ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags25f14
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY106775.1| Zea mays PCO117540 mRNA sequence 230 3e-57
2dbj|AK102348.1| Oryza sativa (japonica cultivar-group) cDNA clon... 226 5e-56
3ref|NM_196510.1| Oryza sativa (japonica cultivar-group) putative... 188 1e-44
4dbj|AB193582.1| Oryza sativa (japonica cultivar-group) OsGME-1 m... 188 1e-44
5dbj|AK104822.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
6dbj|AK069385.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
7gb|AY104279.1| Zea mays PCO103545 mRNA sequence 141 2e-30
8gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 139 9e-30
9dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 139 9e-30
10gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 139 9e-30
11gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 139 9e-30
12gb|AC146334.2| Oryza sativa (japonica cultivar-group) chromosome... 131 2e-27
13dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 131 2e-27
14gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 131 2e-27
15gb|BT016578.1| Zea mays clone Contig411 mRNA sequence 129 9e-27
16gb|AF229187.1|AF229187 Oryza sativa subsp. japonica BAC clone nb... 121 2e-24
17gb|DQ207722.1| Zea mays cultivar B73 IDP512 marker 107 3e-20
18gb|DQ207723.1| Zea mays cultivar inbred line Mo17 IDP512 marker 101 2e-18
19gb|BT013590.1| Lycopersicon esculentum clone 132353F, mRNA sequence 101 2e-18
20gb|DQ268848.1| Solanum tuberosum clone 155B09 NAD-dependent epim... 101 2e-18
21gb|AY830138.1| Ipomoea batatas cultivar Beauregard clone BAC117E... 46 0.099
22ref|XM_322466.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.39
23ref|XM_952174.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.39
24emb|BX296566.5| Zebrafish DNA sequence from clone CH211-196F4 in... 44 0.39
25ref|XM_714481.1| Candida albicans SC5314 hypothetical protein (C... 42 1.5
26ref|XM_714352.1| Candida albicans SC5314 hypothetical protein (C... 42 1.5
27gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.5
28ref|XM_848981.1| PREDICTED: Canis familiaris similar to NACHT, L... 42 1.5
29emb|CR654217.2|CNS0F3RJ Tetraodon nigroviridis full-length cDNA 42 1.5
30emb|CR645237.2|CNS0EWU3 Tetraodon nigroviridis full-length cDNA 42 1.5
31ref|XM_499876.1| Yarrowia lipolytica CLIB122, YALI0A08448g predi... 42 1.5
32emb|AL031431.8|HS462O23 Human DNA sequence from clone RP3-462O23... 42 1.5
33ref|XM_793921.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.5
34ref|XM_966297.1| PREDICTED: Tribolium castaneum similar to CG122... 42 1.5
35gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 42 1.5
36gb|AC134698.10| Homo sapiens chromosome 8, clone RP11-359P18, co... 42 1.5
37emb|CR407555.9| Zebrafish DNA sequence from clone DKEY-260H8 in ... 42 1.5
38dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
39gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.5
40emb|AL935276.16| Zebrafish DNA sequence from clone CH211-273J2, ... 42 1.5
41gb|U19103.1|YSCL8039 Saccharomyces cerevisiae chromosome XII cos... 42 1.5
42emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 42 1.5
43gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet... 40 6.1
44gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 40 6.1
45gb|AC139580.4| Mus musculus BAC clone RP23-110M15 from chromosom... 40 6.1
46gb|AY292762.1| Pronolagus saundersiae MGF gene, partial intron s... 40 6.1
47gb|BC056813.1| Danio rerio transcription elongation regulator 1 ... 40 6.1
48gb|AY231957.1| Drosophila yakuba clone yak-em_Tm2 mRNA sequence 40 6.1
49emb|CR696040.2|CNS0G00K Tetraodon nigroviridis full-length cDNA 40 6.1
50gb|AC073068.8| Homo sapiens BAC clone RP11-159I18 from 7, comple... 40 6.1
51gb|AC152067.21| Medicago truncatula clone mth2-22g24, complete s... 40 6.1
52emb|AL355333.18| Human DNA sequence from clone RP11-575N15 on ch... 40 6.1
53emb|AL139220.13| Human DNA sequence from clone RP5-1198O20 on ch... 40 6.1
54emb|AL034395.6|HS243L18 Human DNA sequence from clone RP1-243L18... 40 6.1
55gb|AC009757.8| Homo sapiens chromosome 5, clone RP11-37M16, comp... 40 6.1
56dbj|AB248956.1| Canis familiaris TLR7 mRNA for Toll-like recepto... 40 6.1
57dbj|AK096106.1| Homo sapiens cDNA FLJ38787 fis, clone LIVER20018... 40 6.1
58gb|AC008825.6| Homo sapiens chromosome 5 clone CTD-2134P3, compl... 40 6.1
59gb|AC126778.9| Medicago truncatula clone mth2-32j21, complete se... 40 6.1
60emb|BX569781.7| Zebrafish DNA sequence from clone DKEY-72L18 in ... 40 6.1
61gb|AC020782.12| Homo sapiens chromosome 8, clone RP11-562L3, com... 40 6.1
62gb|AC009927.10| Homo sapiens chromosome 8, clone RP11-114M5, com... 40 6.1
63ref|NM_169645.2| Drosophila melanogaster Tropomyosin 2 CG4843-RC... 40 6.1
64ref|NM_169644.1| Drosophila melanogaster Tropomyosin 2 CG4843-RB... 40 6.1
65ref|NM_079637.4| Drosophila melanogaster Tropomyosin 2 CG4843-RA... 40 6.1
66gb|AY071087.1| Drosophila melanogaster RE15528 full length cDNA 40 6.1
67ref|XM_696925.1| PREDICTED: Danio rerio hypothetical protein LOC... 40 6.1
68gb|AC005087.2|AC005087 Homo sapiens BAC clone CTA-306D19 from 1,... 40 6.1
69gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, r... 40 6.1
70gb|AC096736.3| Homo sapiens BAC clone RP11-171N4 from 4, complet... 40 6.1
71ref|NM_198357.1| Danio rerio transcription elongation regulator ... 40 6.1
72gb|AC108059.6| Homo sapiens BAC clone RP11-398G9 from 2, complet... 40 6.1
73gb|AC013473.8| Homo sapiens BAC clone RP11-504G5 from 2, complet... 40 6.1
74gb|AC021049.12| Homo sapiens 12 BAC RP11-904M10 (Roswell Park Ca... 40 6.1
75dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome 40 6.1
76dbj|BS000112.1| Pan troglodytes chromosome 22 clone:RP43-076J24,... 40 6.1
77emb|CR388075.14| Zebrafish DNA sequence from clone DKEY-223L3 in... 40 6.1
78gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46... 40 6.1
79emb|AL356032.4|CNS05TDD Human chromosome 14 DNA sequence BAC R-8... 40 6.1
80gb|K03277.1|DROTROPI2 D. melanogaster tropomyosin I gene, exons ... 40 6.1
81gb|K02622.1|DROTRO14 D.melanogaster gene for tropomyosin isoform... 40 6.1
82dbj|AB024552.1| Bacillus halodurans gene for SLEB, YPEB, YPFA an... 40 6.1
83dbj|AB065284.1| Cynops pyrrhogaster ngn mRNA for neurogenin rela... 40 6.1 
>gb|AY106775.1| Zea mays PCO117540 mRNA sequence
          Length = 541

 Score =  230 bits (116), Expect = 3e-57
 Identities = 228/263 (86%), Gaps = 2/263 (0%)
 Strand = Plus / Minus

                                                                       
Query: 192 gttcactccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtg 251
           ||||||||||||||||| ||||||||||||||||| ||||| ||||| ||||| ||  ||
Sbjct: 321 gttcactccttgccatcagcggcgcggagggagccgagctgaaccggggcctgtgtc-tg 263

                                                                       
Query: 252 ca-gaccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccag 310
           || ||||||||||||||||||  ||||||  ||   ||| ||||  || |||||||| ||
Sbjct: 262 cacgaccttggatgatccgtagaccgacagatccatgccctcggccttctccttctcaag 203

                                                                       
Query: 311 ctgctccttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagc 370
           |||||||||||||||  | ||||||||||||||||| ||||| |||||||| || |||||
Sbjct: 202 ctgctccttgatccaggagtacgtgatcctcagcccgtccttcagcctcatagtcggagc 143

                                                                       
Query: 371 ccagccaagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggg 430
           |||||||||||||||||||||||| |||||||| ||||| || ||||| |||||||| ||
Sbjct: 142 ccagccaagcttctccttgatgagcgtgttgtctgagttgcgcccacgcacgccctccgg 83

                                  
Query: 431 gccagggatgtggtggatgggca 453
            || |||||||||||||||||||
Sbjct: 82  cccggggatgtggtggatgggca 60
to top
>dbj|AK102348.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C16, full
            insert sequence
          Length = 1533

 Score =  226 bits (114), Expect = 5e-56
 Identities = 226/261 (86%), Gaps = 2/261 (0%)
 Strand = Plus / Minus

                                                                        
Query: 194  tcactccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgca 253
            ||||||||| ||||| || || ||||||||||||||||| ||||| ||||| ||  ||||
Sbjct: 1191 tcactcctttccatcagcagcacggagggagccaagctgcaccggcgcctgagtc-tgca 1133

                                                                        
Query: 254  g-accttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagct 312
              ||||||||||| ||||| ||||||| |||  |||| ||||  || |||||||| ||||
Sbjct: 1132 ctaccttggatgacccgtaggccgacaagtcgacgccctcggccttctccttctcgagct 1073

                                                                        
Query: 313  gctccttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagccc 372
            ||||||||||||| || || ||||||||||| |||||||| |||||||||||||||||||
Sbjct: 1072 gctccttgatccagaagtatgtgatcctcagaccatccttcagcctcatggttggagccc 1013

                                                                        
Query: 373  agccaagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggc 432
            ||||||||||||| |||||||| |||||||| ||||| || |||||||| ||||| || |
Sbjct: 1012 agccaagcttctctttgatgagcgtgttgtcggagttgcgaccacggacaccctctggcc 953

                                 
Query: 433  cagggatgtggtggatgggca 453
            | |||||||||||||||||||
Sbjct: 952  cggggatgtggtggatgggca 932
to top
>ref|NM_196510.1| Oryza sativa (japonica cultivar-group) putative epimerase/dehydratase
            (OSJNBa0061K21.15), mRNA
          Length = 1137

 Score =  188 bits (95), Expect = 1e-44
 Identities = 217/258 (84%)
 Strand = Plus / Minus

                                                                        
Query: 196  actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
            ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 1135 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 1076

                                                                        
Query: 256  ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
            |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 1075 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 1016

                                                                        
Query: 316  ccttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagcccagc 375
            |||||||||| || || |||| ||||||||| ||||| ||| |||| || || |||||||
Sbjct: 1015 ccttgatccagaagtaggtgaacctcagcccgtccttgagcttcattgtgggtgcccagc 956

                                                                        
Query: 376  caagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggccag 435
            ||||||||||||||||||| |||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 955  caagcttctccttgatgagggtgttgtcggagttacggccacggacaccctcgggtccag 896

                              
Query: 436  ggatgtggtggatgggca 453
            ||||||||||||||||||
Sbjct: 895  ggatgtggtggatgggca 878
to top
>dbj|AB193582.1| Oryza sativa (japonica cultivar-group) OsGME-1 mRNA for
            GDP-mannose-3'',5''-epimerase, complete cds
          Length = 1212

 Score =  188 bits (95), Expect = 1e-44
 Identities = 217/258 (84%)
 Strand = Plus / Minus

                                                                        
Query: 196  actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
            ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 1171 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 1112

                                                                        
Query: 256  ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
            |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 1111 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 1052

                                                                        
Query: 316  ccttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagcccagc 375
            |||||||||| || || |||| ||||||||| ||||| ||| |||| || || |||||||
Sbjct: 1051 ccttgatccagaagtaggtgaacctcagcccgtccttgagcttcattgtgggtgcccagc 992

                                                                        
Query: 376  caagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggccag 435
            ||||||||||||||||||| |||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 991  caagcttctccttgatgagggtgttgtcggagttacggccacggacaccctcgggtccag 932

                              
Query: 436  ggatgtggtggatgggca 453
            ||||||||||||||||||
Sbjct: 931  ggatgtggtggatgggca 914
to top
>dbj|AK104822.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-B04, full
            insert sequence
          Length = 1587

 Score =  188 bits (95), Expect = 1e-44
 Identities = 217/258 (84%)
 Strand = Plus / Minus

                                                                        
Query: 196  actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
            ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 1256 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 1197

                                                                        
Query: 256  ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
            |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 1196 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 1137

                                                                        
Query: 316  ccttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagcccagc 375
            |||||||||| || || |||| ||||||||| ||||| ||| |||| || || |||||||
Sbjct: 1136 ccttgatccagaagtaggtgaacctcagcccgtccttgagcttcattgtgggtgcccagc 1077

                                                                        
Query: 376  caagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggccag 435
            ||||||||||||||||||| |||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 1076 caagcttctccttgatgagggtgttgtcggagttacggccacggacaccctcgggtccag 1017

                              
Query: 436  ggatgtggtggatgggca 453
            ||||||||||||||||||
Sbjct: 1016 ggatgtggtggatgggca 999
to top
>dbj|AK069385.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023012D14, full
            insert sequence
          Length = 1592

 Score =  188 bits (95), Expect = 1e-44
 Identities = 217/258 (84%)
 Strand = Plus / Minus

                                                                        
Query: 196  actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
            ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 1261 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 1202

                                                                        
Query: 256  ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
            |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 1201 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 1142

                                                                        
Query: 316  ccttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagcccagc 375
            |||||||||| || || |||| ||||||||| ||||| ||| |||| || || |||||||
Sbjct: 1141 ccttgatccagaagtaggtgaacctcagcccgtccttgagcttcattgtgggtgcccagc 1082

                                                                        
Query: 376  caagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggccag 435
            ||||||||||||||||||| |||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 1081 caagcttctccttgatgagggtgttgtcggagttacggccacggacaccctcgggtccag 1022

                              
Query: 436  ggatgtggtggatgggca 453
            ||||||||||||||||||
Sbjct: 1021 ggatgtggtggatgggca 1004
to top
>gb|AY104279.1| Zea mays PCO103545 mRNA sequence
          Length = 1547

 Score =  141 bits (71), Expect = 2e-30
 Identities = 133/154 (86%)
 Strand = Plus / Minus

                                                                        
Query: 300  tccttctccagctgctccttgatccaaaaatacgtgatcctcagcccatccttnagcctc 359
            |||||||| | |||||| |||||||| || || |||| || |||||||||||| ||| ||
Sbjct: 1150 tccttctcgatctgctctttgatccagaagtaggtgaaccgcagcccatccttgagcttc 1091

                                                                        
Query: 360  atggttggagcccagccaagcttctccttgatgagtgtgttgtcagagttacggccacgg 419
            || || || ||||||||||||||||||||||| || |||||||||||||| || || |||
Sbjct: 1090 atcgtcggggcccagccaagcttctccttgataagggtgttgtcagagttgcgcccgcgg 1031

                                              
Query: 420  acgccctcggggccagggatgtggtggatgggca 453
            || || || |||||||||||||||||||||||||
Sbjct: 1030 accccttccgggccagggatgtggtggatgggca 997



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 197  ctccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtgg 249
            ||||||||| || ||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 1253 ctccttgccgtcggcggcgcggagggagcccagctgcacgggcgcctgggtgg 1201
to top
>gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica cultivar-group) cultivar
             Nipponbare Clone OSJNBa0061K21 From Chromosome 10,
             complete sequence
          Length = 112721

 Score =  139 bits (70), Expect = 9e-30
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                         
Query: 349   ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
             |||| ||| |||| || || |||||||||||||||||||||||||| |||||||| ||||
Sbjct: 68188 ccttgagcttcattgtgggtgcccagccaagcttctccttgatgagggtgttgtcggagt 68129

                                                          
Query: 409   tacggccacggacgccctcggggccagggatgtggtggatgggca 453
             ||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 68128 tacggccacggacaccctcgggtccagggatgtggtggatgggca 68084



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 124/156 (79%)
 Strand = Plus / Minus

                                                                         
Query: 196   actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
             ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 68474 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 68415

                                                                         
Query: 256   ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
             |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 68414 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 68355

                                                 
Query: 316   ccttgatccaaaaatacgtgatcctcagcccatcct 351
             |||||||||| || || |||| ||||||||| ||||
Sbjct: 68354 ccttgatccagaagtaggtgaacctcagcccgtcct 68319
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  139 bits (70), Expect = 9e-30
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                            
Query: 349      ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
                |||| ||| |||| || || |||||||||||||||||||||||||| |||||||| ||||
Sbjct: 14128550 ccttgagcttcattgtgggtgcccagccaagcttctccttgatgagggtgttgtcggagt 14128491

                                                             
Query: 409      tacggccacggacgccctcggggccagggatgtggtggatgggca 453
                ||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 14128490 tacggccacggacaccctcgggtccagggatgtggtggatgggca 14128446



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 124/156 (79%)
 Strand = Plus / Minus

                                                                            
Query: 196      actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
                ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 14128836 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 14128777

                                                                            
Query: 256      ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
                |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 14128776 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 14128717

                                                    
Query: 316      ccttgatccaaaaatacgtgatcctcagcccatcct 351
                |||||||||| || || |||| ||||||||| ||||
Sbjct: 14128716 ccttgatccagaagtaggtgaacctcagcccgtcct 14128681
to top
>gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb0006I13 chromosome
           10, complete sequence
          Length = 142737

 Score =  139 bits (70), Expect = 9e-30
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                       
Query: 349 ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
           |||| ||| |||| || || |||||||||||||||||||||||||| |||||||| ||||
Sbjct: 623 ccttgagcttcattgtgggtgcccagccaagcttctccttgatgagggtgttgtcggagt 564

                                                        
Query: 409 tacggccacggacgccctcggggccagggatgtggtggatgggca 453
           ||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 563 tacggccacggacaccctcgggtccagggatgtggtggatgggca 519



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 124/156 (79%)
 Strand = Plus / Minus

                                                                       
Query: 196 actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
           ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 909 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 850

                                                                       
Query: 256 ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
           |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 849 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 790

                                               
Query: 316 ccttgatccaaaaatacgtgatcctcagcccatcct 351
           |||||||||| || || |||| ||||||||| ||||
Sbjct: 789 ccttgatccagaagtaggtgaacctcagcccgtcct 754
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  139 bits (70), Expect = 9e-30
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                            
Query: 349      ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
                |||| ||| |||| || || |||||||||||||||||||||||||| |||||||| ||||
Sbjct: 14136792 ccttgagcttcattgtgggtgcccagccaagcttctccttgatgagggtgttgtcggagt 14136733

                                                             
Query: 409      tacggccacggacgccctcggggccagggatgtggtggatgggca 453
                ||||||||||||| |||||||| ||||||||||||||||||||||
Sbjct: 14136732 tacggccacggacaccctcgggtccagggatgtggtggatgggca 14136688



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 124/156 (79%)
 Strand = Plus / Minus

                                                                            
Query: 196      actccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgcaga 255
                ||||||||||||| || || ||||||||||| ||||| ||||| ||||| ||||     |
Sbjct: 14137078 actccttgccatcggcagcacggagggagcccagctgaaccggggcctgggtggacacca 14137019

                                                                            
Query: 256      ccttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagctgct 315
                |||||||||| |||||  |||  | |||  |||| | ||  || |||||||| | |||||
Sbjct: 14137018 ccttggatgagccgtaacccgcgatgtcgacgccctgggtcttctccttctctatctgct 14136959

                                                    
Query: 316      ccttgatccaaaaatacgtgatcctcagcccatcct 351
                |||||||||| || || |||| ||||||||| ||||
Sbjct: 14136958 ccttgatccagaagtaggtgaacctcagcccgtcct 14136923
to top
>gb|AC146334.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone B1356F10,
              complete sequence
          Length = 170681

 Score =  131 bits (66), Expect = 2e-27
 Identities = 95/105 (90%)
 Strand = Plus / Plus

                                                                          
Query: 349    ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
              |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||
Sbjct: 130017 ccttcagcctcatggttggagcccagccaagcttctctttgatgagcgtgttgtcggagt 130076

                                                           
Query: 409    tacggccacggacgccctcggggccagggatgtggtggatgggca 453
              | || |||||||| ||||| || || |||||||||||||||||||
Sbjct: 130077 tgcgaccacggacaccctctggcccggggatgtggtggatgggca 130121



 Score =  101 bits (51), Expect = 2e-18
 Identities = 134/159 (84%), Gaps = 2/159 (1%)
 Strand = Plus / Plus

                                                                          
Query: 194    tcactccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgca 253
              ||||||||| ||||| || || ||||||||||||||||| ||||| ||||| ||  ||||
Sbjct: 129759 tcactcctttccatcagcagcacggagggagccaagctgcaccggcgcctgagtc-tgca 129817

                                                                          
Query: 254    g-accttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagct 312
                ||||||||||| ||||| ||||||| |||  |||| ||||  || |||||||| ||||
Sbjct: 129818 ctaccttggatgacccgtaggccgacaagtcgacgccctcggccttctccttctcgagct 129877

                                                     
Query: 313    gctccttgatccaaaaatacgtgatcctcagcccatcct 351
              ||||||||||||| || || ||||||||||| |||||||
Sbjct: 129878 gctccttgatccagaagtatgtgatcctcagaccatcct 129916
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  131 bits (66), Expect = 2e-27
 Identities = 95/105 (90%)
 Strand = Plus / Plus

                                                                            
Query: 349      ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
                |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||
Sbjct: 21606498 ccttcagcctcatggttggagcccagccaagcttctctttgatgagcgtgttgtcggagt 21606557

                                                             
Query: 409      tacggccacggacgccctcggggccagggatgtggtggatgggca 453
                | || |||||||| ||||| || || |||||||||||||||||||
Sbjct: 21606558 tgcgaccacggacaccctctggcccggggatgtggtggatgggca 21606602



 Score =  101 bits (51), Expect = 2e-18
 Identities = 134/159 (84%), Gaps = 2/159 (1%)
 Strand = Plus / Plus

                                                                            
Query: 194      tcactccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgca 253
                ||||||||| ||||| || || ||||||||||||||||| ||||| ||||| ||  ||||
Sbjct: 21606240 tcactcctttccatcagcagcacggagggagccaagctgcaccggcgcctgagtc-tgca 21606298

                                                                            
Query: 254      g-accttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagct 312
                  ||||||||||| ||||| ||||||| |||  |||| ||||  || |||||||| ||||
Sbjct: 21606299 ctaccttggatgacccgtaggccgacaagtcgacgccctcggccttctccttctcgagct 21606358

                                                       
Query: 313      gctccttgatccaaaaatacgtgatcctcagcccatcct 351
                ||||||||||||| || || ||||||||||| |||||||
Sbjct: 21606359 gctccttgatccagaagtatgtgatcctcagaccatcct 21606397
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  131 bits (66), Expect = 2e-27
 Identities = 95/105 (90%)
 Strand = Plus / Plus

                                                                            
Query: 349      ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
                |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||
Sbjct: 21916697 ccttcagcctcatggttggagcccagccaagcttctctttgatgagcgtgttgtcggagt 21916756

                                                             
Query: 409      tacggccacggacgccctcggggccagggatgtggtggatgggca 453
                | || |||||||| ||||| || || |||||||||||||||||||
Sbjct: 21916757 tgcgaccacggacaccctctggcccggggatgtggtggatgggca 21916801



 Score =  101 bits (51), Expect = 2e-18
 Identities = 134/159 (84%), Gaps = 2/159 (1%)
 Strand = Plus / Plus

                                                                            
Query: 194      tcactccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtggtgca 253
                ||||||||| ||||| || || ||||||||||||||||| ||||| ||||| ||  ||||
Sbjct: 21916439 tcactcctttccatcagcagcacggagggagccaagctgcaccggcgcctgagtc-tgca 21916497

                                                                            
Query: 254      g-accttggatgatccgtatgccgacacgtctgcgccttcggatttttccttctccagct 312
                  ||||||||||| ||||| ||||||| |||  |||| ||||  || |||||||| ||||
Sbjct: 21916498 ctaccttggatgacccgtaggccgacaagtcgacgccctcggccttctccttctcgagct 21916557

                                                       
Query: 313      gctccttgatccaaaaatacgtgatcctcagcccatcct 351
                ||||||||||||| || || ||||||||||| |||||||
Sbjct: 21916558 gctccttgatccagaagtatgtgatcctcagaccatcct 21916596
to top
>gb|BT016578.1| Zea mays clone Contig411 mRNA sequence
          Length = 1538

 Score =  129 bits (65), Expect = 9e-27
 Identities = 118/136 (86%)
 Strand = Plus / Minus

                                                                        
Query: 318  ttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagcccagcca 377
            |||||||| || || |||| || |||||||||||| ||| |||| || || |||||||||
Sbjct: 1130 ttgatccagaagtaggtgaaccgcagcccatccttgagcttcatcgtcggggcccagcca 1071

                                                                        
Query: 378  agcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggccaggg 437
            |||||||||||||| || |||||||||||||| || || ||||| || || |||||||||
Sbjct: 1070 agcttctccttgataagggtgttgtcagagttgcgcccgcggaccccttccgggccaggg 1011

                            
Query: 438  atgtggtggatgggca 453
            ||||||||||||||||
Sbjct: 1010 atgtggtggatgggca 995



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 197  ctccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtgg 249
            ||||||||| || |||| |||||||||||| ||||| || || ||||| ||||
Sbjct: 1251 ctccttgccgtcggcggggcggagggagcccagctgcacgggcgcctgggtgg 1199
to top
>gb|AF229187.1|AF229187 Oryza sativa subsp. japonica BAC clone nbxb0032I20, complete sequence
          Length = 144651

 Score =  121 bits (61), Expect = 2e-24
 Identities = 73/77 (94%)
 Strand = Plus / Minus

                                                                          
Query: 377    aagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggccagg 436
              |||||||||||||||||| |||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 144651 aagcttctccttgatgagggtgttgtcggagttacggccacggacaccctcgggtccagg 144592

                               
Query: 437    gatgtggtggatgggca 453
              |||||||||||||||||
Sbjct: 144591 gatgtggtggatgggca 144575
to top
>gb|DQ207722.1| Zea mays cultivar B73 IDP512 marker
          Length = 527

 Score =  107 bits (54), Expect = 3e-20
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 349 ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
           |||| ||| |||| || || ||||||||||||||||||||||| || |||||||||||||
Sbjct: 351 ccttgagcttcatcgtcggggcccagccaagcttctccttgataagggtgttgtcagagt 410

                                                        
Query: 409 tacggccacggacgccctcggggccagggatgtggtggatgggca 453
           | || || ||||| || || |||||||||||||||||||||||||
Sbjct: 411 tgcgcccgcggaccccttccgggccagggatgtggtggatgggca 455



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 197 ctccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtgg 249
           ||||||||| || ||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 107 ctccttgccgtcggcggcgcggagggagcccagctgcacgggcgcctgggtgg 159



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 300 tccttctccagctgctccttgatccaaaaatacgtgatcctcagcccatcct 351
           |||||||| | |||||| |||||||| || || |||| || |||||||||||
Sbjct: 210 tccttctcgatctgctctttgatccagaagtaggtgaaccgcagcccatcct 261
to top
>gb|DQ207723.1| Zea mays cultivar inbred line Mo17 IDP512 marker
          Length = 473

 Score =  101 bits (51), Expect = 2e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 349 ccttnagcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagt 408
           |||| ||| |||| || || ||||||||||||||||||||||| || |||||||||||||
Sbjct: 359 ccttgagcttcatcgtcggggcccagccaagcttctccttgataagggtgttgtcagagt 418

                                                     
Query: 409 tacggccacggacgccctcggggccagggatgtggtggatgg 450
           | || || ||||| || || ||||||||||||||||||||||
Sbjct: 419 tgcgcccgcggaccccttccgggccagggatgtggtggatgg 460



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 197 ctccttgccatctgcggcgcggagggagccaagctggaccggtgcctgcgtgg 249
           ||||||||| || ||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 115 ctccttgccgtcggcggcgcggagggagcccagctgcacgggcgcctgggtgg 167



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 300 tccttctccagctgctccttgatccaaaaatacgtgatcctcagcccatcct 351
           |||||||| | |||||| |||||||| || || |||| || |||||||||||
Sbjct: 218 tccttctcgatctgctctttgatccagaagtaggtgaaccgcagcccatcct 269
to top
>gb|BT013590.1| Lycopersicon esculentum clone 132353F, mRNA sequence
          Length = 1880

 Score =  101 bits (51), Expect = 2e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                        
Query: 315  tccttgatccaaaaatacgtgatcctcagcccatccttnagcctcatggttggagcccag 374
            ||||| ||||| |||||||| ||||||| ||||||||| | | ||||  | |||||||||
Sbjct: 1199 tcctttatccagaaatacgtaatcctcaacccatccttcaacttcatattaggagcccag 1140

                                                                        
Query: 375  ccaagcttctccttgatgagtgtgttgtcagagttacggccacggacgccctcggggcca 434
            |||||||| ||||||||||| |||||||||||||| || ||||| || ||||| || || 
Sbjct: 1139 ccaagcttttccttgatgagagtgttgtcagagtttcgaccacgcacaccctctggtcct 1080

                          
Query: 435  gggatgtggtggat 448
            || ||||| |||||
Sbjct: 1079 ggaatgtgatggat 1066
to top
>gb|DQ268848.1| Solanum tuberosum clone 155B09 NAD-dependent epimerase/dehydratase
            family protein-like protein mRNA, complete cds
          Length = 1521

 Score =  101 bits (51), Expect = 2e-18
 Identities = 128/154 (83%)
 Strand = Plus / Minus

                                                                        
Query: 294  gatttttccttctccagctgctccttgatccaaaaatacgtgatcctcagcccatccttn 353
            ||||| || ||||| | ||||||||||||||| || || || || ||||| |||||||| 
Sbjct: 1055 gatttctctttctcgatctgctccttgatccagaagtatgtaattctcagaccatccttc 996

                                                                        
Query: 354  agcctcatggttggagcccagccaagcttctccttgatgagtgtgttgtcagagttacgg 413
            |  ||||| ||||||||||| ||||||||||| || || ||||||||||| ||||| || 
Sbjct: 995  aatctcattgttggagcccaaccaagcttctcttttatcagtgtgttgtctgagttgcga 936

                                              
Query: 414  ccacggacgccctcggggccagggatgtggtgga 447
            ||||||||||| || ||||| || ||||| ||||
Sbjct: 935  ccacggacgccttctgggcctggaatgtgttgga 902
to top
>gb|AY830138.1| Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence
          Length = 99025

 Score = 46.1 bits (23), Expect = 0.099
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 16    tttacatgtacaaataaaatgtt 38
             |||||||||||||||||||||||
Sbjct: 61371 tttacatgtacaaataaaatgtt 61349
to top
>ref|XM_322466.1| Neurospora crassa OR74A hypothetical protein (NCU00381.1) partial
            mRNA
          Length = 3465

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 49   aacatcctcttgcgccaagcag 70
            ||||||||||||||||||||||
Sbjct: 3161 aacatcctcttgcgccaagcag 3182
to top
>ref|XM_952174.1| Neurospora crassa OR74A hypothetical protein (NCU00381.1) partial
            mRNA
          Length = 3465

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 49   aacatcctcttgcgccaagcag 70
            ||||||||||||||||||||||
Sbjct: 3161 aacatcctcttgcgccaagcag 3182
to top
>emb|BX296566.5| Zebrafish DNA sequence from clone CH211-196F4 in linkage group 11,
             complete sequence
          Length = 128109

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 29    ataaaatgtttaacattaataa 50
             ||||||||||||||||||||||
Sbjct: 90446 ataaaatgtttaacattaataa 90467
to top
>ref|XM_714481.1| Candida albicans SC5314 hypothetical protein (CaO19_9547), mRNA
          Length = 2130

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 301  ccttctccagctgctccttga 321
            |||||||||||||||||||||
Sbjct: 1538 ccttctccagctgctccttga 1518
to top
>ref|XM_714352.1| Candida albicans SC5314 hypothetical protein (CaO19_1995), mRNA
          Length = 2130

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 301  ccttctccagctgctccttga 321
            |||||||||||||||||||||
Sbjct: 1538 ccttctccagctgctccttga 1518
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 142     aaatggtgtgacaactgacaa 162
               |||||||||||||||||||||
Sbjct: 6185580 aaatggtgtgacaactgacaa 6185560
to top
>ref|XM_848981.1| PREDICTED: Canis familiaris similar to NACHT, LRR and PYD containing
            protein 10 (LOC611323), mRNA
          Length = 2061

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 301  ccttctccagctgctccttgatcca 325
            ||||||||| |||||||||||||||
Sbjct: 1108 ccttctccatctgctccttgatcca 1084
to top
>emb|CR654217.2|CNS0F3RJ Tetraodon nigroviridis full-length cDNA
          Length = 1435

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 299 ttccttctccagctgctcctt 319
           |||||||||||||||||||||
Sbjct: 146 ttccttctccagctgctcctt 126
to top
>emb|CR645237.2|CNS0EWU3 Tetraodon nigroviridis full-length cDNA
          Length = 1432

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 299 ttccttctccagctgctcctt 319
           |||||||||||||||||||||
Sbjct: 139 ttccttctccagctgctcctt 119
to top
>ref|XM_499876.1| Yarrowia lipolytica CLIB122, YALI0A08448g predicted mRNA
          Length = 993

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 300 tccttctccagctgctccttg 320
           |||||||||||||||||||||
Sbjct: 785 tccttctccagctgctccttg 765
to top
>emb|AL031431.8|HS462O23 Human DNA sequence from clone RP3-462O23 on chromosome 1p35.1-36.12
             Contains the 3' end of the gene for sister-of-mammalian
             grainyhead (SOM), a novel gene (LOC90529) and a novel gene
             (DJ462O23.2), complete sequence
          Length = 154154

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 21    atgtacaaataaaatgtttaacattaataacat 53
             |||||||| ||||||||||||||  ||||||||
Sbjct: 50169 atgtacaagtaaaatgtttaacaacaataacat 50201
to top
>ref|XM_793921.1| PREDICTED: Strongylocentrotus purpuratus similar to SLIT-ROBO Rho
           GTPase activating protein 3 (LOC594484), mRNA
          Length = 1425

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 301 ccttctccagctgctccttga 321
           |||||||||||||||||||||
Sbjct: 34  ccttctccagctgctccttga 14
to top
>ref|XM_966297.1| PREDICTED: Tribolium castaneum similar to CG1221-PA, isoform A
            (LOC660033), mRNA
          Length = 1250

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 27   aaataaaatgtttaacattaa 47
            |||||||||||||||||||||
Sbjct: 1230 aaataaaatgtttaacattaa 1250
to top
>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 289    cttcggatttttccttctcca 309
              |||||||||||||||||||||
Sbjct: 845570 cttcggatttttccttctcca 845550
to top
>gb|AC134698.10| Homo sapiens chromosome 8, clone RP11-359P18, complete sequence
          Length = 173305

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 432    ccagggatgtggtggatgggc 452
              |||||||||||||||||||||
Sbjct: 131613 ccagggatgtggtggatgggc 131633
to top
>emb|CR407555.9| Zebrafish DNA sequence from clone DKEY-260H8 in linkage group 5,
             complete sequence
          Length = 156095

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 150   tgacaactgacaaacaactga 170
             |||||||||||||||||||||
Sbjct: 11748 tgacaactgacaaacaactga 11768
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 142     aaatggtgtgacaactgacaa 162
               |||||||||||||||||||||
Sbjct: 6184793 aaatggtgtgacaactgacaa 6184773
to top
>gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNAa0090D11, complete sequence
          Length = 115403

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   aaatggtgtgacaactgacaa 162
             |||||||||||||||||||||
Sbjct: 24191 aaatggtgtgacaactgacaa 24171
to top
>emb|AL935276.16| Zebrafish DNA sequence from clone CH211-273J2, complete sequence
          Length = 164481

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 27    aaataaaatgtttaacattaa 47
             |||||||||||||||||||||
Sbjct: 49762 aaataaaatgtttaacattaa 49742
to top
>gb|U19103.1|YSCL8039 Saccharomyces cerevisiae chromosome XII cosmid 8039
          Length = 31806

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 16   tttacatgtacaaataaaatgttta 40
            ||||||||||||||||| |||||||
Sbjct: 1503 tttacatgtacaaataatatgttta 1527
to top
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    tccttctccagctgctccttg 320
              |||||||||||||||||||||
Sbjct: 843264 tccttctccagctgctccttg 843244
to top
>gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complete genome
          Length = 2401520

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 300    tccttctccagctgctcctt 319
              ||||||||||||||||||||
Sbjct: 554200 tccttctccagctgctcctt 554181
to top
>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 305     ctccagctgctccttgatcc 324
               ||||||||||||||||||||
Sbjct: 2729798 ctccagctgctccttgatcc 2729817
to top
>gb|AC139580.4| Mus musculus BAC clone RP23-110M15 from chromosome 13, complete sequence
          Length = 205480

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     acaaataaaatgtttaacat 44
              ||||||||||||||||||||
Sbjct: 102714 acaaataaaatgtttaacat 102695
to top
>gb|AY292762.1| Pronolagus saundersiae MGF gene, partial intron sequence
          Length = 678

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 150 tgacaactgacaaacaactg 169
           ||||||||||||||||||||
Sbjct: 449 tgacaactgacaaacaactg 468
to top
>gb|BC056813.1| Danio rerio transcription elongation regulator 1 (CA150), mRNA (cDNA
            clone MGC:63740 IMAGE:2639923), complete cds
          Length = 3833

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 389  gatgagtgtgttgtcagagt 408
            ||||||||||||||||||||
Sbjct: 3176 gatgagtgtgttgtcagagt 3195
to top
>gb|AY231957.1| Drosophila yakuba clone yak-em_Tm2 mRNA sequence
          Length = 638

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ccttctccagctgctccttg 320
           ||||||||||||||||||||
Sbjct: 106 ccttctccagctgctccttg 87
to top
>emb|CR696040.2|CNS0G00K Tetraodon nigroviridis full-length cDNA
          Length = 1345

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 300 tccttctccagctgctcctt 319
           ||||||||||||||||||||
Sbjct: 296 tccttctccagctgctcctt 277
to top
>gb|AC073068.8| Homo sapiens BAC clone RP11-159I18 from 7, complete sequence
          Length = 171058

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 75    tcccgtttacaacagcacaaaaag 98
             |||| |||||||||||||||||||
Sbjct: 92025 tcccatttacaacagcacaaaaag 92048
to top
>gb|AC152067.21| Medicago truncatula clone mth2-22g24, complete sequence
          Length = 86972

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    acaaaaagctacaaatctca 110
             ||||||||||||||||||||
Sbjct: 17085 acaaaaagctacaaatctca 17066
to top
>emb|AL355333.18| Human DNA sequence from clone RP11-575N15 on chromosome 10, complete
              sequence
          Length = 180545

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 51     catcctcttgcgccaagcag 70
              ||||||||||||||||||||
Sbjct: 163581 catcctcttgcgccaagcag 163600
to top
>emb|AL139220.13| Human DNA sequence from clone RP5-1198O20 on chromosome 1p32.3-34.2,
              complete sequence
          Length = 133728

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     tttacatgtacaaataaaat 35
              ||||||||||||||||||||
Sbjct: 130153 tttacatgtacaaataaaat 130134
to top
>emb|AL034395.6|HS243L18 Human DNA sequence from clone RP1-243L18 on chromosome 1p36.11-36.23
             Contains the 5' end of a novel gene (KIAA1026) and a CpG
             island, complete sequence
          Length = 110654

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 299   ttccttctccagctgctcct 318
             ||||||||||||||||||||
Sbjct: 17316 ttccttctccagctgctcct 17335
to top
>gb|AC009757.8| Homo sapiens chromosome 5, clone RP11-37M16, complete sequence
          Length = 166918

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     ttttacatgtacaaataaaa 34
              ||||||||||||||||||||
Sbjct: 143789 ttttacatgtacaaataaaa 143808
to top
>dbj|AB248956.1| Canis familiaris TLR7 mRNA for Toll-like receptor 7 protein, complete
            cds
          Length = 4244

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 372  cagccaagcttctccttgatgagt 395
            |||||||||||||||||| |||||
Sbjct: 3293 cagccaagcttctccttggtgagt 3270
to top
>dbj|AK096106.1| Homo sapiens cDNA FLJ38787 fis, clone LIVER2001835, moderately
            similar to MAGO NASHI PROTEIN
          Length = 2673

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 24   tacaaataaaatgtttaacattaataac 51
            |||||||||||||| ||| |||||||||
Sbjct: 1833 tacaaataaaatgtgtaatattaataac 1806
to top
>gb|AC008825.6| Homo sapiens chromosome 5 clone CTD-2134P3, complete sequence
          Length = 155495

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    ttttacatgtacaaataaaa 34
             ||||||||||||||||||||
Sbjct: 77624 ttttacatgtacaaataaaa 77643
to top
>gb|AC126778.9| Medicago truncatula clone mth2-32j21, complete sequence
          Length = 110448

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  acaaataaaatgtttaacat 44
           ||||||||||||||||||||
Sbjct: 508 acaaataaaatgtttaacat 489
to top
>emb|BX569781.7| Zebrafish DNA sequence from clone DKEY-72L18 in linkage group 17,
             complete sequence
          Length = 170138

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   tgtgacaactgacaaacaac 167
             ||||||||||||||||||||
Sbjct: 10326 tgtgacaactgacaaacaac 10345
to top
>gb|AC020782.12| Homo sapiens chromosome 8, clone RP11-562L3, complete sequence
          Length = 104745

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     aataaaatgtttaacattaa 47
              ||||||||||||||||||||
Sbjct: 100446 aataaaatgtttaacattaa 100465
to top
>gb|AC009927.10| Homo sapiens chromosome 8, clone RP11-114M5, complete sequence
          Length = 166985

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 28    aataaaatgtttaacattaa 47
             ||||||||||||||||||||
Sbjct: 28123 aataaaatgtttaacattaa 28142
to top
>ref|NM_169645.2| Drosophila melanogaster Tropomyosin 2 CG4843-RC, transcript variant
           C (Tm2), mRNA
          Length = 1015

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ccttctccagctgctccttg 320
           ||||||||||||||||||||
Sbjct: 359 ccttctccagctgctccttg 340
to top
>ref|NM_169644.1| Drosophila melanogaster Tropomyosin 2 CG4843-RB, transcript variant
           B (Tm2), mRNA
          Length = 1514

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ccttctccagctgctccttg 320
           ||||||||||||||||||||
Sbjct: 356 ccttctccagctgctccttg 337
to top
>ref|NM_079637.4| Drosophila melanogaster Tropomyosin 2 CG4843-RA, transcript variant
           A (Tm2), mRNA
          Length = 1517

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ccttctccagctgctccttg 320
           ||||||||||||||||||||
Sbjct: 359 ccttctccagctgctccttg 340
to top
>gb|AY071087.1| Drosophila melanogaster RE15528 full length cDNA
          Length = 1244

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ccttctccagctgctccttg 320
           ||||||||||||||||||||
Sbjct: 359 ccttctccagctgctccttg 340
to top
>ref|XM_696925.1| PREDICTED: Danio rerio hypothetical protein LOC554766 (LOC554766),
            mRNA
          Length = 3807

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 389  gatgagtgtgttgtcagagt 408
            ||||||||||||||||||||
Sbjct: 3167 gatgagtgtgttgtcagagt 3186
to top
>gb|AC005087.2|AC005087 Homo sapiens BAC clone CTA-306D19 from 1, complete sequence
          Length = 53204

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    tttacatgtacaaataaaat 35
             ||||||||||||||||||||
Sbjct: 28771 tttacatgtacaaataaaat 28790
to top
>gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, region 88E-88F, BAC clone
             BACR13A02, complete sequence
          Length = 166141

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   ccttctccagctgctccttg 320
             ||||||||||||||||||||
Sbjct: 71708 ccttctccagctgctccttg 71689
to top
>gb|AC096736.3| Homo sapiens BAC clone RP11-171N4 from 4, complete sequence
          Length = 172989

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     aaataaaatgtttaacatta 46
              ||||||||||||||||||||
Sbjct: 127336 aaataaaatgtttaacatta 127355
to top
>ref|NM_198357.1| Danio rerio transcription elongation regulator 1 (CA150) (tcerg1),
            mRNA
          Length = 3833

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 389  gatgagtgtgttgtcagagt 408
            ||||||||||||||||||||
Sbjct: 3176 gatgagtgtgttgtcagagt 3195
to top
>gb|AC108059.6| Homo sapiens BAC clone RP11-398G9 from 2, complete sequence
          Length = 124950

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    acaaataaaatgtttaacat 44
             ||||||||||||||||||||
Sbjct: 75850 acaaataaaatgtttaacat 75831
to top
>gb|AC013473.8| Homo sapiens BAC clone RP11-504G5 from 2, complete sequence
          Length = 170781

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     tacatgtacaaataaaatgt 37
              ||||||||||||||||||||
Sbjct: 165768 tacatgtacaaataaaatgt 165787
to top
>gb|AC021049.12| Homo sapiens 12 BAC RP11-904M10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 175315

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 24     tacaaataaaatgtttaacattaataac 51
              |||||||||||||| ||| |||||||||
Sbjct: 141239 tacaaataaaatgtgtaatattaataac 141212
to top
>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome
          Length = 4202352

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 130     gactgaatcaagaaatggtg 149
               ||||||||||||||||||||
Sbjct: 1710709 gactgaatcaagaaatggtg 1710728
to top
>dbj|BS000112.1| Pan troglodytes chromosome 22 clone:RP43-076J24, map 22, complete
             sequences
          Length = 169786

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 30    taaaatgtttaacattaata 49
             ||||||||||||||||||||
Sbjct: 36322 taaaatgtttaacattaata 36341
to top
>emb|CR388075.14| Zebrafish DNA sequence from clone DKEY-223L3 in linkage group 4,
             complete sequence
          Length = 116492

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 24    tacaaataaaatgtttaacattaa 47
             |||||||| |||||||||||||||
Sbjct: 69958 tacaaatataatgtttaacattaa 69981
to top
>gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46 of 118 of the complete
              sequence
          Length = 236375

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 301    ccttctccagctgctccttg 320
              ||||||||||||||||||||
Sbjct: 116140 ccttctccagctgctccttg 116121
to top
>emb|AL356032.4|CNS05TDD Human chromosome 14 DNA sequence BAC R-802A16 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 169936

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   ttcagactgaatcaagaaat 145
             ||||||||||||||||||||
Sbjct: 85214 ttcagactgaatcaagaaat 85195
to top
>gb|K03277.1|DROTROPI2 D. melanogaster tropomyosin I gene, exons 2-5, complete cds
          Length = 3599

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ccttctccagctgctccttg 320
           ||||||||||||||||||||
Sbjct: 808 ccttctccagctgctccttg 789
to top
>gb|K02622.1|DROTRO14 D.melanogaster gene for tropomyosin isoforms 127 and 129, exons 1
           and 2
          Length = 893

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ccttctccagctgctccttg 320
           ||||||||||||||||||||
Sbjct: 210 ccttctccagctgctccttg 191
to top
>dbj|AB024552.1| Bacillus halodurans gene for SLEB, YPEB, YPFA and CMK, complete and
            partial cds
          Length = 3482

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 130  gactgaatcaagaaatggtg 149
            ||||||||||||||||||||
Sbjct: 2268 gactgaatcaagaaatggtg 2287
to top
>dbj|AB065284.1| Cynops pyrrhogaster ngn mRNA for neurogenin related protein, complete
            cds
          Length = 1719

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 26   caaataaaatgtttaacatt 45
            ||||||||||||||||||||
Sbjct: 1675 caaataaaatgtttaacatt 1694


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,212,366
Number of Sequences: 3902068
Number of extensions: 4212366
Number of successful extensions: 99503
Number of sequences better than 10.0: 83
Number of HSP's better than 10.0 without gapping: 83
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99157
Number of HSP's gapped (non-prelim): 345
length of query: 453
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 431
effective length of database: 17,147,199,772
effective search space: 7390443101732
effective search space used: 7390443101732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top