550652.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 775

 Score =  210 bits (106), Expect = 3e-51
 Identities = 189/217 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
           ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 503 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 444

                                                                       
Query: 331 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 390
           | || ||||| |||||||| ||||| ||||||||||  | || ||| |||||||||| | 
Sbjct: 443 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttgacac 384

                                                                       
Query: 391 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 450
             ||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 383 atatgcctccagtgcccttctttcctcggatgacaacccctggttcaccttggatcacca 324

                                                
Query: 451 tgtattttgtgcctccaaggaaaanaccagttggtgc 487
           ||||||||||||| |||||||||| ||||||||||||
Sbjct: 323 tgtattttgtgcccccaaggaaaagaccagttggtgc 287



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 37  caggcaaatgtacattactcagcgaaagagcagctgagtttgatacgacacgatgccaaa 96
           |||| |||||||||  |||||| ||| |  ||||||||||||||||||||||||||||||
Sbjct: 726 caggtaaatgtacagaactcagtgaatggacagctgagtttgatacgacacgatgccaaa 667

              
Query: 97  cat 99
           |||
Sbjct: 666 cat 664

---

>dbj|AK121519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028A03, full
           insert sequence
          Length = 776

 Score =  210 bits (106), Expect = 3e-51
 Identities = 189/217 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
           ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 504 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 445

                                                                       
Query: 331 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 390
           | || ||||| |||||||| ||||| ||||||||||  | || ||| |||||||||| | 
Sbjct: 444 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttgacac 385

                                                                       
Query: 391 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 450
             ||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 384 atatgcctccagtgcccttctttcctcggatgacaacccctggttcaccttggatcacca 325

                                                
Query: 451 tgtattttgtgcctccaaggaaaanaccagttggtgc 487
           ||||||||||||| |||||||||| ||||||||||||
Sbjct: 324 tgtattttgtgcccccaaggaaaagaccagttggtgc 288



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 37  caggcaaatgtacattactcagcgaaagagcagctgagtttgatacgacacgatgccaaa 96
           |||| |||||||||  |||||| ||| |  ||||||||||||||||||||||||||||||
Sbjct: 727 caggtaaatgtacagaactcagtgaatggacagctgagtttgatacgacacgatgccaaa 668

              
Query: 97  cat 99
           |||
Sbjct: 667 cat 665

---

>dbj|AK058798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H10, full
           insert sequence
          Length = 775

 Score =  210 bits (106), Expect = 3e-51
 Identities = 189/217 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
           ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 503 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 444

                                                                       
Query: 331 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 390
           | || ||||| |||||||| ||||| ||||||||||  | || ||| |||||||||| | 
Sbjct: 443 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttgacac 384

                                                                       
Query: 391 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 450
             ||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 383 atatgcctccagtgcccttctttcctcggatgacaacccctggttcaccttggatcacca 324

                                                
Query: 451 tgtattttgtgcctccaaggaaaanaccagttggtgc 487
           ||||||||||||| |||||||||| ||||||||||||
Sbjct: 323 tgtattttgtgcccccaaggaaaagaccagttggtgc 287



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 37  caggcaaatgtacattactcagcgaaagagcagctgagtttgatacgacacgatgccaaa 96
           |||| |||||||||  |||||| ||| |  ||||||||||||||||||||||||||||||
Sbjct: 726 caggtaaatgtacagaactcagtgaatggacagctgagtttgatacgacacgatgccaaa 667

              
Query: 97  cat 99
           |||
Sbjct: 666 cat 664

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  133 bits (67), Expect = 6e-28
 Identities = 78/82 (95%)
 Strand = Plus / Minus

                                                                           
Query: 406     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
               ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
Sbjct: 2690735 ccttctttcctcggatgacaacccctggttcaccttggatcaccatgtattttgtgcccc 2690676

                                     
Query: 466     caaggaaaanaccagttggtgc 487
               ||||||||| ||||||||||||
Sbjct: 2690675 caaggaaaagaccagttggtgc 2690654



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                           
Query: 271     cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
               ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 2691751 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 2691692

                                                                        
Query: 331     caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttga 387
               | || ||||| |||||||| ||||| ||||||||||  | || ||| ||||||||||
Sbjct: 2691691 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttga 2691635



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                           
Query: 37      caggcaaatgtacattactcagcgaaagagcagctgagtttgatacgacacgatgccaaa 96
               |||| |||||||||  |||||| ||| |  ||||||||||||||||||||||||||||||
Sbjct: 2691974 caggtaaatgtacagaactcagtgaatggacagctgagtttgatacgacacgatgccaaa 2691915

                  
Query: 97      cat 99
               |||
Sbjct: 2691914 cat 2691912

---

>dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0710H01
          Length = 187107

 Score =  133 bits (67), Expect = 6e-28
 Identities = 78/82 (95%)
 Strand = Plus / Minus

                                                                          
Query: 406    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
              ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
Sbjct: 146076 ccttctttcctcggatgacaacccctggttcaccttggatcaccatgtattttgtgcccc 146017

                                    
Query: 466    caaggaaaanaccagttggtgc 487
              ||||||||| ||||||||||||
Sbjct: 146016 caaggaaaagaccagttggtgc 145995



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                          
Query: 271    cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
              ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 147092 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 147033

                                                                       
Query: 331    caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttga 387
              | || ||||| |||||||| ||||| ||||||||||  | || ||| ||||||||||
Sbjct: 147032 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttga 146976



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                          
Query: 37     caggcaaatgtacattactcagcgaaagagcagctgagtttgatacgacacgatgccaaa 96
              |||| |||||||||  |||||| ||| |  ||||||||||||||||||||||||||||||
Sbjct: 147315 caggtaaatgtacagaactcagtgaatggacagctgagtttgatacgacacgatgccaaa 147256

                 
Query: 97     cat 99
              |||
Sbjct: 147255 cat 147253

---

>dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0529C07
          Length = 174011

 Score =  133 bits (67), Expect = 6e-28
 Identities = 78/82 (95%)
 Strand = Plus / Minus

                                                                          
Query: 406    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
              ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
Sbjct: 102482 ccttctttcctcggatgacaacccctggttcaccttggatcaccatgtattttgtgcccc 102423

                                    
Query: 466    caaggaaaanaccagttggtgc 487
              ||||||||| ||||||||||||
Sbjct: 102422 caaggaaaagaccagttggtgc 102401



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                          
Query: 271    cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 330
              ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 103498 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 103439

                                                                       
Query: 331    caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttga 387
              | || ||||| |||||||| ||||| ||||||||||  | || ||| ||||||||||
Sbjct: 103438 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttga 103382



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                          
Query: 37     caggcaaatgtacattactcagcgaaagagcagctgagtttgatacgacacgatgccaaa 96
              |||| |||||||||  |||||| ||| |  ||||||||||||||||||||||||||||||
Sbjct: 103721 caggtaaatgtacagaactcagtgaatggacagctgagtttgatacgacacgatgccaaa 103662

                 
Query: 97     cat 99
              |||
Sbjct: 103661 cat 103659

---

>emb|Y09457.1|PPPROFIL3 P.pratense mRNA for profilin 3
          Length = 396

 Score =  105 bits (53), Expect = 1e-19
 Identities = 139/165 (84%), Gaps = 2/165 (1%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||||||||||||||||||||| ||||  |||||||| ||||| |||||||||||||||
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcatcg 318

                                                                       
Query: 351 tagataccaagaatcagggccatgccc-gtcttcttgatagtaatgccaccggtgccctt 409
           ||||| || | || ||| ||| ||||| |||||||| || || ||||| || |  |||||
Sbjct: 317 tagatgccgacaaccagcgcc-tgccctgtcttctttatggtgatgcctcctgctccctt 259

                                                        
Query: 410 ctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
           ||| || ||||||||  | || |||||||| ||||||||||||||
Sbjct: 258 cttgccacggatgaccgcgccgggttcaccctggatgaccatgta 214

---

>emb|X73279.1|ZMPRO1MR Z.mays ZmPRO1 mRNA for profilin 1
          Length = 1048

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 160/194 (82%), Gaps = 2/194 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           ||||| |||| |||||||||||| ||||| ||||| ||||  |||||||| || ||||||
Sbjct: 516 ccctgttcgagcaggtagtcgcccagcctttccaccaccaggttgcactgcccgggagtc 457

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgccc-gtcttcttgatagtaatgcc 397
           || ||||| |||||||| ||||  || || | | ||||| || ||||| | ||| |||||
Sbjct: 456 atcggctcgtcgtagatgccaatgatgagtgac-tgccctgttttcttcacagtgatgcc 398

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
            ||||  |||||||| || ||||||||| | |||||||| ||||||||||||||||| ||
Sbjct: 397 cccggatcccttcttgccacggatgacagctccaggttcgccttggatgaccatgtactt 338

                         
Query: 458 tgtgcctccaagga 471
            |||||||| ||||
Sbjct: 337 ggtgcctcccagga 324

---

>emb|AJ507459.1|MDO507459 Malus x domestica mRNA for apple allergen profilin (pf-3 gene),
           clone 3
          Length = 683

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 172/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 272 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
           ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 396 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 337

                                                                       
Query: 332 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
           ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 336 aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 277

                                                                       
Query: 392 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 451
           ||| || || | ||||||||||||||| |||||| | || |||||||| ||||| |||||
Sbjct: 276 aattccgcccgagcccttctttcctcgaatgacagcgccgggttcaccctggatcaccat 217

                                            
Query: 452 gtattttgtgcctccaaggaaaanaccagttgg 484
            || || || || |||||||| |  ||||||||
Sbjct: 216 atacttcgtcccaccaaggaataatccagttgg 184

---

>gb|AY109559.1| Zea mays CL2097_1 mRNA sequence
          Length = 983

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 160/194 (82%), Gaps = 2/194 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           ||||| |||| |||||||||||| ||||| ||||| ||||  |||||||| || ||||||
Sbjct: 513 ccctgttcgagcaggtagtcgcccagcctttccaccaccaggttgcactgcccgggagtc 454

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgccc-gtcttcttgatagtaatgcc 397
           || ||||| |||||||| ||||  || || | | ||||| || ||||| | ||| |||||
Sbjct: 453 atcggctcgtcgtagatgccaatgatgagtgac-tgccctgttttcttcacagtgatgcc 395

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
            ||||  |||||||| || ||||||||| | |||||||| ||||||||||||||||| ||
Sbjct: 394 tccggatcccttcttgccacggatgacagctccaggttcgccttggatgaccatgtactt 335

                         
Query: 458 tgtgcctccaagga 471
            |||||||| ||||
Sbjct: 334 ggtgcctcccagga 321

---

>emb|AJ565931.1|CME565931 Cucumis melo mRNA for profilin (cuc m 2 gene)
          Length = 396

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 171/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 337
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 331

                                                                       
Query: 338 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 397
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 271

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 211

                                           
Query: 458 tgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||| | ||||||||| ||||
Sbjct: 210 tgtcccaccaaggaataaaccagttggggcaa 179

---

>emb|AJ491881.1|PPE491881 Prunus persica mRNA for profilin, allergen Pru p 4.01
          Length = 396

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 171/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 337
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 331

                                                                       
Query: 338 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 397
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 271

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 211

                                           
Query: 458 tgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||| | ||||||||| ||||
Sbjct: 210 tgtcccaccaaggaataaaccagttggggcaa 179

---

>gb|AF129425.1|AF129425 Prunus avium profilin mRNA, complete cds
          Length = 396

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 171/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 337
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcaacaatcatgttgcactgccctggagt 331

                                                                       
Query: 338 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 397
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 271

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| |||||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatattt 211

                                           
Query: 458 tgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||| |  |||||||| ||||
Sbjct: 210 tgtcccaccaaggaataacccagttggggcaa 179

---

>gb|AF377949.1|AF377949 Ananas comosus profilin mRNA, complete cds
          Length = 396

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 464
           |||||||||||||| ||||||||||| || || ||||||||||||||||||||||| || 
Sbjct: 263 cccttctttcctcgaatgacaacccctggctctccttggatgaccatgtattttgtaccg 204

                                    
Query: 465 ccaaggaaaanaccagttggtgcaa 489
           |||||| | | ||||||||| ||||
Sbjct: 203 ccaaggtataaaccagttggagcaa 179

---

>gb|AF129428.1|AF129428 Malus domestica GD4-5 profilin mRNA, complete cds
          Length = 396

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 171/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 272 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
           ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 396 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 337

                                                                       
Query: 332 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
           ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 336 aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 277

                                                                       
Query: 392 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 451
           ||| || || |  |||||||||||||| |||||| | || |||||||| ||||| |||||
Sbjct: 276 aattccgcccgaacccttctttcctcgaatgacagcgccgggttcaccctggatcaccat 217

                                            
Query: 452 gtattttgtgcctccaaggaaaanaccagttgg 484
            || || || || |||||||| |  ||||||||
Sbjct: 216 atacttcgtcccaccaaggaataatccagttgg 184

---

>gb|AF129427.1|AF129427 Malus domestica GD4-2 profilin mRNA, complete cds
          Length = 396

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 139/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 300 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcgtagatacca 359
           ||||||||||| || ||||  ||||| |||||||||||||| |||||||| || || |||
Sbjct: 368 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctcatcataaatccca 309

                                                                       
Query: 360 agaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcgg 419
           |  | ||  |||||     ||||||||| |||||  ||||| | ||||||||||||||| 
Sbjct: 308 atcagcaaagccattgtgctcttcttgacagtaacaccacctgggcccttctttcctcga 249

                                                             
Query: 420 atgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaag 469
           || ||||| || |||||||| ||||||||||||||||| || ||||||||
Sbjct: 248 atcacaactcctggttcaccctggatgaccatgtatttggtccctccaag 199

---

>emb|Y09458.1|PPPROFIL4 P.pratense mRNA for profilin 4
          Length = 396

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 137/165 (83%), Gaps = 2/165 (1%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||||||||||||||||||||| ||||  |||||||| ||||| ||||||||||| |||
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcgtcg 318

                                                                       
Query: 351 tagataccaagaatcagggccatgccc-gtcttcttgatagtaatgccaccggtgccctt 409
           ||||| || |  | ||| ||| ||||| |||||||| || || ||||| || |  |||||
Sbjct: 317 tagatgccgacgaccagcgcc-tgcccggtcttctttatggtgatgcctcctgctccctt 259

                                                        
Query: 410 ctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
           ||| || ||||||||  | || |||||||| ||||||||||||||
Sbjct: 258 cttgccacggatgaccgcgccgggttcaccctggatgaccatgta 214

---

>emb|AJ865015.1| Citrus sinensis mRNA for profilin allergen Cit s 2.0102 (cit s
           2.0102 gene)
          Length = 396

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 170/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 337
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 331

                                                                       
Query: 338 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 397
           ||  |||||||| || |||||||  || ||||||      |||||||| | | |||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacaataatgcc 271

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 211

                                           
Query: 458 tgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||| | ||||||||| ||||
Sbjct: 210 tgtcccaccaaggaataaaccagttggggcaa 179

---

>gb|AY081850.1| Prunus dulcis profilin (pru du 4.1) mRNA, complete cds
          Length = 924

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 170/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 337
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 526 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 467

                                                                       
Query: 338 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 397
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 466 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 407

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 406 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 347

                                           
Query: 458 tgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||| |  |||||||| ||||
Sbjct: 346 tgtcccaccaaggaataacccagttggggcaa 315

---

>gb|AF200184.1|AF200184 Lilium longiflorum profilin 1 mRNA, complete cds
          Length = 752

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                       
Query: 278 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 337
           |||||| ||||| ||||||||||| | ||||||||||||||  |||||||| || |||||
Sbjct: 438 accctgatcgacaaggtagtcgcccatcctctccacgaccatgttgcactgccctggagt 379

                                                                       
Query: 338 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 397
           ||| || || ||||||||||| | ||| || |||  ||| |||||||| ||||| |  ||
Sbjct: 378 catcggttcctcgtagataccgaaaataagagcctggcctgtcttcttaatagtcacacc 319

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
           ||| |  ||||||||||| ||||| ||| | ||||| || ||||| || ||||| |||||
Sbjct: 318 accagatcccttctttccacggataacagctccaggctctccttgaatcaccatatattt 259

---

>emb|AJ507458.1|MDO507458 Malus x domestica mRNA for apple allergen profilin (pf-2 gene),
           clone 2
          Length = 593

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcac 438
           ||||||||| |||||  ||||| | ||||||||||||||| || ||||| || |||||||
Sbjct: 289 tcttcttgacagtaacaccaccagggcccttctttcctcgaatcacaactcctggttcac 230

                                          
Query: 439 cttggatgaccatgtattttgtgcctccaag 469
           | ||||||||||||||||| || ||||||||
Sbjct: 229 cctggatgaccatgtatttggtccctccaag 199



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 300 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatc 349
           ||||||||||| || ||||  ||||| |||||||||||||| ||||||||
Sbjct: 368 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctcatc 319

---

>gb|AY081852.1| Prunus dulcis profilin (pru du 4.2) mRNA, complete cds
          Length = 742

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 157/195 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 337
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 404 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 345

                                                                       
Query: 338 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 397
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 344 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 285

                                                                       
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 457
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 284 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 225

                          
Query: 458 tgtgcctccaaggaa 472
           ||| || ||||||||
Sbjct: 224 tgtcccaccaaggaa 210

---

>emb|Y09456.1|PPPROFIL2 P.pratense mRNA for profilin 2
          Length = 396

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 136/165 (82%), Gaps = 2/165 (1%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||||||||||||||||||||| ||||  |||||||| ||||| ||||||||||| || 
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcgtca 318

                                                                       
Query: 351 tagataccaagaatcagggccatgccc-gtcttcttgatagtaatgccaccggtgccctt 409
           ||||| || |  | ||| ||| ||||| |||||||| || || ||||| || |  |||||
Sbjct: 317 tagatgccgacgaccagcgcc-tgcccggtcttctttatggtgatgcctcctgctccctt 259

                                                        
Query: 410 ctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
           ||| || ||||||||  | || |||||||| ||||||||||||||
Sbjct: 258 cttgccacggatgaccgcgccgggttcaccctggatgaccatgta 214

---

>emb|X82120.1|NTPROFLN N.tabacum mRNA for profilin
          Length = 653

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 464
           |||||||| || ||||||||| | |||||||| |||||||| |||||||||||||  || 
Sbjct: 309 cccttcttcccacggatgacagcgccaggttctccttggattaccatgtattttgccccg 250

                                                 
Query: 465 ccaaggaaaanaccagttggtgcaanatgtccgggttc 502
           |||||||| | ||||||||| || | |||||| |||||
Sbjct: 249 ccaaggaataaaccagttggagctagatgtccaggttc 212

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                           
Query: 274     agaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccag 333
               |||||||||| || || ||||| ||||||||||||||||| ||||  |||||||||||||
Sbjct: 4868241 agaaaccctgttcaacaaggtaatcgccaagcctctccacaaccatgttgcactggccag 4868300

                      
Query: 334     gagtcat 340
               |||||||
Sbjct: 4868301 gagtcat 4868307

---

>dbj|AP002743.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0710E05
          Length = 179714

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                          
Query: 274    agaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccag 333
              |||||||||| || || ||||| ||||||||||||||||| ||||  |||||||||||||
Sbjct: 112890 agaaaccctgttcaacaaggtaatcgccaagcctctccacaaccatgttgcactggccag 112949

                     
Query: 334    gagtcat 340
              |||||||
Sbjct: 112950 gagtcat 112956

---

>emb|X93465.1|NTPRO2MR N.tabacum mRNA for profilin (clone NTPRO2)
          Length = 713

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 150/188 (79%)
 Strand = Plus / Minus

                                                                       
Query: 315 accaaattgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatg 374
           |||| ||||||||| || |||||||  || || || |||||||||| |||||| |||  |
Sbjct: 415 accatattgcactgtcctggagtcactggttcctcatagataccaaaaatcagagcctgg 356

                                                                       
Query: 375 cccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggt 434
              || |||||||| || || ||||| |  |||||||| || || |||||| | ||||||
Sbjct: 355 ttagttttcttgatggttattccaccagatcccttcttcccacgaatgacagcgccaggt 296

                                                                       
Query: 435 tcaccttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaanatgt 494
           || |||||||| |||||||||||||  || |||||||| | ||||||||| || | ||||
Sbjct: 295 tctccttggattaccatgtattttgccccgccaaggaataaaccagttggagctagatgt 236

                   
Query: 495 ccgggttc 502
           || |||||
Sbjct: 235 ccaggttc 228

---

>emb|AJ132397.1|HBR132397 Hevea brasiliensis mRNA for hevea brasiliensis profilin (Hev b 8)
          Length = 396

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||||||||||||||| || || | ||  |||||||| || |||||||| |||||||||
Sbjct: 377 aggtagtcgccaagcctttcaacaatcatgttgcactgccctggagtcattggctcatcg 318

                                                                       
Query: 351 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 410
           ||||||||||  || | ||||      |||||||| | |||||  ||||| | |||||||
Sbjct: 317 tagataccaattattaaggcctgattagtcttcttaacagtaacaccaccagggcccttc 258

                                                                     
Query: 411 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaa 468
           || || || |||||| | || || || |||||||| ||||||||||||||||| ||||
Sbjct: 257 ttcccccgaatgacagctcctggctcgccttggatcaccatgtattttgtgccaccaa 200

---

>ref|NM_195688.1| Oryza sativa (japonica cultivar-group) Profilin A
           (OSJNBa0065C16.11), mRNA
          Length = 396

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 389 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 330

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 397
           |||||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 329 atgggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcactgtgatgcc 271

                                                                    
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 270 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 214

---

>ref|NM_195685.1| Oryza sativa (japonica cultivar-group) Profilin A
           (OSJNBa0065C16.14), mRNA
          Length = 396

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 389 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 330

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 397
           || ||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 329 atcggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcaccgtgatgcc 271

                                                                    
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 270 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 214

---

>emb|X77583.1|PPPROPXI P.pratense mRNA for profilin-Phl p XI
          Length = 396

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||||||||||||||||||||| ||||  |||||||| ||||| ||||||||||| || 
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcgtca 318

                
Query: 351 tagat 355
           |||||
Sbjct: 317 tagat 313

---

>gb|AF310253.1|AF310253 Oryza sativa profilin A mRNA, complete cds
          Length = 812

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 506 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 447

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 397
           || ||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 446 atcggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcaccgtgatgcc 388

                                                                    
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 387 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 331

---

>dbj|AK121412.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132P11, full
           insert sequence
          Length = 880

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 493 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 434

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 397
           |||||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 433 atgggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcactgtgatgcc 375

                                                                    
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 374 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 318

---

>dbj|AK100089.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003I11, full
           insert sequence
          Length = 830

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 486 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 427

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 397
           |||||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 426 atgggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcactgtgatgcc 368

                                                                    
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 367 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 311

---

>gb|AY792613.1| Malus x domestica clone M4-2-FS8 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 466 caag 469
           ||||
Sbjct: 450 caag 447



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 300 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctc 346
           ||||||||||| || ||||  ||||| |||||||||||||| |||||
Sbjct: 835 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctc 789

---

>gb|AY792612.1| Malus x domestica clone M4-2-PM2 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 466 caag 469
           ||||
Sbjct: 450 caag 447



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 300 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctc 346
           ||||||||||| || ||||  ||||| |||||||||||||| |||||
Sbjct: 835 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctc 789

---

>gb|AY792611.1| Malus x domestica clone M4-2-FS10 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 466 caag 469
           ||||
Sbjct: 450 caag 447



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 300 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctc 346
           ||||||||||| || ||||  ||||| |||||||||||||| |||||
Sbjct: 835 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctc 789

---

>gb|AY792610.1| Malus x domestica clone M4-2-PM7 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 862

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 466 caag 469
           ||||
Sbjct: 450 caag 447



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 300 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatc 349
           ||||||||||| || ||||  ||||| |||||||||||||| ||||||||
Sbjct: 834 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctcatc 785

---

>emb|AJ491882.1|PPE491882 Prunus persica mRNA for profilin, allergen Pru p 4.02
          Length = 396

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcac 438
           ||||||||| |||||  ||||| |  |||||||||||||  |||||| | || || || |
Sbjct: 289 tcttcttgacagtaacaccacctggtcccttctttcctctaatgacagctcctggctctc 230

                                          
Query: 439 cttggatgaccatgtattttgtgcctccaag 469
           |||||||||||||||| ||||||||||||||
Sbjct: 229 cttggatgaccatgtactttgtgcctccaag 199



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 273 tagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcca 332
           |||| ||||||||| ||||| || || |||||||| || || | ||  ||||| ||||||
Sbjct: 395 tagagaccctgctcaaccagataatcaccaagcctttcaacaatcatgttgcattggcca 336

                            
Query: 333 ggagtcatgggctcatc 349
           |||||||| ||||||||
Sbjct: 335 ggagtcattggctcatc 319

---

>emb|AJ130969.1|NTA130969 Nicotiana tabacum pronp1 gene, exons 1-3
          Length = 3797

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 406  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
            ||||||| || ||||||||| | |||||||| |||||||| ||||||||||| |  || |
Sbjct: 1775 ccttcttcccacggatgacagcgccaggttctccttggattaccatgtatttcgccccgc 1716

                                                 
Query: 466  caaggaaaanaccagttggtgcaanatgtccgggttc 502
            ||||||| | ||||||||| || | |||||| |||||
Sbjct: 1715 caaggaataaaccagttggagctagatgtccaggttc 1679

---

>gb|DQ400579.1| Mangifera indica profilin 2 mRNA, complete cds
          Length = 660

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 321 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 380
           |||||||| ||||||||||| |||||||| ||||||||||  |  | ||||||||  |||
Sbjct: 347 ttgcactgtccaggagtcattggctcatcatagataccaatgacaaaggccatgctggtc 288

                                                                       
Query: 381 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 440
           || |||| |||||  ||||| |  |||||||||||||| |||||| | || || || |||
Sbjct: 287 tttttgacagtaacaccaccaggtcccttctttcctcgaatgacagctcctggctcccct 228

                      
Query: 441 tggatgaccat 451
           ||||| |||||
Sbjct: 227 tggatcaccat 217

---

>gb|AF377948.1|AF377948 Musa acuminata profilin mRNA, complete cds
          Length = 396

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 294 tagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcat 348
           |||||||||||||||||||| |||| |||||| || ||||| |||||||||||||
Sbjct: 374 tagtcgccaagcctctccactaccatattgcattgaccaggcgtcatgggctcat 320

---

>gb|AY082337.1| Chenopodium album pollen allergen Che a 2 mRNA, complete cds
          Length = 396

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 285 tcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggc 344
           |||||||||||||| |||| ||| || || |||| ||||||||| |||||||||||||||
Sbjct: 383 tcgaccaggtagtcaccaatcctttcaacaaccatattgcactgaccaggagtcatgggc 324

              
Query: 345 tca 347
           |||
Sbjct: 323 tca 321



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 404 gcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 463
           |||||||||||||| ||| ||  | ||||| || |||||||| ||||| |||||||||||
Sbjct: 264 gcccttctttcctctgatcacgtctccaggctcgccttggataaccatatattttgtgcc 205

                  
Query: 464 tccaagg 470
            ||||||
Sbjct: 204 accaagg 198

---

>gb|U50195.1|SLU50195 Solanum lycopersicum profilin (LePro1) mRNA, complete cds
          Length = 610

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 437
           |||||||| ||||| || ||||| |  ||||| || || ||||| ||| | |||||||| 
Sbjct: 296 gtcttcttaatagttattccaccaggaccctttttcccgcggataacagcaccaggttct 237

                                                                       
Query: 438 ccttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaanatgtccg 497
           ||||| ||||||||||||||||| ||  ||||||| | ||||||||| || | |||||| 
Sbjct: 236 ccttgaatgaccatgtattttgtacccgcaaggaatagaccagttggagctagatgtcca 177

                
Query: 498 ggttc 502
           |||||
Sbjct: 176 ggttc 172

---

>emb|X73281.1|ZMPRO3MR Z.mays ZmPRO3 mRNA for profilin 3
          Length = 777

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 138/173 (79%)
 Strand = Plus / Minus

                                                                       
Query: 282 tgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatg 341
           ||||| || |||||||| || |||||||| || ||||  |||||||| ||||| ||||||
Sbjct: 509 tgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgtccaggggtcatg 450

                                                                       
Query: 342 ggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccg 401
           ||||| |||||||| || |  | ||| |||   || |||||||| | ||| ||||| || 
Sbjct: 449 ggctcgtcgtagatgccgatcaccagcgcctgtccggtcttcttcacagttatgcctcca 390

                                                                
Query: 402 gtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
           |  |||||||| || ||||||||| | || || || |||||||||||||||||
Sbjct: 389 gatcccttcttcccgcggatgacagcgccgggctcgccttggatgaccatgta 337

---

>dbj|AK070595.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023058I07, full
           insert sequence
          Length = 880

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 143/177 (80%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 506 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 447

                                                                       
Query: 339 atgggctcatcgtagataccaagaatcagggccatgccc-gtcttcttgatagtaatgcc 397
           || ||||| |||||||| || |  | ||| ||| ||||| |||||||| |  || |||||
Sbjct: 446 atcggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcaccgtgatgcc 388

                                                                    
Query: 398 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
            || |  |||||||| || || |||||| | |||||||||||| |||||||||||||
Sbjct: 387 tcctgatcccttcttgccacgaatgacagcgccaggttcacctcggatgaccatgta 331

---

>gb|AF126263.1|AF126263 Phalaenopsis sp. 'KCbutterfly' putative profilin mRNA, complete cds
          Length = 718

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 381 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 440
           ||||||||||||||||| || |  |||||||| ||||| || ||| ||||||||||||||
Sbjct: 429 ttcttgatagtaatgcctccagaacccttcttccctcgaataacagccccaggttcacct 370

                            
Query: 441 tggatgaccatgtattt 457
           || || ||||| |||||
Sbjct: 369 tgtataaccatatattt 353

---

>gb|AY898658.1| Crocus sativus profilin mRNA, complete cds
          Length = 396

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           ||||| ||||| |||||||| || ||||| |||||||||||||| ||||| || ||||| 
Sbjct: 377 aggtaatcgccgagcctctcaacaaccaagttgcactggccaggggtcatcggttcatca 318

                                                                       
Query: 351 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 410
           ||||  ||||  ||||  ||||||    | |||||||||||||  ||||| |  ||||||
Sbjct: 317 tagagcccaaagatcaaagccatgttacttttcttgatagtaacaccaccagaacccttc 258

                                                            
Query: 411 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
           || ||||| || ||||| || || || |||||||| |||||||| ||||
Sbjct: 257 ttccctcgaataacaacacctggctcgccttggataaccatgtactttg 209

---

>gb|M65179.1|BELPRFLN B.verrucosa profilin (BetvII) mRNA, complete cds
          Length = 660

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 437
           |||||||| |||||||| || || |  ||||||||||| ||||||||| | ||||  || 
Sbjct: 375 gtcttctttatagtaatacctccagatcccttctttccacggatgacagcaccagcctct 316

                                            
Query: 438 ccttggatgaccatgtattttgtgcctccaagg 470
           || |||||||||||||||||| |||| ||||||
Sbjct: 315 ccctggatgaccatgtattttatgcccccaagg 283

---

>gb|AY792617.1| Malus x domestica clone M4-5-FS4 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1033

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 272  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1033 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 974

                                                                        
Query: 332  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 973  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 914

               
Query: 392  aat 394
            |||
Sbjct: 913  aat 911



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 651 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 592

                                   
Query: 466 caaggaaaanaccagttggtgcaa 489
           ||||||| |  |||||||| ||||
Sbjct: 591 caaggaataatccagttggggcaa 568

---

>gb|AY792616.1| Malus x domestica clone M4-5-FS5 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1032

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 272  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1032 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 973

                                                                        
Query: 332  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 972  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 913

               
Query: 392  aat 394
            |||
Sbjct: 912  aat 910



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 650 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 591

                                   
Query: 466 caaggaaaanaccagttggtgcaa 489
           ||||||| |  |||||||| ||||
Sbjct: 590 caaggaataatccagttggggcaa 567

---

>gb|AY792615.1| Malus x domestica clone M4-5-PM2 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1032

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 272  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1032 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 973

                                                                        
Query: 332  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 972  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 913

               
Query: 392  aat 394
            |||
Sbjct: 912  aat 910



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 650 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 591

                                   
Query: 466 caaggaaaanaccagttggtgcaa 489
           ||||||| |  |||||||| ||||
Sbjct: 590 caaggaataatccagttggggcaa 567

---

>gb|AY792614.1| Malus x domestica clone M4-5-PM7 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1030

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 272  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1030 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 971

                                                                        
Query: 332  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 391
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 970  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 911

               
Query: 392  aat 394
            |||
Sbjct: 910  aat 908



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 406 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 465
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 648 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 589

                              
Query: 466 caaggaaaanaccagttgg 484
           ||||||| |  ||||||||
Sbjct: 588 caaggaataatccagttgg 570

---

>emb|X73280.1|ZMPRO2MR Z.mays ZmPRO2 mRNA for profilin 2
          Length = 830

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 290 caggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatc 349
           |||||||||||| ||||| ||||| ||||  |||||||| ||||| ||||| ||||| ||
Sbjct: 470 caggtagtcgcccagcctttccaccaccatgttgcactgcccaggcgtcatcggctcgtc 411

                      
Query: 350 gtagataccaa 360
           |||||| ||||
Sbjct: 410 gtagatgccaa 400

---

>gb|DQ270547.1| Mangifera indica profilin 1 (Man i 3.01) mRNA, complete cds
          Length = 656

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 321 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 380
           |||||||| ||||||||||| |||||||| ||||||||||  |  | |||||||   |||
Sbjct: 347 ttgcactgtccaggagtcattggctcatcatagataccaatgacaaaggccatgttggtc 288

                                                                       
Query: 381 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 440
           || |||| |||||  ||||| |  ||||||||||| || || ||| | ||||| ||||| 
Sbjct: 287 tttttgacagtaacaccaccaggacccttctttccacgaatcacagctccaggctcaccc 228

                                  
Query: 441 tggatgaccatgtattttgtgcc 463
           ||||| |||||||| || |||||
Sbjct: 227 tggattaccatgtacttagtgcc 205

---

>gb|AF092547.1|AF092547 Ricinus communis profilin (pro1) mRNA, complete cds
          Length = 737

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 321 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 380
           |||||||| || |||||||| |||||||| ||||||||||  |||| ||||      |||
Sbjct: 424 ttgcactgccctggagtcattggctcatcatagataccaatgatcaaggcctgattggtc 365

                                                                       
Query: 381 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 440
           ||||| | |||||  ||||| |  |||||||| ||||| |||||| | || || || |||
Sbjct: 364 ttcttaacagtaacaccacccggtcccttcttccctcgaatgacagctcctggctcgcct 305

                                  
Query: 441 tggatgaccatgtattttgtgcc 463
           ||||||||||||||||| |||||
Sbjct: 304 tggatgaccatgtatttagtgcc 282

---

>gb|AY268424.1| Humulus scandens profilin-like protein (LCM9) mRNA, complete cds
          Length = 633

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                       
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 464
           ||||||||||||| ||| ||| | || ||||| |||||||| ||||| ||||||||||| 
Sbjct: 263 cccttctttcctctgataacagcacctggttccccttggatcaccatatattttgtgcca 204

                                    
Query: 465 ccaaggaaaanaccagttggtgcaa 489
           |||||  | |  |||||||||||||
Sbjct: 203 ccaagatacaagccagttggtgcaa 179

---

>emb|AJ417566.1|PDA417566 Phoenix dactylifera mRNA for profilin (pro gene)
          Length = 396

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 291 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 350
           |||||||| || | |||||| || ||||  ||||||||||| |||||||||||||| |||
Sbjct: 377 aggtagtcacccaacctctcaacaaccatgttgcactggcctggagtcatgggctcttcg 318

                     
Query: 351 tagataccaa 360
           ||||| ||||
Sbjct: 317 tagatgccaa 308



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgt 460
           ||||||||||| ||||| ||| | |||||||| |||||||| ||||| ||||||||
Sbjct: 263 cccttctttccacggataacagctccaggttctccttggataaccatatattttgt 208

---

>emb|Y12425.1|OEPROFIL1 Olea europaea mRNA for profilin 1
          Length = 405

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 146/185 (78%)
 Strand = Plus / Minus

                                                                       
Query: 285 tcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggc 344
           |||||||||||||| || | |||||| || ||||  ||||| || || ||||| |  |||
Sbjct: 392 tcgaccaggtagtctcccaacctctcgacaaccatgttgcattgtcctggagttacaggc 333

                                                                       
Query: 345 tcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtg 404
           || ||||||||||||| ||  || ||   ||| |||||||| || ||||| ||||| |  
Sbjct: 332 tcctcgtagataccaaaaactagtgcttggccagtcttcttaatggtaataccaccagat 273

                                                                       
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 464
           ||||||||||| ||||||||| | ||||  || ||||| || ||||| || ||||| |||
Sbjct: 272 cccttctttccacggatgacagctccagcctctccttgaatcaccatatactttgttcct 213

                
Query: 465 ccaag 469
           |||||
Sbjct: 212 ccaag 208

---

>gb|AC074354.8|AC074354 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0065C16, from Chromosome 10, complete sequence
          Length = 146391

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 406   ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
             ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 68751 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 68799



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                         
Query: 279   ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
             |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 68500 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 68559

                              
Query: 339   atgggctcatcgtagat 355
             || ||||| ||||||||
Sbjct: 68560 atcggctcgtcgtagat 68576



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 279   ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
             |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 59549 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 59490

                              
Query: 339   atgggctcatcgtagat 355
             |||||||| ||||||||
Sbjct: 59489 atgggctcgtcgtagat 59473



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 406   ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
             ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 59289 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 59241

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 406     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8461501 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8461549



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                           
Query: 279     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
               |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 8461241 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 8461300

                                
Query: 339     atgggctcatcgtagat 355
               |||||||| ||||||||
Sbjct: 8461301 atgggctcgtcgtagat 8461317



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 279     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
               |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 8452290 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 8452231

                                
Query: 339     atgggctcatcgtagat 355
               || ||||| ||||||||
Sbjct: 8452230 atcggctcgtcgtagat 8452214



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                
Query: 406     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8452039 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8451991

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 406     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8466600 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8466648



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                           
Query: 279     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
               |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 8466340 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 8466399

                                
Query: 339     atgggctcatcgtagat 355
               |||||||| ||||||||
Sbjct: 8466400 atgggctcgtcgtagat 8466416



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 279     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
               |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 8457389 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 8457330

                                
Query: 339     atgggctcatcgtagat 355
               || ||||| ||||||||
Sbjct: 8457329 atcggctcgtcgtagat 8457313



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                
Query: 406     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8457138 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8457090

---

>emb|X81982.1|PVPROFILN P.vulgaris mRNA for profilin
          Length = 759

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 464
           |||||||| ||||| ||||||   || |||||||||||||||||||| ||||| ||||| 
Sbjct: 313 cccttcttgcctcgaatgacagagccgggttcaccttggatgaccatatatttagtgcca 254

               
Query: 465 ccaa 468
           ||||
Sbjct: 253 ccaa 250

---

>emb|AJ421030.1|AVU421030 Artemisia vulgaris mRNA for profilin, isoallergen 1
          Length = 676

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 464
           ||||||||||| || |||||| | ||||  ||||||||||| |||||||||||||  || 
Sbjct: 301 cccttctttccacgaatgacagctccagcctcaccttggataaccatgtattttgcacca 242

                   
Query: 465 ccaaggaa 472
           ||||||||
Sbjct: 241 ccaaggaa 234

---

>gb|AY292385.2| Cucumis melo var. reticulatus profilin (Cu m2) mRNA, complete cds
          Length = 634

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 134/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           |||||| ||||| |||||||| || |||| | | | ||||||||| ||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaa 179

---

>gb|AY292386.3| Cucumis melo var. reticulatus cultivar Mashadi profilin (Cuc m2)
           mRNA, complete cds; alternatively polyadenylated 2
          Length = 655

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 134/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           |||||| ||||| |||||||| || |||| | | | ||||||||| ||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaa 179

---

>gb|AY292387.3| Cucumis melo var. reticulatus cultivar Mashadi profilin (Cuc m2)
           mRNA, complete cds; alternatively polyadenylated 3
          Length = 779

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 134/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           |||||| ||||| |||||||| || |||| | | | ||||||||| ||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaa 179

---

>gb|AY271295.2| Cucumis melo var. reticulatus profilin (Cuc m2) mRNA, complete cds
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 134/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           |||||| ||||| |||||||| || |||| | | | ||||||||| ||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaa 179

---

>emb|AJ223982.1|GMPRO1 Glycine max mRNA for profilin, PRO1
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 463
           |||||||| ||||| |||||| | || |||||||| ||||||||||| ||||| |||||
Sbjct: 263 cccttcttccctcgaatgacagcaccgggttcaccctggatgaccatatatttggtgcc 205

---

>emb|AJ223981.1|GMPRO2 Glycine max mRNA for profilin, PRO2
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 463
           |||||||| ||||| |||||| | || |||||||| ||||||||||| ||||| |||||
Sbjct: 263 cccttcttccctcgaatgacagcaccgggttcaccctggatgaccatatatttggtgcc 205

---

>gb|AF119367.1|AF119367 Hevea brasiliensis clone hevb 8.10 latex profilin Hev b 8 mRNA,
           complete cds
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 132/167 (79%)
 Strand = Plus / Minus

                                                                       
Query: 303 agcctctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaaga 362
           |||||||| |||| ||  |||||||| || |||||||  || |||||||| ||||||| |
Sbjct: 365 agcctctctacgatcatgttgcactgtcctggagtcaatggttcatcgtaaataccaata 306

                                                                       
Query: 363 atcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatg 422
           || || ||   ||| || ||||| | |||||||||||| |  ||||||||||| || || 
Sbjct: 305 atgagagcttggccggttttcttcacagtaatgccaccagaacccttctttccacgaatc 246

                                                          
Query: 423 acaaccccaggttcaccttggatgaccatgtattttgtgcctccaag 469
           ||| | || || || || ||||| |||||||| |||||||| |||||
Sbjct: 245 acagctccgggctctccctggatcaccatgtactttgtgccaccaag 199

---

>gb|AY109853.1| Zea mays CL2096_2 mRNA sequence
          Length = 821

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 tgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatg 341
           ||||| || ||||||||||| |||||||| || ||||  ||||||||||| |   |||||
Sbjct: 478 tgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactggccggtcntcatg 419

                         
Query: 342 ggctcatcgtagat 355
           ||||| ||||||||
Sbjct: 418 ggctcgtcgtagat 405



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 454
           |||||||| || ||||||||| | || || || |||||||||||||||||
Sbjct: 355 cccttcttcccgcggatgacagcgccgggctcgccttggatgaccatgta 306

---

>ref|NM_125043.2| Arabidopsis thaliana PRF3 (PROFILIN 3); actin binding AT5G56600
           (PRF3) mRNA, complete cds
          Length = 701

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 307 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 360
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 472 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 419

---

>ref|NM_127534.2| Arabidopsis thaliana PRF1 (PROFILIN 1); actin binding AT2G19760
           (PRF1) mRNA, complete cds
          Length = 783

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 363 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 310

---

>gb|AY730591.1| Citrullus lanatus profilin mRNA, partial cds
          Length = 393

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 279 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 338
           ||||||||||  ||||| || |||||||| || || | || ||||||||| |||||||||
Sbjct: 389 ccctgctcgataaggtaatccccaagcctttcaacaatcatattgcactgaccaggagtc 330

                                 
Query: 339 atgggctcatcgtagataccaa 360
           || || ||||| ||||| ||||
Sbjct: 329 attggttcatcatagatgccaa 308

---

>gb|BT000885.1| Arabidopsis thaliana clone C105361 putative profilin protein
           (At5g56600) mRNA, complete cds
          Length = 538

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 307 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 360
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 472 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 419

---

>gb|AY034989.1| Arabidopsis thaliana putative profilin protein (At5g56600) mRNA,
           partial cds
          Length = 675

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 307 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 360
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 463 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 410

---

>gb|BT000264.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA, complete cds
          Length = 527

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 263 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 210

---

>gb|AY072427.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA, complete cds
          Length = 717

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 347 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 294

---

>gb|U43592.1|U43592 Arabidopsis thaliana profilin (PRF3) mRNA, complete cds
          Length = 584

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 307 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 360
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 402 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 349

---

>gb|U43590.1|U43590 Arabidopsis thaliana profilin (PRF1) mRNA, complete cds
          Length = 710

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 339 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 286

---

>emb|BX818797.1|CNS0A9XS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB14ZC01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 670

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 329 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 276

---

>emb|BX833469.1|CNS0A0EA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL57ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 633

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 307 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 360
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 445 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 392

---

>gb|AY084285.1| Arabidopsis thaliana clone 102364 mRNA, complete sequence
          Length = 686

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 307 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 360
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 457 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 404

---

>dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK19
          Length = 84129

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 307  tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 360
            ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 8122 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 8175

---

>gb|AF200186.1|AF200186 Lilium longiflorum profilin 3 mRNA, complete cds
          Length = 700

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 303 agcctctccacgaccaaattgcactggccaggagtcatgggctcatcgta 352
           ||||||||||| ||||  |||||||| ||||||||||| ||||| |||||
Sbjct: 402 agcctctccacaaccatgttgcactgaccaggagtcattggctcgtcgta 353

---

>gb|U43325.1|ATU43325 Arabidopsis thaliana profilin 1 mRNA, complete cds
          Length = 800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 363 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 310

---

>gb|AY726606.1| Arachis hypogaea profilin (PROF) mRNA, complete cds
          Length = 604

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 378 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 437
           |||||||| |||||||  ||||| |  ||||| |||| | |||||||| | || || |||
Sbjct: 395 gtcttcttaatagtaacaccaccaggacccttntttcnttggatgacagctccgggctca 336

                                  
Query: 438 ccttggatgaccatgtattttgt 460
           |||||||| ||||| ||||||||
Sbjct: 335 ccttggattaccatatattttgt 313

---

>gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map mi148, complete
              sequence
          Length = 126386

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                   
Query: 406    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
              ||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 106095 ccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 106043

---

>gb|AY268426.1| Ambrosia artemisiifolia profilin-like protein (D106) mRNA, complete
           cds
          Length = 632

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 272 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
           |||||||||||| ||||  || ||||| ||| ||||||| || | ||  ||||| || ||
Sbjct: 396 ttagaaaccctgttcgaggagatagtcaccaggcctctcaacaagcatgttgcattgtcc 337

                                        
Query: 332 aggagtcatgggctcatcgtagataccaa 360
            ||||||||||| ||||| ||||||||||
Sbjct: 336 tggagtcatgggttcatcatagataccaa 308

---

>gb|U43593.1|U43593 Arabidopsis thaliana profilin (PRF1) gene, complete cds
          Length = 1833

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 406  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
            ||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 1328 ccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 1276

---

>gb|U43322.1|ATU43322 Arabidopsis thaliana profilin 1 gene, complete cds
          Length = 3113

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 406  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 458
            ||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 2449 ccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 2397

---

>emb|Y12430.1|OEPROFIL3 Olea europaea mRNA for profilin 3
          Length = 405

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 342 ggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccg 401
           ||||| ||||||||||||| ||  || ||   ||| |||||||| || ||||| ||||| 
Sbjct: 335 ggctcctcgtagataccaaaaactagtgcttggccagtcttcttaatggtaataccacca 276

                                                                       
Query: 402 gtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtg 461
           |  ||||||||||| ||||||||| | ||||  || ||||| || ||||| || ||||| 
Sbjct: 275 gatcccttctttccacggatgacagctccagcctctccttgaatcaccatatactttgtt 216

                   
Query: 462 cctccaag 469
           ||||||||
Sbjct: 215 cctccaag 208

---

>gb|AF059616.1|AF059616 Arachis hypogaea profilin (Ara h 5) mRNA, complete cds
          Length = 743

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 432 ggttcaccttggatgaccatgtattttgtgcc 463
           |||||||||||||| ||||||||||| |||||
Sbjct: 252 ggttcaccttggataaccatgtatttggtgcc 221

---

>ref|NM_119080.2| Arabidopsis thaliana PRF2 (PROFILIN 2); actin binding AT4G29350
           (PRF2) mRNA, complete cds
          Length = 760

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 291 aggtagtcgccaagcctctccacgaccaaattgca 325
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 483 aggtaatcgccgagcctctccacgaccaagttgca 449

---

>ref|NM_119079.3| Arabidopsis thaliana PRF4; actin binding AT4G29340 (PRF4) mRNA,
           complete cds
          Length = 707

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 343 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 289

---

>gb|DQ228336.1| Solanum tuberosum clone 145G03 profilin-like protein mRNA, complete
           cds
          Length = 645

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           ||||||||| ||||||||||| |||||||| || || ||||  ||||  |||  |   ||
Sbjct: 383 attgcactgtccaggagtcatcggctcatcatatattccaatgatcaaagcctggttggt 324

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| || || || ||||| |  |||||||| |||||||| ||| | || || || ||
Sbjct: 323 cttcttaatggtgataccacctggacccttcttccctcggatcacagctcctggctctcc 264

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||||||||| || |||||  | | ||||||||| ||||
Sbjct: 263 ttgaatcaccatgtattttgttcccccaagatacaaaccagttggagcaa 214

---

>gb|DQ207877.1| Solanum tuberosum clone 092D10 profilin-like mRNA, complete cds
          Length = 750

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           ||||||||| ||||||||||| |||||||| || || ||||  ||||  |||  |   ||
Sbjct: 485 attgcactgtccaggagtcatcggctcatcatatattccaatgatcaaagcctggttggt 426

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| || || || ||||| |  |||||||| |||||||| ||| | || || || ||
Sbjct: 425 cttcttaatggtgataccacctggacccttcttccctcggatcacagctcctggctctcc 366

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||||||||| || |||||  | | ||||||||| ||||
Sbjct: 365 ttgaatcaccatgtattttgttcccccaagatacaaaccagttggagcaa 316

---

>gb|AY496123.1| Capsicum annuum profilin mRNA, complete cds
          Length = 647

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           ||||||||| ||||||||||| |||||||| || || ||||  ||||  |||  |   ||
Sbjct: 379 attgcactgcccaggagtcattggctcatcatatattccaatgatcaaagcctggttggt 320

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| || || || ||||| |  |||||||| |||||||| || || || || || ||
Sbjct: 319 cttcttaatggtgataccacctggacccttcttccctcggatcaccactcctggctctcc 260

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           ||| || |||||||||||||| || |||||  | | ||||||||| ||||
Sbjct: 259 ttgaatcaccatgtattttgttcccccaagatacaaaccagttggagcaa 210

---

>gb|AY114048.1| Arabidopsis thaliana putative profilin 2 protein (At4g29350) mRNA,
           complete cds
          Length = 427

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 291 aggtagtcgccaagcctctccacgaccaaattgca 325
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 377 aggtaatcgccgagcctctccacgaccaagttgca 343

---

>gb|AY074350.1| Arabidopsis thaliana putative profilin 2 protein (At4g29350) mRNA,
           complete cds
          Length = 759

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 291 aggtagtcgccaagcctctccacgaccaaattgca 325
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 470 aggtaatcgccgagcctctccacgaccaagttgca 436

---

>emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 70
          Length = 198429

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 291    aggtagtcgccaagcctctccacgaccaaattgca 325
              ||||| ||||| ||||||||||||||||| |||||
Sbjct: 179180 aggtaatcgccgagcctctccacgaccaagttgca 179146



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                    
Query: 406    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
              ||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 176328 ccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 176275

---

>gb|BT024816.1| Arabidopsis thaliana At4g29340 gene, complete cds
          Length = 405

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 272 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 218

---

>gb|AY894660.1| Ambrosia artemisiifolia profilin isoallergen 1 mRNA, complete cds
          Length = 791

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
           ||||||||||| || || ||| | ||||| ||||||||||| |||||||| ||||
Sbjct: 275 cccttctttccacgaataacagctccaggctcaccttggattaccatgtactttg 221

---

>gb|BT003946.1| Arabidopsis thaliana clone RAFL15-14-D07 (R20752) putative profilin
           3 (At4g29340) mRNA, complete cds
          Length = 723

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 343 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 289

---

>gb|AY086576.1| Arabidopsis thaliana clone 25886 mRNA, complete sequence
          Length = 754

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 291 aggtagtcgccaagcctctccacgaccaaattgca 325
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 483 aggtaatcgccgagcctctccacgaccaagttgca 449

---

>gb|AY085179.1| Arabidopsis thaliana clone 13601 mRNA, complete sequence
          Length = 705

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 341 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 287

---

>gb|AY900016.1| Petroselinum crispum profilin 5 (PRF5) mRNA, complete cds
          Length = 764

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 463
           |||||||||||||| |||||| |   |||||||||||| || ||||| || ||||||||
Sbjct: 447 cccttctttcctcgtatgacagcattaggttcaccttgaatcaccatatactttgtgcc 389

---

>gb|AY879597.1| Cucumis melo profilin (m2) mRNA, complete cds and 3' UTR
          Length = 576

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 133/170 (78%)
 Strand = Plus / Minus

                                                                       
Query: 320 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 379
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 380 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 439
           |||||| | ||||   ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtagccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                             
Query: 440 ttggatgaccatgtattttgtgcctccaaggaaaanaccagttggtgcaa 489
           |||||| ||||| |||||||| || |||| | | | ||||||||| ||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaa 179

---

>gb|U43326.1|ATU43326 Arabidopsis thaliana profilin 2 mRNA, complete cds
          Length = 712

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 291 aggtagtcgccaagcctctccacgaccaaattgca 325
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 420 aggtaatcgccgagcctctccacgaccaagttgca 386

---

>gb|U43323.1|ATU43323 Arabidopsis thaliana profilin 2 and profilin 3 genes, complete cds
          Length = 5329

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 291  aggtagtcgccaagcctctccacgaccaaattgca 325
            ||||| ||||| ||||||||||||||||| |||||
Sbjct: 4995 aggtaatcgccgagcctctccacgaccaagttgca 4961



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 406  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
            ||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 2142 ccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 2089

---

>gb|AY268425.1| Ambrosia artemisiifolia profilin-like protein (A0418) mRNA,
           complete cds
          Length = 645

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 82/102 (80%)
 Strand = Plus / Minus

                                                                       
Query: 272 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 331
           |||||||||||| ||||  || ||||| |||||||| || || | ||  ||||| |||||
Sbjct: 396 ttagaaaccctgttcgaggagatagtcaccaagcctttcaacaatcatgttgcattggcc 337

                                                     
Query: 332 aggagtcatgggctcatcgtagataccaagaatcagggccat 373
            |||| ||| |||||||| ||||| ||||  |||| ||||||
Sbjct: 336 tggagccattggctcatcatagattccaatgatcaaggccat 295

---

>gb|AY499654.1| Capsicum annuum profilin mRNA, partial cds
          Length = 329

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 320 attgcactggccaggagtcatgggctcatc 349
           ||||||||| ||||||||||| ||||||||
Sbjct: 118 attgcactgcccaggagtcattggctcatc 89

---

>gb|AC101882.14| Mus musculus chromosome 10, clone RP23-394M6, complete sequence
          Length = 209838

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 365  cagggccatgcccgtcttcttg 386
            ||||||||||||||||||||||
Sbjct: 3385 cagggccatgcccgtcttcttg 3364

---

>emb|Y15042.1|HBY15042 Hevea brasiliensis mRNA for profilin
          Length = 396

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 438 ccttggatgaccatgtattttgtgcc 463
           |||||||| |||||||||||||||||
Sbjct: 230 ccttggatcaccatgtattttgtgcc 205

---

>emb|AJ417553.1|LES417553 Lycopersicon esculentum mRNA for profilin, allergen Lyc e 1
          Length = 581

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 320 attgcactggccaggagtcatgggctcatc 349
           ||||||||| ||||||||||| ||||||||
Sbjct: 348 attgcactgtccaggagtcatcggctcatc 319

---

>gb|AF327623.1|AF327623 Corylus avellana clone 7 minor allergen hazelnut profilin mRNA,
           complete cds
          Length = 396

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 118/150 (78%)
 Strand = Plus / Minus

                                                                       
Query: 321 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 380
           |||||||| ||||||||||| || ||||| || |||||||  |||| ||||   |  || 
Sbjct: 347 ttgcactgcccaggagtcattggttcatcatatataccaatgatcaaggcctgactagtt 288

                                                                       
Query: 381 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 440
           || ||||  ||||  ||||| | ||||||||| ||||| || ||| | || || || |||
Sbjct: 287 tttttgacggtaacaccaccagggcccttcttccctcgaataacagctcccggctcgcct 228

                                         
Query: 441 tggatgaccatgtattttgtgcctccaagg 470
           ||||| |||||||| |||||||| ||||||
Sbjct: 227 tggatcaccatgtactttgtgccaccaagg 198

---

>gb|AF327622.1|AF327622 Corylus avellana clone 6 minor allergen hazelnut profilin mRNA,
           complete cds
          Length = 396

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 118/150 (78%)
 Strand = Plus / Minus

                                                                       
Query: 321 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 380
           |||||||| ||||||||||| || ||||| || |||||||  |||| ||||   |  |||
Sbjct: 347 ttgcactgcccaggagtcattggttcatcatatataccaatgatcaaggcctgactagtc 288

                                                                       
Query: 381 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 440
           || ||||  ||||  ||||| | ||||||||| | ||| || ||| | || || || |||
Sbjct: 287 tttttgacggtaacaccaccagggcccttcttccttcgaataacagctcccggctcgcct 228

                                         
Query: 441 tggatgaccatgtattttgtgcctccaagg 470
           ||||| |||||||| |||||||| ||||||
Sbjct: 227 tggatcaccatgtactttgtgccaccaagg 198

---

>gb|U43594.1|U43594 Arabidopsis thaliana profilin (PRF4) gene, complete cds
          Length = 1792

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 406  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 459
            ||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 1284 ccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 1231

---

>gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 219072

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 365   cagggccatgcccgtcttcttg 386
             ||||||||||||||||||||||
Sbjct: 78872 cagggccatgcccgtcttcttg 78893

---

>gb|AF119366.1|AF119366 Hevea brasiliensis clone hevb 8.8 latex profilin Hev b 8 mRNA,
           complete cds
          Length = 396

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgc 462
           ||||||||||| || || ||| ||||||| || || ||||| |||||||| |||||||
Sbjct: 263 cccttctttccacgaatcacagccccaggctctccctggatcaccatgtactttgtgc 206

---

>gb|DQ335252.1| Cinnamomum camphora profilin-like protein (Cin c 1) mRNA, complete
           cds
          Length = 697

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 321 ttgcactggccaggagtcatgggctcatcgtagatacc 358
           ||||||||||| || |||| ||||||||| ||||||||
Sbjct: 347 ttgcactggcctggggtcaagggctcatcatagatacc 310

---

>gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, complete sequence
          Length = 214694

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 207    gatgcaaagcccacaggagca 227
              |||||||||||||||||||||
Sbjct: 118838 gatgcaaagcccacaggagca 118858

---

>dbj|AK133754.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:5730406J02 product:pericentriolar
            material 1, full insert sequence
          Length = 2634

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 207  gatgcaaagcccacaggagca 227
            |||||||||||||||||||||
Sbjct: 1720 gatgcaaagcccacaggagca 1700

---

>gb|AC158222.6| Mus musculus chromosome 8, clone RP23-117M15, complete sequence
          Length = 207233

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 207  gatgcaaagcccacaggagca 227
            |||||||||||||||||||||
Sbjct: 8815 gatgcaaagcccacaggagca 8795

---

>gb|AF352180.1|AF352180 Mus musculus pericentriolar material gene 1 protein (Pcm1) mRNA,
            alternatively spliced, partial cds
          Length = 6010

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 207  gatgcaaagcccacaggagca 227
            |||||||||||||||||||||
Sbjct: 1368 gatgcaaagcccacaggagca 1348

---

>ref|NM_023662.1| Mus musculus pericentriolar material 1 (Pcm1), mRNA
          Length = 6674

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 207  gatgcaaagcccacaggagca 227
            |||||||||||||||||||||
Sbjct: 1585 gatgcaaagcccacaggagca 1565

---

>dbj|AB029291.1| Mus musculus pcm-1 mRNA for pericentriolar material-1, complete cds
          Length = 6674

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 207  gatgcaaagcccacaggagca 227
            |||||||||||||||||||||
Sbjct: 1585 gatgcaaagcccacaggagca 1565

---

>ref|XM_422236.1| PREDICTED: Gallus gallus similar to KIAA1096 protein (LOC424393),
            mRNA
          Length = 11679

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tagattattcactgcatata 183
            ||||||||||||||||||||
Sbjct: 8979 tagattattcactgcatata 8960

---

>gb|AC154768.2| Mus musculus BAC clone RP24-444E21 from chromosome 14, complete
             sequence
          Length = 135417

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   agggtgggcttagaaaccct 282
             ||||||||||||||||||||
Sbjct: 11386 agggtgggcttagaaaccct 11367

---

>gb|AC123957.4| Mus musculus BAC clone RP23-302N2 from 12, complete sequence
          Length = 206661

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   ggatgaccatgtattttgtg 461
             ||||||||||||||||||||
Sbjct: 69836 ggatgaccatgtattttgtg 69855

---

>emb|Y13271.1|MAPROFILN Mercurialis annua mRNA for profilin
          Length = 402

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 405 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 464
           ||||||||||| ||||| ||| | |||  ||| || ||||| ||||| ||||||||||||
Sbjct: 269 cccttctttccacggattacagcgccactttcgccctggataaccatatattttgtgcct 210

---

>emb|Y12429.1|OEPROFIL2 Olea europaea mRNA for profilin 2
          Length = 405

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 101/128 (78%)
 Strand = Plus / Minus

                                                                       
Query: 342 ggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccg 401
           ||||| ||||||||||||| ||  || ||   ||| |||||||| || ||||| ||||| 
Sbjct: 335 ggctcctcgtagataccaaaaactagtgcttggccagtcttcttaatggtaataccacca 276

                                                                       
Query: 402 gtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtg 461
           |  ||||||||||| ||||||||  | ||||  || ||||| || ||||| || ||||| 
Sbjct: 275 gatcccttctttccacggatgacggctccagcctctccttgaatcaccatatactttgtt 216

                   
Query: 462 cctccaag 469
           ||||||||
Sbjct: 215 cctccaag 208

---

>gb|AC102657.13| Mus musculus chromosome 10, clone RP23-15N10, complete sequence
          Length = 186954

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 432   ggttcaccttggatgaccat 451
             ||||||||||||||||||||
Sbjct: 43853 ggttcaccttggatgaccat 43872


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,702,467
Number of Sequences: 3902068
Number of extensions: 3702467
Number of successful extensions: 98041
Number of sequences better than 10.0: 142
Number of HSP's better than 10.0 without gapping: 141
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 97575
Number of HSP's gapped (non-prelim): 457
length of query: 504
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 482
effective length of database: 17,147,199,772
effective search space: 8264950290104
effective search space used: 8264950290104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---