>gb|AC073248.5| Homo sapiens BAC clone CTD-2009F14 from 7, complete sequence
          Length = 128294

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 183   ttttcctttctcttcatatgtc 204
             ||||||||||||||||||||||
Sbjct: 52530 ttttcctttctcttcatatgtc 52551

>ref|XM_817218.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.70.7750)
            partial mRNA
          Length = 2067

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 44   attggtttacctcttatttgg 64
            |||||||||||||||||||||
Sbjct: 1239 attggtttacctcttatttgg 1259

>gb|AC114284.2| Homo sapiens chromosome 5 clone CTD-2334D19, complete sequence
          Length = 126480

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 255   cttgataagccccttcagtaa 275
             |||||||||||||||||||||
Sbjct: 87811 cttgataagccccttcagtaa 87831

>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome
          Length = 859006

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 325    acaatgtactaggcttggagg 345
              |||||||||||||||||||||
Sbjct: 765611 acaatgtactaggcttggagg 765631

>gb|AC135671.3| Mus musculus BAC clone RP23-440D14 from chromosome 17, complete sequence
          Length = 188307

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 51     tacctcttatttggtattta 70
              ||||||||||||||||||||
Sbjct: 180887 tacctcttatttggtattta 180906

>gb|AC122536.4| Mus musculus BAC clone RP24-542K22 from chromosome 17, complete sequence
          Length = 150022

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 51     tacctcttatttggtattta 70
              ||||||||||||||||||||
Sbjct: 121909 tacctcttatttggtattta 121890

>emb|AL139319.16| Human DNA sequence from clone RP11-131J24 on chromosome 13q22.1-31.1
             Contains the 5' end of a novel gene (contains FLJ13449,
             possible ortholog of mouse 2810449K13Rik protein) and a
             CpG island, complete sequence
          Length = 62837

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   cttttcctttctcttcatat 201
             ||||||||||||||||||||
Sbjct: 47904 cttttcctttctcttcatat 47885

>emb|BX548044.10| Zebrafish DNA sequence from clone DKEY-10B15 in linkage group 10,
              complete sequence
          Length = 250011

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 272    gtaataatcacttatgtgtcatcc 295
              |||||||||| |||||||||||||
Sbjct: 247970 gtaataatcatttatgtgtcatcc 247947

>emb|BX537138.6| Zebrafish DNA sequence from clone DKEY-52L18 in linkage group 15,
              complete sequence
          Length = 144274

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 444    ttattgccaagatccagctc 463
              ||||||||||||||||||||
Sbjct: 116301 ttattgccaagatccagctc 116320

>emb|BX322555.7| Zebrafish DNA sequence from clone DKEY-19D21 in linkage group 15,
             complete sequence
          Length = 209310

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    tatttggtatttatggtatt 77
             ||||||||||||||||||||
Sbjct: 82741 tatttggtatttatggtatt 82722

>emb|BX470223.14| Zebrafish DNA sequence from clone DKEY-45P9 in linkage group 10,
             complete sequence
          Length = 247644

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 272   gtaataatcacttatgtgtcatcc 295
             |||||||||| |||||||||||||
Sbjct: 94146 gtaataatcatttatgtgtcatcc 94169

>gb|AC174760.1| Gasterosteus aculeatus clone VMRC26-231C14, complete sequence
          Length = 76197

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 340   tggaggagcagcagggcttg 359
             ||||||||||||||||||||
Sbjct: 57758 tggaggagcagcagggcttg 57739

>emb|AL732311.13| Mouse DNA sequence from clone RP23-125H15 on chromosome 2, complete
             sequence
          Length = 209215

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 460   gctcagcattccaagatggc 479
             ||||||||||||||||||||
Sbjct: 44228 gctcagcattccaagatggc 44209

>dbj|AP003029.2| Homo sapiens genomic DNA, chromosome 11q, clone:CTC-343F17, complete
             sequence
          Length = 142882

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 350   gcagggcttgaagtttgaaa 369
             ||||||||||||||||||||
Sbjct: 96742 gcagggcttgaagtttgaaa 96761


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,562,034
Number of Sequences: 3902068
Number of extensions: 4562034
Number of successful extensions: 88517
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88488
Number of HSP's gapped (non-prelim): 29
length of query: 514
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 491
effective length of database: 17,143,297,704
effective search space: 8417359172664
effective search space used: 8417359172664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)