ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags24p24 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT016445.1| Zea mays clone Contig278 mRNA sequence Length = 1018 Score = 351 bits (177), Expect = 1e-93 Identities = 245/268 (91%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 699 aacggttggccttggcaacacgctcaatctcgtccttcttcttgatggcgtaactgttgg 640 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 |||||||||||||||| |||||||||||||| ||||||||||| |||||||| |||| | Sbjct: 639 atgagcccttggcagcgttgatcagctcatctgcaaggcactcggcaatggttttgatgt 580 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | |||||||| |||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 579 tccggaaagcactctccctggcaccagtggtgaggaggtagatggcctggttcaccctcc 520 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | ||||| ||||||||||| ||||| || ||||||||||||| || ||||| ||||| | Sbjct: 519 tcaggggtgagatatccacggcctgccttctcacaacaccagcggaaccaatacgggtgg 460 Query: 413 catcctcacgtgggccactgttgatgat 440 |||||||||| ||||||||||||||||| Sbjct: 459 catcctcacgggggccactgttgatgat 432
>gb|AY103625.1| Zea mays PCO091587 mRNA sequence Length = 1085 Score = 351 bits (177), Expect = 1e-93 Identities = 245/268 (91%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 750 aacggttggccttggcaacacgctcaatctcgtccttcttcttgatggcgtaactgttgg 691 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 |||||||||||||||| |||||||||||||| ||||||||||| |||||||| |||| | Sbjct: 690 atgagcccttggcagcgttgatcagctcatctgcaaggcactcggcaatggttttgatgt 631 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | |||||||| |||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 630 tccggaaagcactctccctggcaccagtggtgaggaggtagatggcctggttcaccctcc 571 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | ||||| ||||||||||| ||||| || ||||||||||||| || ||||| ||||| | Sbjct: 570 tcaggggtgagatatccacggcctgccttctcacaacaccagcggaaccaatacgggtgg 511 Query: 413 catcctcacgtgggccactgttgatgat 440 |||||||||| ||||||||||||||||| Sbjct: 510 catcctcacgggggccactgttgatgat 483
>gb|BT016516.1| Zea mays clone Contig349 mRNA sequence Length = 818 Score = 337 bits (170), Expect = 2e-89 Identities = 241/265 (90%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct: 657 aacggttggccttggcaacacgctcaatctcgtccttcttcttgatggcgtagctgttgg 598 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 | |||||||||||||| ||||||| |||||| |||||||||||||||||||| |||| | Sbjct: 597 aagagcccttggcagcgttgatcaactcatctgcaaggcactcagcaatggttttgatgt 538 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | | ||||||||||||||||||||||||||| || ||||||||||||||||||||||| | Sbjct: 537 tcctgaaagcgctctccctggcaccagtggtgaggaggtagatggcctggttcacccttc 478 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | ||||| ||||||||||||||||| || ||||||||||||| ||| ||||| ||||| | Sbjct: 477 tcaggggtgagatatccacagcctgccttctcacaacaccagctgaaccaatacgggtgg 418 Query: 413 catcctcacgtgggccactgttgat 437 ||||||||||||| ||||||||||| Sbjct: 417 catcctcacgtggtccactgttgat 393
>gb|BT016589.1| Zea mays clone Contig422 mRNA sequence Length = 899 Score = 319 bits (161), Expect = 4e-84 Identities = 235/260 (90%) Strand = Plus / Minus Query: 181 gccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccc 240 ||||||| ||||||||| ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 676 gccttggaaacacgctcaatctcgtcctttttcttgatggcgtaactgttggatgagccc 617 Query: 241 ttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaa 300 |||||||| |||||||||||||| ||||||||||| |||||||| |||| || ||||| Sbjct: 616 ttggcagcgttgatcagctcatctgcaaggcactcggcaatggttttgatgttcaggaaa 557 Query: 301 gcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcctgaggggg 360 || |||||||||||||||||||| || |||||||||||||||||||||||||| ||||| Sbjct: 556 gcactctccctggcaccagtggtgaggaggtagatggcctggttcaccctcctcaggggt 497 Query: 361 gagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtagcatcctca 420 ||||||||||| ||||| || ||||||||||||| || ||||| ||||| ||||||||| Sbjct: 496 gagatatccacggcctgccttctcacaacaccagcggaaccaatacgggtggcatcctca 437 Query: 421 cgtgggccactgttgatgat 440 || ||||||||||||||||| Sbjct: 436 cgggggccactgttgatgat 417
>dbj|AK103918.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-A08, full insert sequence Length = 884 Score = 311 bits (157), Expect = 1e-81 Identities = 240/268 (89%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||||| Sbjct: 707 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggcatagctgttgg 648 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 ||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||| | Sbjct: 647 atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttgatgt 588 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | | ||| ||||||||||||||||||||||| || |||||||| |||||||| ||||||| Sbjct: 587 tcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttgaccctcc 528 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | | ||| ||||||||||||||||| ||||||||| |||| | |||||||| ||||| | Sbjct: 527 tcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaatacgggtcg 468 Query: 413 catcctcacgtgggccactgttgatgat 440 |||||||||| ||||||||||||||||| Sbjct: 467 catcctcacgagggccactgttgatgat 440
>dbj|AK059823.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-E03, full insert sequence Length = 1022 Score = 311 bits (157), Expect = 1e-81 Identities = 240/268 (89%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||||| Sbjct: 819 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggcatagctgttgg 760 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 ||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||| | Sbjct: 759 atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttgatgt 700 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | | ||| ||||||||||||||||||||||| || |||||||| |||||||| ||||||| Sbjct: 699 tcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttgaccctcc 640 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | | ||| ||||||||||||||||| ||||||||| |||| | |||||||| ||||| | Sbjct: 639 tcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaatacgggtcg 580 Query: 413 catcctcacgtgggccactgttgatgat 440 |||||||||| ||||||||||||||||| Sbjct: 579 catcctcacgagggccactgttgatgat 552
>dbj|AK059558.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-G10, full insert sequence Length = 1012 Score = 311 bits (157), Expect = 1e-81 Identities = 240/268 (89%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||||| Sbjct: 703 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggcatagctgttgg 644 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 ||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||| | Sbjct: 643 atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttgatgt 584 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | | ||| ||||||||||||||||||||||| || |||||||| |||||||| ||||||| Sbjct: 583 tcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttgaccctcc 524 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | | ||| ||||||||||||||||| ||||||||| |||| | |||||||| ||||| | Sbjct: 523 tcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaatacgggtcg 464 Query: 413 catcctcacgtgggccactgttgatgat 440 |||||||||| ||||||||||||||||| Sbjct: 463 catcctcacgagggccactgttgatgat 436
>ref|NM_183433.2| Oryza sativa (japonica cultivar-group), mRNA Length = 864 Score = 264 bits (133), Expect = 2e-67 Identities = 234/268 (87%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||| ||||| ||||||||||||||||| || ||||||| Sbjct: 679 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggcatagctgttgg 620 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| | Sbjct: 619 atgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtcttgatgt 560 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | | || || ||||||||||| |||||||| || |||||||| |||||||| ||||||| Sbjct: 559 tcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttgaccctcc 500 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | | ||| ||||||||||||||||| ||||||||| | |||| || || || ||||| | Sbjct: 499 tcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgatacgggttg 440 Query: 413 catcctcacgtgggccactgttgatgat 440 | |||||||| ||||| ||||||||||| Sbjct: 439 cgtcctcacgcgggccgctgttgatgat 412
>dbj|AK121523.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028P14, full insert sequence Length = 916 Score = 264 bits (133), Expect = 2e-67 Identities = 234/268 (87%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||| ||||| ||||||||||||||||| || ||||||| Sbjct: 689 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggcatagctgttgg 630 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| | Sbjct: 629 atgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtcttgatgt 570 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | | || || ||||||||||| |||||||| || |||||||| |||||||| ||||||| Sbjct: 569 tcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttgaccctcc 510 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | | ||| ||||||||||||||||| ||||||||| | |||| || || || ||||| | Sbjct: 509 tcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgatacgggttg 450 Query: 413 catcctcacgtgggccactgttgatgat 440 | |||||||| ||||| ||||||||||| Sbjct: 449 cgtcctcacgcgggccgctgttgatgat 422
>dbj|AK059844.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-E02, full insert sequence Length = 864 Score = 264 bits (133), Expect = 2e-67 Identities = 234/268 (87%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| ||||||||||||||||| ||||| ||||||||||||||||| || ||||||| Sbjct: 679 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggcatagctgttgg 620 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacat 292 ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| | Sbjct: 619 atgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtcttgatgt 560 Query: 293 tacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcc 352 | | || || ||||||||||| |||||||| || |||||||| |||||||| ||||||| Sbjct: 559 tcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttgaccctcc 500 Query: 353 tgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtag 412 | | ||| ||||||||||||||||| ||||||||| | |||| || || || ||||| | Sbjct: 499 tcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgatacgggttg 440 Query: 413 catcctcacgtgggccactgttgatgat 440 | |||||||| ||||| ||||||||||| Sbjct: 439 cgtcctcacgcgggccgctgttgatgat 412
>gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0078f20, complete sequence Length = 151042 Score = 222 bits (112), Expect = 7e-55 Identities = 183/207 (88%) Strand = Plus / Plus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||| Sbjct: 69133 ctgttggatgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtc 69192 Query: 286 ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 345 |||| || | ||| ||||||||||||||||||||||| || |||||||| |||||||| Sbjct: 69193 ttgatgttcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttg 69252 Query: 346 accctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaatt 405 |||||||| | ||| ||||||||||||||||| ||||||||| |||| | |||||||| Sbjct: 69253 accctcctcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaata 69312 Query: 406 cgggtagcatcctcacgtgggccactg 432 ||||| ||||||||||| ||||||||| Sbjct: 69313 cgggtcgcatcctcacgagggccactg 69339 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Plus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 68995 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggc 69043
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 222 bits (112), Expect = 7e-55 Identities = 183/207 (88%) Strand = Plus / Plus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||| Sbjct: 16328698 ctgttggatgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtc 16328757 Query: 286 ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 345 |||| || | ||| ||||||||||||||||||||||| || |||||||| |||||||| Sbjct: 16328758 ttgatgttcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttg 16328817 Query: 346 accctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaatt 405 |||||||| | ||| ||||||||||||||||| ||||||||| |||| | |||||||| Sbjct: 16328818 accctcctcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaata 16328877 Query: 406 cgggtagcatcctcacgtgggccactg 432 ||||| ||||||||||| ||||||||| Sbjct: 16328878 cgggtcgcatcctcacgagggccactg 16328904 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Plus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 16328560 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggc 16328608
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 222 bits (112), Expect = 7e-55 Identities = 183/207 (88%) Strand = Plus / Plus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||| Sbjct: 16418677 ctgttggatgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtc 16418736 Query: 286 ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 345 |||| || | ||| ||||||||||||||||||||||| || |||||||| |||||||| Sbjct: 16418737 ttgatgttcctgaaggcgctctccctggcaccagtggtgaggaggtagattgcctggttg 16418796 Query: 346 accctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaatt 405 |||||||| | ||| ||||||||||||||||| ||||||||| |||| | |||||||| Sbjct: 16418797 accctcctcaagggagagatatccacagcctgcctcctcacagcacccgcagacccaata 16418856 Query: 406 cgggtagcatcctcacgtgggccactg 432 ||||| ||||||||||| ||||||||| Sbjct: 16418857 cgggtcgcatcctcacgagggccactg 16418883 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Plus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 16418539 aacggttggccttggcaacacgctcgatctcatccttcttcttgatggc 16418587
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 184 bits (93), Expect = 2e-43 Identities = 179/208 (86%) Strand = Plus / Minus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| Sbjct: 27293 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 27234 Query: 286 ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 345 |||| || | || || ||||||||||| |||||||| || |||||||| |||||||| Sbjct: 27233 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 27174 Query: 346 accctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaatt 405 |||||||| | ||| ||||||||||||||||| ||||||||| | |||| || || || Sbjct: 27173 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 27114 Query: 406 cgggtagcatcctcacgtgggccactgt 433 ||||| || |||||||| ||||| |||| Sbjct: 27113 cgggttgcgtcctcacgcgggccgctgt 27086 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 27417 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 27369
>dbj|AP003727.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0672D08 Length = 173729 Score = 184 bits (93), Expect = 2e-43 Identities = 179/208 (86%) Strand = Plus / Minus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| Sbjct: 25095 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 25036 Query: 286 ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 345 |||| || | || || ||||||||||| |||||||| || |||||||| |||||||| Sbjct: 25035 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 24976 Query: 346 accctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaatt 405 |||||||| | ||| ||||||||||||||||| ||||||||| | |||| || || || Sbjct: 24975 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 24916 Query: 406 cgggtagcatcctcacgtgggccactgt 433 ||||| || |||||||| ||||| |||| Sbjct: 24915 cgggttgcgtcctcacgcgggccgctgt 24888 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 25219 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 25171
>dbj|AP008219.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, fosmid clone:OSJNOa264G09 Length = 31687 Score = 184 bits (93), Expect = 2e-43 Identities = 179/208 (86%) Strand = Plus / Minus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| Sbjct: 27293 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 27234 Query: 286 ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 345 |||| || | || || ||||||||||| |||||||| || |||||||| |||||||| Sbjct: 27233 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 27174 Query: 346 accctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaatt 405 |||||||| | ||| ||||||||||||||||| ||||||||| | |||| || || || Sbjct: 27173 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 27114 Query: 406 cgggtagcatcctcacgtgggccactgt 433 ||||| || |||||||| ||||| |||| Sbjct: 27113 cgggttgcgtcctcacgcgggccgctgt 27086 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 27417 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 27369
>dbj|AP003610.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0402A09 Length = 141966 Score = 184 bits (93), Expect = 2e-43 Identities = 179/208 (86%) Strand = Plus / Minus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| Sbjct: 12223 ctgttggatgagcccttggcggcattgatgagctcatcagcaaggcactcagcaatggtc 12164 Query: 286 ttgacattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttc 345 |||| || | || || ||||||||||| |||||||| || |||||||| |||||||| Sbjct: 12163 ttgatgttcctaaaggcactctccctggcgccagtggtgaggaggtagattgcctggttg 12104 Query: 346 accctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaatt 405 |||||||| | ||| ||||||||||||||||| ||||||||| | |||| || || || Sbjct: 12103 accctcctcaagggagagatatccacagcctgcctcctcacagcgccagcagagccgata 12044 Query: 406 cgggtagcatcctcacgtgggccactgt 433 ||||| || |||||||| ||||| |||| Sbjct: 12043 cgggttgcgtcctcacgcgggccgctgt 12016 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| ||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 12347 aacggttcgccttggcaacacgctcaatctcatccttcttcttgatggc 12299
>gb|AY674223.1| Ixodes pacificus clone IP_7_60_92_100_CLU 40S ribosomal protein S5 mRNA, complete cds Length = 630 Score = 165 bits (83), Expect = 2e-37 Identities = 155/179 (86%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | |||||||||||||||||||||||| ||||| Sbjct: 630 ttaacggttggacttggcgacacgctccagctcgtccttcttcttgatggcgtagctgtt 571 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| ||||||||||| |||||||| ||||| || || |||||||| ||||||||||||| Sbjct: 570 ggaagagcccttggcggcattgatgagctcgtccgccaggcactctgcaatggtcttgat 511 Query: 291 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccc 349 |||||||| |||||||||| ||||| ||| ||| || |||||||||||||||||| Sbjct: 510 gttacggaaggcgctctcccgtgcacccgtgcacagcagccagatggcctggttcaccc 452
>gb|AY547734.1| Ornithodoros moubata 40S ribosomal protein S5 mRNA, complete cds Length = 739 Score = 163 bits (82), Expect = 6e-37 Identities = 178/210 (84%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | ||||| |||||||||||||| || ||||| Sbjct: 658 ttaacggtttgacttggccacacgctccaattcgtctttcttcttgatggcatagctgtt 599 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 |||||||||||| ||||||||||| || || ||||| | |||||||||||||||||||| Sbjct: 598 ggatgagcccttagcagcattgatgagttcgtcagccaagcactcagcaatggtcttgat 539 Query: 291 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccct 350 || ||||| || ||||| | ||||||||| | ||||| ||||||||||||||||||| Sbjct: 538 gttgcggaaggcactctcgcgggcaccagtagaaagaagccagatggcctggttcaccct 479 Query: 351 cctgaggggggagatatccacagcctgtct 380 || || ||||| | ||||||||||||||| Sbjct: 478 ccgcagcggggatacatccacagcctgtct 449
>dbj|D29726.1|RICYK40 Oryza sativa mRNA, partial homologous to ribosomal protein S5 gene Length = 305 Score = 155 bits (78), Expect = 1e-34 Identities = 106/116 (91%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||| |||||||||||| | |||||||| ||||||||||||||||| || ||||||| Sbjct: 124 aacggttggccttggcaacangntcgatctcatccttcttcttgatggcatagctgttgg 65 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttg 288 ||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||| Sbjct: 64 atgagcccttggcggcattaataagctcgtcagcaaggcactcagcaatggtcttg 9
>ref|NM_112027.2| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN 5A); structural constituent of ribosome AT3G11940 (ATRPS5A) transcript variant AT3G11940.1 mRNA, complete cds Length = 1017 Score = 153 bits (77), Expect = 6e-34 Identities = 222/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 738 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 679 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 678 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 619 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 618 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 560 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||||||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 559 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 500 Query: 409 gtagcatcctcacgtgggccactgttga 436 |||||||| |||||||| |||||||||| Sbjct: 499 gtagcatcttcacgtggaccactgttga 472
>ref|NM_180233.1| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN 5A); structural constituent of ribosome AT3G11940 (ATRPS5A) transcript variant AT3G11940.2 mRNA, complete cds Length = 968 Score = 153 bits (77), Expect = 6e-34 Identities = 222/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 689 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 630 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 629 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 570 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 569 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 511 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||||||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 510 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 451 Query: 409 gtagcatcctcacgtgggccactgttga 436 |||||||| |||||||| |||||||||| Sbjct: 450 gtagcatcttcacgtggaccactgttga 423
>gb|AY091376.1| Arabidopsis thaliana putative 40S ribosomal protein S5 (At3g11940) mRNA, complete cds Length = 655 Score = 153 bits (77), Expect = 6e-34 Identities = 222/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 625 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 566 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 565 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 506 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 505 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 447 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||||||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 446 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 387 Query: 409 gtagcatcctcacgtgggccactgttga 436 |||||||| |||||||| |||||||||| Sbjct: 386 gtagcatcttcacgtggaccactgttga 359
>gb|AY045846.1| Arabidopsis thaliana putative 40S ribosomal protein S5 (At3g11940) mRNA, complete cds Length = 931 Score = 153 bits (77), Expect = 6e-34 Identities = 222/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 689 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 630 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 629 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 570 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 569 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 511 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||||||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 510 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 451 Query: 409 gtagcatcctcacgtgggccactgttga 436 |||||||| |||||||| |||||||||| Sbjct: 450 gtagcatcttcacgtggaccactgttga 423
>emb|BX822599.1|CNS0A75J Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB51ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 894 Score = 153 bits (77), Expect = 6e-34 Identities = 222/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 675 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 616 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 615 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 556 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 555 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 497 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||||||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 496 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 437 Query: 409 gtagcatcctcacgtgggccactgttga 436 |||||||| |||||||| |||||||||| Sbjct: 436 gtagcatcttcacgtggaccactgttga 409
>emb|BX824143.1|CNS0A6QW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH25ZG01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 800 Score = 153 bits (77), Expect = 6e-34 Identities = 222/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 688 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 629 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 628 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 569 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 568 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 510 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||||||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 509 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 450 Query: 409 gtagcatcctcacgtgggccactgttga 436 |||||||| |||||||| |||||||||| Sbjct: 449 gtagcatcttcacgtggaccactgttga 422
>gb|AY086938.1| Arabidopsis thaliana clone 29782 mRNA, complete sequence Length = 860 Score = 153 bits (77), Expect = 6e-34 Identities = 222/268 (82%), Gaps = 2/268 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 738 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 679 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 678 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 619 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 618 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 560 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||||||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 559 cgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaattctg 500 Query: 409 gtagcatcctcacgtgggccactgttga 436 |||||||| |||||||| |||||||||| Sbjct: 499 gtagcatcttcacgtggaccactgttga 472
>gb|DQ066208.1| Ixodes scapularis isolate ISUFL41 40S ribosomal protein S5 mRNA, complete cds Length = 630 Score = 149 bits (75), Expect = 9e-33 Identities = 153/179 (85%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | ||||||||||||||||||||| || ||||| Sbjct: 630 ttaacggttggacttggcgacacgctccagctcgtccttcttcttgatggcatagctgtt 571 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| ||||||||||| |||||||| ||||| || || |||||||||||||||||||||| Sbjct: 570 ggaagagcccttggcggcattgatgagctcgtccgccaggcactcagcaatggtcttgat 511 Query: 291 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccc 349 |||||||| |||||||| | || || ||| ||| || |||||||||||||||||| Sbjct: 510 gttacggaaggcgctctcgcgtgcgcccgtgcacagcagccagatggcctggttcaccc 452
>ref|XM_958137.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S5 (NCU09475.1) partial mRNA Length = 582 Score = 141 bits (71), Expect = 2e-30 Identities = 116/131 (88%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | ||||||||||||||||| ||| |||||||||||||||||||| ||| Sbjct: 582 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 523 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| |||||| Sbjct: 522 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 463 Query: 291 attacggaaag 301 || ||||||| Sbjct: 462 gttgcggaaag 452
>ref|XM_329833.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S5 (NCU09475.1) partial mRNA Length = 582 Score = 141 bits (71), Expect = 2e-30 Identities = 116/131 (88%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | ||||||||||||||||| ||| |||||||||||||||||||| ||| Sbjct: 582 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 523 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| |||||| Sbjct: 522 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 463 Query: 291 attacggaaag 301 || ||||||| Sbjct: 462 gttgcggaaag 452
>emb|BX842597.1| Neurospora crassa DNA linkage group II BAC clone B22K18 Length = 75214 Score = 141 bits (71), Expect = 2e-30 Identities = 116/131 (88%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | ||||||||||||||||| ||| |||||||||||||||||||| ||| Sbjct: 73211 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 73152 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| |||||| Sbjct: 73151 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 73092 Query: 291 attacggaaag 301 || ||||||| Sbjct: 73091 gttgcggaaag 73081
>emb|BX842596.1| Neurospora crassa DNA linkage group II BAC clone B10K17 Length = 77292 Score = 141 bits (71), Expect = 2e-30 Identities = 116/131 (88%) Strand = Plus / Plus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | ||||||||||||||||| ||| |||||||||||||||||||| ||| Sbjct: 44634 ttaacggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagtt 44693 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| ||||||||||| || ||||||||||| |||||||||||||| ||||||| |||||| Sbjct: 44694 ggaggagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgac 44753 Query: 291 attacggaaag 301 || ||||||| Sbjct: 44754 gttgcggaaag 44764
>emb|AJ439528.1|PSP439528 Polytomella sp. 'Pringsheim 198.80' mRNA for 40S ribosomal protein s5 (rs5 gene) Length = 885 Score = 139 bits (70), Expect = 9e-30 Identities = 112/126 (88%) Strand = Plus / Minus Query: 177 gttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatga 236 ||||||||||||||| ||||||||||| ||||||||||| ||||| || |||||||| || Sbjct: 588 gttagccttggcaacgcgctcgatctcatccttcttcttaatggcatagctgttggagga 529 Query: 237 gcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacg 296 |||||||| ||||| || ||||||||||| | |||||||||||||||||||| ||||| Sbjct: 528 acccttggcggcattcatgagctcatcagccaagcactcagcaatggtcttgatgttacg 469 Query: 297 gaaagc 302 |||||| Sbjct: 468 gaaagc 463
>gb|AY785292.1| Callinectes sapidus receptor guanylyl cyclase (GC-YO1) mRNA, complete cds Length = 4010 Score = 137 bits (69), Expect = 3e-29 Identities = 174/209 (83%) Strand = Plus / Minus Query: 169 tcttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactg 228 ||||||||||| | ||| || || ||||| | |||||||||||||||||||||||| ||| Sbjct: 3943 tcttaacggttggactttgccacgcgctccagctcgtccttcttcttgatggcgtagctg 3884 Query: 229 ttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttg 288 ||||| |||||| ||| || ||||| ||||||||||| | |||||||| ||||||||| Sbjct: 3883 ttggaggagcccctggatgcgttgatgagctcatcagccaaacactcagcgatggtcttg 3824 Query: 289 acattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 | |||||||| || ||| | ||||| |||||||| || ||||||||||||| ||| Sbjct: 3823 atgttacggaaggcagcctcgcgagcaccggtggtcagcagccagatggcctggttgacc 3764 Query: 349 ctcctgaggggggagatatccacagcctg 377 ||||||||||| || | |||||||||||| Sbjct: 3763 ctcctgaggggcgacacatccacagcctg 3735
>emb|AM167929.1| Chlamydomonas sp. ICE-L mRNA for 40S ribosomal protein S5 (RPS5 gene) Length = 747 Score = 133 bits (67), Expect = 5e-28 Identities = 219/270 (81%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| ||||||||||||||||| | ||||||||||||||| || ||||||||||| Sbjct: 616 ttaacggttggccttggcaacacgctccagctcgtccttcttcttaatagcgtaactgtt 557 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| || ||||| || || |||| || ||| ||||| | ||||||||||| ||||||| Sbjct: 556 ggaagatcccttagcggcgttgaccaactcgtcagccaagcactcagcaacagtcttgat 497 Query: 291 attacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggttcaccct 350 | ||||| || ||| | |||||||||||| | ||| |||| |||||||| || | Sbjct: 496 gctgcggaatgcagcctcacgggcaccagtggtgatcaggaagatagcctggttgacacg 437 Query: 351 cctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgggt 410 | ||||||||||||||||||||||| | | |||||||| | || ||||| ||||| Sbjct: 436 gcgcaggggggagatatccacagcctggcggcggacaacaccggcggagccaatacgggt 377 Query: 411 agcatcctcacgtgggccactgttgatgat 440 ||||||||||| || |||||||||||||| Sbjct: 376 ggcatcctcacggggtccactgttgatgat 347
>emb|BX822969.1|CNS0A70I Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZF12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 807 Score = 131 bits (66), Expect = 2e-27 Identities = 217/265 (81%), Gaps = 2/265 (0%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 653 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 594 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 593 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 534 Query: 290 cattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcacc 348 || | |||||| ||| || | ||||||||||| | | | |||| |||||||| || Sbjct: 533 tgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggttaaca 475 Query: 349 ctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaattcgg 408 | || || || |||| ||| ||||| |||||||| |||||||||| || ||||||| | Sbjct: 474 cgtcttagaggagagaaatcaacagcttgtctcctaacaacaccagcagatccaattctg 415 Query: 409 gtagcatcctcacgtgggccactgt 433 |||||||| | |||||| ||||||| Sbjct: 414 gtagcatctttacgtggaccactgt 390
>emb|BX824064.1|CNS0A6PV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH19ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 802 Score = 119 bits (60), Expect = 8e-24 Identities = 105/120 (87%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 682 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 623 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||||||||||||||| || ||||||| Sbjct: 622 tggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtcttga 563
>ref|XM_747778.1| Aspergillus fumigatus Af293 40S ribosomal protein S5 (Afu1g15020) partial mRNA Length = 696 Score = 117 bits (59), Expect = 3e-23 Identities = 104/119 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 ||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||| Sbjct: 684 cttggcaacacgctcgagctcgtccttcttcttgatggcgtaagagttggagcttccctt 625 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaag 301 |||||| ||||| ||||| ||||| |||||||| |||||| |||||| |||||||||| Sbjct: 624 ggcagcgttgatgagctcttcagccaggcactcggcaatgctcttgatgttacggaaag 566
>gb|AY241965.1| Dermacentor variabilis 40S ribosomal protein S5 mRNA, complete cds Length = 756 Score = 117 bits (59), Expect = 3e-23 Identities = 104/119 (87%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||||| |||||||||||||||||| || || ||||| Sbjct: 679 ttaacggttggacttggccacacgctcgagctcgtccttcttcttgatcgcatagctgtt 620 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 ||||| |||||||| |||||||| ||||||||||| | |||||| |||||||| |||| Sbjct: 619 cgatgaacccttggctgcattgatgagctcatcagccaagcactcggcaatggttttga 561
>emb|Z99168.1|SPAC8C9 S.pombe chromosome I cosmid c8C9 Length = 36310 Score = 111 bits (56), Expect = 2e-21 Identities = 113/132 (85%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 |||||||||| ||||||||||||||| | ||| ||||||||||||||||||||| ||| Sbjct: 14883 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 14824 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| |||||||| ||||||||||| | || ||||| | ||| |||| ||||| |||||| Sbjct: 14823 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 14764 Query: 291 attacggaaagc 302 ||||||||||| Sbjct: 14763 gttacggaaagc 14752
>emb|AL360054.1|SPAC328 S.pombe chromosome I cosmid c328 Length = 25985 Score = 111 bits (56), Expect = 2e-21 Identities = 113/132 (85%) Strand = Plus / Plus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 |||||||||| ||||||||||||||| | ||| ||||||||||||||||||||| ||| Sbjct: 24717 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 24776 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| |||||||| ||||||||||| | || ||||| | ||| |||| ||||| |||||| Sbjct: 24777 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 24836 Query: 291 attacggaaagc 302 ||||||||||| Sbjct: 24837 gttacggaaagc 24848
>ref|NM_078658.2| Drosophila melanogaster Ribosomal protein S5a CG8922-RA (RpS5a), mRNA Length = 855 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||||||||| | |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 740 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 681 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||| ||||||||||||||||| |||||||| || |||||||||| Sbjct: 680 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 621
>gb|AY075368.1| Drosophila melanogaster GM13047 full length cDNA Length = 873 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||||||||| | |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 740 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 681 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||| ||||||||||||||||| |||||||| || |||||||||| Sbjct: 680 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 621
>ref|NM_001019702.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC8C9.08), partial mRNA Length = 612 Score = 111 bits (56), Expect = 2e-21 Identities = 113/132 (85%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 |||||||||| ||||||||||||||| | ||| ||||||||||||||||||||| ||| Sbjct: 612 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 553 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| |||||||| ||||||||||| | || ||||| | ||| |||| ||||| |||||| Sbjct: 552 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 493 Query: 291 attacggaaagc 302 ||||||||||| Sbjct: 492 gttacggaaagc 481
>ref|NM_001019635.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC328.10c), partial mRNA Length = 612 Score = 111 bits (56), Expect = 2e-21 Identities = 113/132 (85%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 |||||||||| ||||||||||||||| | ||| ||||||||||||||||||||| ||| Sbjct: 612 ttaacggttactcttggcaacacgctcaagctcatccttcttcttgatggcgtaagagtt 553 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgac 290 ||| |||||||| ||||||||||| | || ||||| | ||| |||| ||||| |||||| Sbjct: 552 ggaagagcccttagcagcattgatgatttcttcagccaagcattcagaaatggacttgac 493 Query: 291 attacggaaagc 302 ||||||||||| Sbjct: 492 gttacggaaagc 481
>emb|BX822925.1|CNS0A746 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB73ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 752 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| || |||| Sbjct: 630 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggcatagctgt 571 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| ||||||||||| || ||||||| |||||||| ||||||||||| || ||||||| Sbjct: 570 tggaagagcccttggctgcgttgatcaattcatcagcgaggcactcagctatagtcttga 511
>gb|U48394.1|DMU48394 Drosophila melanogaster ribosomal protein S5 homolog (M(1)15D) mRNA, complete cds Length = 860 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||||||||| | |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 744 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 685 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||| ||||||||||||||||| |||||||| || |||||||||| Sbjct: 684 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 625
>gb|AY837869.1| Trichoplusia ni ribosomal protein S5 mRNA, complete cds Length = 782 Score = 109 bits (55), Expect = 8e-21 Identities = 103/119 (86%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | ||| ||||||||||| | ||| ||||||||||||||||||||| ||| Sbjct: 696 ttaacggttggacttagcaacacgctccaactcatccttcttcttgatggcgtaagagtt 637 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 ||||| ||||| ||||| ||||| ||||| ||||||| ||||||||||||||||||| Sbjct: 636 tgatgaacccttagcagcgttgatgagctcgtcagcaacacactcagcaatggtcttga 578
>ref|XM_386195.1| Gibberella zeae PH-1 chromosome 3 RS5_CICAR 40S RIBOSOMAL PROTEIN S5 (FG06019.1) partial mRNA Length = 546 Score = 107 bits (54), Expect = 3e-20 Identities = 135/162 (83%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||| |||||||||||||| |||||| |||| || ||||| Sbjct: 534 cttggccacacgctccaactcatccttcttcttgatagcgtaagagttgctggaaccctt 475 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaagc 302 |||||| ||||| ||||| |||||||||||||| ||||||| ||||||||| ||||||| Sbjct: 474 ggcagcgttgataagctcctcagcaaggcactcggcaatggacttgacattgcggaaaga 415 Query: 303 gctctccctggcaccagtggtcagaaggtagatggcctggtt 344 | ||| | |||||||||||| || || |||| |||||||| Sbjct: 414 ggcctcgcgggcaccagtggtgaggagagagatagcctggtt 373
>ref|XM_512950.1| PREDICTED: Pan troglodytes similar to ribosomal protein S5; 40S ribosomal protein S5 (LOC456347), mRNA Length = 678 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 614 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 555 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 554 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 510 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 465 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 418
>gb|BC015405.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone MGC:21949 IMAGE:4390892), complete cds Length = 743 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 663 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 604 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 603 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 559 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 514 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 467
>gb|BC004392.1| Homo sapiens cDNA clone IMAGE:3635299, **** WARNING: chimeric clone **** Length = 4791 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 1811 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 1870 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 1871 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 1915 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Plus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 1960 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 2007
>gb|BC015589.2| Homo sapiens cDNA clone IMAGE:4643450, partial cds Length = 1512 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 108 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 167 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 168 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 212 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Plus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 257 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 304
>gb|BC011718.1| Homo sapiens cDNA clone IMAGE:4099312, **** WARNING: chimeric clone **** Length = 3787 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 1688 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 1747 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 1748 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 1792 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Plus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 1837 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 1884
>ref|NM_001009.3| Homo sapiens ribosomal protein S5 (RPS5), mRNA Length = 755 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 675 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 616 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 615 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 571 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 526 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 479
>emb|CR625375.1| full-length cDNA clone CS0DI026YC20 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 714 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 650 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 591 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 590 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 546 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 501 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 454
>emb|CR619033.1| full-length cDNA clone CS0DK007YN14 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 537 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 471 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 412 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 411 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 367 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 322 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 275
>emb|CR614318.1| full-length cDNA clone CS0DI033YI16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1520 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 1452 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 1393 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 1392 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 1348 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 1303 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 1256
>emb|CR605125.1| full-length cDNA clone CS0DM009YE02 of Fetal liver of Homo sapiens (human) Length = 720 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 656 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 597 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 596 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 552 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 507 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 460
>emb|CR606098.1| full-length cDNA clone CS0DK012YE07 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 716 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 654 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 595 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 594 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 550 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 505 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 458
>emb|CR593754.1| full-length cDNA clone CS0DI002YN03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 354 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 290 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 231 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 230 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 186 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 141 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 94
>gb|AY891473.1| Synthetic construct Homo sapiens clone FLH027247.01L ribosomal protein S5 (RPS5) mRNA, partial cds Length = 615 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 603 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 544 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 543 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 499 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 454 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 407
>gb|AY888836.1| Synthetic construct Homo sapiens clone FLH027250.01X ribosomal protein S5 (RPS5) mRNA, complete cds Length = 615 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 603 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 544 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 543 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 499 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 454 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 407
>gb|BC018151.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone MGC:9774 IMAGE:3856663), complete cds Length = 797 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 650 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 591 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 590 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 546 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 501 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 454
>gb|BC035830.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone IMAGE:5581961) Length = 740 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 663 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 604 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 603 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 559 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 514 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 467
>gb|BC018828.2| Homo sapiens ribosomal protein S5, mRNA (cDNA clone IMAGE:3343539) Length = 764 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 661 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 602 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 601 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 557 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 512 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 465
>gb|U14970.1|HSU14970 Human ribosomal protein S5 mRNA, complete cds Length = 705 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||||||||||| ||||| || ||| || |||||||| Sbjct: 640 cttggccacacgctccagctcgtccttcttcttaatggcataggagttcgaggagccctt 581 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 580 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 536 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 491 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 444
>ref|NM_129283.2| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROTEIN 5B); structural constituent of ribosome AT2G37270 (ATRPS5B) transcript variant AT2G37270.1 mRNA, complete cds Length = 910 Score = 103 bits (52), Expect = 5e-19 Identities = 103/120 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || |||| Sbjct: 725 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 666 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||||||||| || |||||||||||||||||||| || ||||||| Sbjct: 665 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 606
>ref|NM_001036425.1| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROTEIN 5B); structural constituent of ribosome AT2G37270 (ATRPS5B) transcript variant AT2G37270.2 mRNA, complete cds Length = 991 Score = 103 bits (52), Expect = 5e-19 Identities = 103/120 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || |||| Sbjct: 786 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 727 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||||||||| || |||||||||||||||||||| || ||||||| Sbjct: 726 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 667
>gb|AY498744.1| Capsicum annuum 40S ribosomal protein S5 (RpS5) mRNA, complete cds Length = 853 Score = 103 bits (52), Expect = 5e-19 Identities = 192/239 (80%) Strand = Plus / Minus Query: 199 atctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagc 258 ||||| ||||||||||| ||||| || || || || || || || ||||||||||| || Sbjct: 649 atctcatccttcttcttaatggcatagctatttgaagaacctttagcagcattgatgagt 590 Query: 259 tcatcagcaaggcactcagcaatggtcttgacattacggaaagcgctctccctggcacca 318 |||||||||||||| |||||||||||||||| || | |||||| ||||| | |||||| Sbjct: 589 tcatcagcaaggcattcagcaatggtcttgatgttcctgaaagcactctcacgagcacca 530 Query: 319 gtggtcagaaggtagatggcctggttcaccctcctgaggggggagatatccacagcctgt 378 || ||||| | ||||| |||||||| || | | ||||| || ||||||||||| || Sbjct: 529 gttgtcagcaaatagattgcctggttaacacggcgaaggggagaaatatccacagcttga 470 Query: 379 ctcctcacaacaccagntgacccaattcgggtagcatcctcacgtgggccactgttgat 437 | || |||||||||| ||| ||||| || |||||||| || | ||| ||||||||||| Sbjct: 469 cgtctgacaacaccagctgaaccaatacgagtagcatcttcccttggcccactgttgat 411
>gb|AY081669.1| Arabidopsis thaliana 40S ribosomal protein S5 (At2g37270) mRNA, complete cds Length = 691 Score = 103 bits (52), Expect = 5e-19 Identities = 103/120 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || |||| Sbjct: 625 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 566 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||||||||| || |||||||||||||||||||| || ||||||| Sbjct: 565 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 506
>gb|AY059849.1| Arabidopsis thaliana 40S ribosomal protein S5 (At2g37270; F3G5.6) mRNA, complete cds Length = 856 Score = 103 bits (52), Expect = 5e-19 Identities = 103/120 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || |||| Sbjct: 722 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 663 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||||||||| || |||||||||||||||||||| || ||||||| Sbjct: 662 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 603
>gb|AY088613.1| Arabidopsis thaliana clone 8397 mRNA, complete sequence Length = 839 Score = 103 bits (52), Expect = 5e-19 Identities = 103/120 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| || |||| Sbjct: 725 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggcatagctgt 666 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| ||||||||||| || |||||||||||||||||||| || ||||||| Sbjct: 665 tggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtcttga 606
>ref|XM_792179.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal protein S5 (LOC592668), mRNA Length = 663 Score = 101 bits (51), Expect = 2e-18 Identities = 90/103 (87%) Strand = Plus / Minus Query: 187 gcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggca 246 ||||||||||||| |||||||||||||||||| ||||| |||||| || |||||||| Sbjct: 647 gcaacacgctcgagctcgtccttcttcttgattgcgtacgagttggaggatcccttggcg 588 Query: 247 gcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||||| || |||||||| | ||||||||| |||||||||| Sbjct: 587 gcattgatgagttcatcagccaagcactcagcgatggtcttga 545
>emb|Y08860.1|NP40SRS5 N.plumbaginifolia mRNA for 40S ribosomal protein S5 Length = 653 Score = 101 bits (51), Expect = 2e-18 Identities = 102/119 (85%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 |||||| || ||||||||||| | ||| ||||| |||||||||||||| || || ||||| Sbjct: 466 ttaacgattggccttggcaaccctctcaatctcatccttcttcttgatagcatagctgtt 407 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 || || ||||||||||||||||| || ||||| |||||||| || ||||||||||||| Sbjct: 406 agaagatcccttggcagcattgatgagttcatctgcaaggcattctgcaatggtcttga 348
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 101 bits (51), Expect = 2e-18 Identities = 144/175 (82%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| || ||||| | |||||||||||||||||| |||||| || Sbjct: 1193522 cttatcggttagacttggcgactcgctcaagctcgtccttcttcttgatagcgtaagagt 1193463 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| | || ||||| ||||| |||||||| ||||||||||||||||||| Sbjct: 1193462 tggaagaaccctttccggcgttgatgagctcctcagcaagacactcagcaatggtcttga 1193403 Query: 290 cattacggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggtt 344 || ||||||||| ||| | |||||| |||| || || ||||||||||||| Sbjct: 1193402 tgtttcggaaagcggcctctcgggcaccgatggtgagcagagagatggcctggtt 1193348
>ref|XM_505167.1| Yarrowia lipolytica CLIB122, YALI0F08569g predicted mRNA Length = 633 Score = 99.6 bits (50), Expect = 7e-18 Identities = 140/170 (82%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| || ||||| | |||||||||||||||||| |||||| |||||| Sbjct: 629 cggttagacttggcgactcgctcaagctcgtccttcttcttgatagcgtaagagttggaa 570 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 || ||||| | || ||||| ||||| |||||||| ||||||||||||||||||| || Sbjct: 569 gaaccctttccggcgttgatgagctcctcagcaagacactcagcaatggtcttgatgttt 510 Query: 295 cggaaagcgctctccctggcaccagtggtcagaaggtagatggcctggtt 344 ||||||||| ||| | |||||| |||| || || ||||||||||||| Sbjct: 509 cggaaagcggcctctcgggcaccgatggtgagcagagagatggcctggtt 460
>gb|AY190724.1| Pagrus major 40S ribosomal protein S5 mRNA, partial cds Length = 633 Score = 97.6 bits (49), Expect = 3e-17 Identities = 79/89 (88%) Strand = Plus / Minus Query: 201 ctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctc 260 |||||| ||||||||||||||||| ||| ||||| ||||| || |||||||||||||| Sbjct: 622 ctcgtctttcttcttgatggcgtaggagttagatgaacccttagctgcattgatcagctc 563 Query: 261 atcagcaaggcactcagcaatggtcttga 289 |||||| ||||||||||| |||||||||| Sbjct: 562 atcagccaggcactcagcgatggtcttga 534
>gb|AC016795.6|ATAC016795 Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence, complete sequence Length = 100835 Score = 97.6 bits (49), Expect = 3e-17 Identities = 170/208 (81%), Gaps = 2/208 (0%) Strand = Plus / Plus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||| ||||||||||| || ||||||| |||||||||||||||||||| || ||| Sbjct: 78840 ctgttggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtc 78899 Query: 286 ttgacattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggtt 344 |||| || | |||||| ||| || | ||||||||||| | | | |||| |||||||| Sbjct: 78900 ttgatgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggtt 78958 Query: 345 caccctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaat 404 || | || || || |||||||| ||||| |||||||| |||||||||| || ||||| Sbjct: 78959 aacacgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaat 79018 Query: 405 tcgggtagcatcctcacgtgggccactg 432 || ||||||||| |||||||| |||||| Sbjct: 79019 tctggtagcatcttcacgtggaccactg 79046 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| Sbjct: 78704 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggc 78755
>dbj|AK223106.1| Homo sapiens mRNA for ribosomal protein S5 variant, clone: KAT05451 Length = 820 Score = 97.6 bits (49), Expect = 3e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||||||| | ||||||| ||||||| ||||| || ||| || |||||||| Sbjct: 675 cttggccacacgctccagctcgtccctcttcttaatggcatagaagttcgaggagccctt 616 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 615 ggcagcattgatgagctcatctgccaggcactcagcaatggtctt 571 Score = 40.1 bits (20), Expect = 5.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtc 379 |||||||||||||||| | | |||||||| | |||||||||||||| Sbjct: 526 agatggcctggttcacacggcgcaggggggacacatccacagcctgtc 479
>gb|AC084495.1|CBRG10C24 Caenorhabditis briggsae cosmid G10C24, complete sequence Length = 21608 Score = 97.6 bits (49), Expect = 3e-17 Identities = 103/121 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||| | |||||| |||||||||| |||||||||||||||||||||||| |||| Sbjct: 8241 cttatcggttggacttggcgacacgctcgagctcgtccttcttcttgatggcgtagctgt 8182 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||| || ||||| || || ||||| || || ||||| | ||| ||||| |||||||||| Sbjct: 8181 tggaggatcccttagcggcgttgatgagttcgtcagccaagcattcagcgatggtcttga 8122 Query: 290 c 290 | Sbjct: 8121 c 8121
>dbj|AP002040.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEC18 Length = 80099 Score = 97.6 bits (49), Expect = 3e-17 Identities = 170/208 (81%), Gaps = 2/208 (0%) Strand = Plus / Plus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||| ||||||||||| || ||||||| |||||||||||||||||||| || ||| Sbjct: 12246 ctgttggaagagcccttggctgcgttgatcaattcatcagcaaggcactcagctatagtc 12305 Query: 286 ttgacattacggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggtt 344 |||| || | |||||| ||| || | ||||||||||| | | | |||| |||||||| Sbjct: 12306 ttgatgtttctgaaagcagct-tcacgagcaccagtggtaatcaagaagatagcctggtt 12364 Query: 345 caccctcctgaggggggagatatccacagcctgtctcctcacaacaccagntgacccaat 404 || | || || || |||||||| ||||| |||||||| |||||||||| || ||||| Sbjct: 12365 aacacgtcttagaggagagatatcaacagcttgtctcctaacaacaccagcagatccaat 12424 Query: 405 tcgggtagcatcctcacgtgggccactg 432 || ||||||||| |||||||| |||||| Sbjct: 12425 tctggtagcatcttcacgtggaccactg 12452 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| |||||||||||||| | || ||||| ||||||||||||||||| Sbjct: 12110 cttaacgattagccttggcaactctttcaatctcatccttcttcttgatggc 12161
>ref|XM_341788.2| PREDICTED: Rattus norvegicus ribosomal protein S5 (Rps5), mRNA Length = 722 Score = 95.6 bits (48), Expect = 1e-16 Identities = 108/128 (84%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || ||||||||||| || || |||||| Sbjct: 672 cggttagacttggccacacgctccagttcatctttcttcttgatagcataggagttggag 613 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| |||||||||||||| |||||||||| || Sbjct: 612 gagcccttggcagcattaatgagctcatctgcaaggcactcagcgatggtcttgatgttc 553 Query: 295 cggaaagc 302 |||||||| Sbjct: 552 cggaaagc 545
>ref|XM_528175.1| PREDICTED: Pan troglodytes similar to ribosomal protein S5; 40S ribosomal protein S5 (LOC472803), mRNA Length = 534 Score = 93.7 bits (47), Expect = 5e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||| ||| | |||||||||||||||||| || || |||||| |||||||| Sbjct: 522 cttggccacacactcaagctcgtccttcttcttgatagcataggagttggaggagccctt 463 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 ||||||| |||| |||||||| || ||| |||||||||||||||||| Sbjct: 462 ggcagcactgatgagctcatctgccaggaactcagcaatggtcttga 416
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 93.7 bits (47), Expect = 5e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 ||||||||||||||| | ||||||||||||||||||||| || ||| || ||||| Sbjct: 3246033 cttggcaacacgctcaagctcgtccttcttcttgatggcataggagttcgagcttccctt 3246092 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacggaaag 301 |||||| ||||| ||||| ||||| ||||||||||||||| |||||| |||||||||| Sbjct: 3246093 ggcagcgttgataagctcttcagcgaggcactcagcaatgctcttgatgttacggaaag 3246151
>emb|BX820728.1|CNS0A81J Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH63ZG02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 797 Score = 93.7 bits (47), Expect = 5e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 199 atctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagc 258 ||||| || |||||||||||||| || |||||||| || ||||| ||||||||||| || Sbjct: 654 atctcatctttcttcttgatggcatagctgttggaagatccctttgcagcattgatgagt 595 Query: 259 tcatcagcaaggcactcagcaatggtcttga 289 |||||||||||||||||||| || ||||||| Sbjct: 594 tcatcagcaaggcactcagcgattgtcttga 564
>emb|Z68751.1|CET05E11 Caenorhabditis elegans Cosmid T05E11, complete sequence Length = 24554 Score = 91.7 bits (46), Expect = 2e-15 Identities = 100/118 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||| | |||||| |||||||||| ||| |||||||||||||| ||||| |||| Sbjct: 6863 cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 6922 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||| || |||||||| || ||||| ||||||||||| | ||| || || |||||||| Sbjct: 6923 tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 6980
>ref|NM_069676.2| Caenorhabditis elegans Ribosomal Protein, Small subunit family member (rps-5) (rps-5) mRNA, complete cds Length = 755 Score = 91.7 bits (46), Expect = 2e-15 Identities = 100/118 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||| | |||||| |||||||||| ||| |||||||||||||| ||||| |||| Sbjct: 642 cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 583 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||| || |||||||| || ||||| ||||||||||| | ||| || || |||||||| Sbjct: 582 tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 525
>gb|BC059443.1| Danio rerio ribosomal protein S5, mRNA (cDNA clone MGC:73068 IMAGE:4145464), complete cds Length = 742 Score = 89.7 bits (45), Expect = 7e-15 Identities = 173/213 (81%), Gaps = 2/213 (0%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| || | ||| | ||| || |||||||||||||||||| |||||| Sbjct: 637 cggttagacttggccactctctccagctcatctttcttcttgatggcgtaagagttggag 578 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 || ||||||||||| ||||| ||||| |||||||| ||||| || |||||||||| || Sbjct: 577 gaacccttggcagcgttgatgagctcgtcagcaagacactctgcgatggtcttgatgttc 518 Query: 295 cggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcct 353 | |||||| ||| || || ||||||||| || || ||||||||||||| || || | Sbjct: 517 ctgaaagcagct-tctcttgcaccagtgcagagcagccagatggcctggttgactctgcg 459 Query: 354 gaggggggagatatccacagcctgtctcctcac 386 |||||||| | ||| ||||||||||||||||| Sbjct: 458 caggggggacacatcaacagcctgtctcctcac 426 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 415 tcctcacgtgggccactgttgatgat 440 |||||||| ||||||||||||||||| Sbjct: 397 tcctcacgagggccactgttgatgat 372
>ref|XM_856770.1| PREDICTED: Canis familiaris similar to ribosomal protein S5, transcript variant 5 (LOC476366), mRNA Length = 793 Score = 89.7 bits (45), Expect = 7e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||||| |||||| ||||| || | ||| |||||||||||||| || || |||| Sbjct: 740 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 681 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 | ||||||||||| |||||||| |||||||| || |||||||||||||| ||||||| Sbjct: 680 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 624
>ref|XM_856740.1| PREDICTED: Canis familiaris similar to ribosomal protein S5, transcript variant 4 (LOC476366), mRNA Length = 680 Score = 89.7 bits (45), Expect = 7e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||||| |||||| ||||| || | ||| |||||||||||||| || || |||| Sbjct: 649 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 590 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 | ||||||||||| |||||||| |||||||| || |||||||||||||| ||||||| Sbjct: 589 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 533
>ref|XM_856714.1| PREDICTED: Canis familiaris similar to ribosomal protein S5, transcript variant 3 (LOC476366), mRNA Length = 678 Score = 89.7 bits (45), Expect = 7e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||||| |||||| ||||| || | ||| |||||||||||||| || || |||| Sbjct: 626 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 567 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 | ||||||||||| |||||||| |||||||| || |||||||||||||| ||||||| Sbjct: 566 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 510
>ref|XM_856685.1| PREDICTED: Canis familiaris similar to ribosomal protein S5, transcript variant 2 (LOC476366), mRNA Length = 507 Score = 89.7 bits (45), Expect = 7e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||||| |||||| ||||| || | ||| |||||||||||||| || || |||| Sbjct: 455 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 396 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 | ||||||||||| |||||||| |||||||| || |||||||||||||| ||||||| Sbjct: 395 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 339
>ref|XM_533568.2| PREDICTED: Canis familiaris similar to ribosomal protein S5, transcript variant 1 (LOC476366), mRNA Length = 724 Score = 89.7 bits (45), Expect = 7e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 173 aacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttgg 232 ||||||||| |||||| ||||| || | ||| |||||||||||||| || || |||| Sbjct: 671 aacggttagacttggccacacgttccagctcatccttcttcttgatagcataggaattgg 612 Query: 233 atgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 | ||||||||||| |||||||| |||||||| || |||||||||||||| ||||||| Sbjct: 611 aagagcccttggctgcattgatgagctcatctgctaggcactcagcaatagtcttga 555
>emb|AL050331.11|HSDJ486I3 Human DNA sequence from clone RP3-486I3 on chromosome 6q22.1-22.3 Contains the 3' end of a novel gene, a novel gene, the gene for KIAA0721 (NAP (Nucleosome Assembly Protein) domain containing protein), a novel gene, an RPS5 (40S Ribosomal Protein S5) pseudogene, the TSPYL gene for TSPY-like (testis specific protein, Y-linked like), the 5' end of a novel gene, the 5' end of the SART gene for squamous cell carcinoma antigen recognised by T cell and two CpG islands, complete sequence Length = 118327 Score = 89.7 bits (45), Expect = 7e-15 Identities = 75/85 (88%) Strand = Plus / Plus Query: 203 cgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcat 262 ||||||||||||| ||||| || |||||| |||||||||||||||||||| ||||| | Sbjct: 85976 cgtccttcttcttaatggcataggagttggaggagcccttggcagcattgatgagctcct 86035 Query: 263 cagcaaggcactcagcaatggtctt 287 | || |||||||||||||||||||| Sbjct: 86036 ctgccaggcactcagcaatggtctt 86060
>ref|NG_000896.1| Homo sapiens ribosomal protein S5 pseudogene 1 (RPS5P1) on chromosome 6 Length = 823 Score = 89.7 bits (45), Expect = 7e-15 Identities = 75/85 (88%) Strand = Plus / Plus Query: 203 cgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcat 262 ||||||||||||| ||||| || |||||| |||||||||||||||||||| ||||| | Sbjct: 141 cgtccttcttcttaatggcataggagttggaggagcccttggcagcattgatgagctcct 200 Query: 263 cagcaaggcactcagcaatggtctt 287 | || |||||||||||||||||||| Sbjct: 201 ctgccaggcactcagcaatggtctt 225
>gb|AY650305.1| Macaca fascicularis ribosomal protein S5 mRNA, partial cds Length = 501 Score = 87.7 bits (44), Expect = 3e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 228 gttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||| |||||||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 492 gttggaggagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtctt 433
>ref|XM_518704.1| PREDICTED: Pan troglodytes similar to KIAA0721 protein (LOC462956), mRNA Length = 1755 Score = 87.7 bits (44), Expect = 3e-14 Identities = 74/84 (88%) Strand = Plus / Minus Query: 204 gtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcatc 263 |||||||||||| ||||| || |||||| |||||||||||||||||||| ||||| || Sbjct: 300 gtccttcttcttaatggcataggagttggaggagcccttggcagcattgatgagctcctc 241 Query: 264 agcaaggcactcagcaatggtctt 287 || |||||||||||||||||||| Sbjct: 240 tgccaggcactcagcaatggtctt 217
>gb|BC058690.1| Mus musculus ribosomal protein S5, mRNA (cDNA clone MGC:63220 IMAGE:6814814), complete cds Length = 749 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 671 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 612 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 611 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 552 Query: 295 cggaaagc 302 |||||||| Sbjct: 551 cggaaagc 544
>emb|Y12431.1|MMRPS5 M.musculus mRNA for ribosomal protein S5 Length = 715 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 666 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 607 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 606 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 547 Query: 295 cggaaagc 302 |||||||| Sbjct: 546 cggaaagc 539
>dbj|AK152449.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830072L04 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK167533.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched library, clone:I530018P15 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK164079.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:C530002K11 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK160552.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410046M18 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK168106.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730057M01 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK168044.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched library, clone:I730048N14 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK169016.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920075A20 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK172446.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830207P21 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK020477.1| Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430066A13 product:ribosomal protein S5, full insert sequence Length = 732 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 683 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 624 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 623 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 564 Query: 295 cggaaagc 302 |||||||| Sbjct: 563 cggaaagc 556
>dbj|AK010681.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410046E20 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK009663.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, clone:2310037J07 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK050622.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:C920021L03 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK050611.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:C920016K09 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK012481.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700063O13 product:ribosomal protein S5, full insert sequence Length = 733 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK012424.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700054J16 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK002235.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610006D06 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>dbj|AK020754.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430101M19 product:ribosomal protein S5, full insert sequence Length = 731 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565 Query: 295 cggaaagc 302 |||||||| Sbjct: 564 cggaaagc 557
>gb|BC020401.1| Mus musculus ribosomal protein S5, mRNA (cDNA clone IMAGE:3963156) Length = 726 Score = 87.7 bits (44), Expect = 3e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 661 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 602 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || |||||||||| || Sbjct: 601 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 542 Query: 295 cggaaagc 302 |||||||| Sbjct: 541 cggaaagc 534
>ref|NM_001015531.1| Bos taurus ribosomal protein S5 (RPS5), mRNA Length = 714 Score = 85.7 bits (43), Expect = 1e-13 Identities = 97/115 (84%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| || ||||| | |||||||||||||||||||||||| ||||| Sbjct: 668 cggttagacttggccacgcgctccagctcgtccttcttcttgatggcgtaggaattggag 609 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||||| || || ||||| || ||||| || |||||||| ||||||||||||| Sbjct: 608 gagcccttagctgcgttgattagttcatccgccaggcactcggcaatggtcttga 554
>gb|AY194365.1| Vitis vinifera putative 40S ribosomal protein S5 (Rps5) mRNA, partial cds Length = 661 Score = 85.7 bits (43), Expect = 1e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 168 atcttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaact 227 |||| ||||||||||||||||||| ||||| ||| | ||||| |||||||||||||| || Sbjct: 461 atctcaacggttagccttggcaactcgctcaatcccatcctttttcttgatggcgtagct 402 Query: 228 gttggatgagccctt 242 ||||||||| ||||| Sbjct: 401 gttggatgaaccctt 387
>gb|AF517858.1| Griffithsia japonica isolate Gj431 40S ribosome protein S5 mRNA, complete cds Length = 889 Score = 85.7 bits (43), Expect = 1e-13 Identities = 97/115 (84%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 |||||||||||||| ||||| |||| |||||||||||||||||||||||| |||||| Sbjct: 602 cggttagccttggcgacacgttcgacctcgtccttcttcttgatggcgtatgagttggag 543 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 || ||||| || || ||||| || || || || ||||| || ||||||||||||| Sbjct: 542 gatcccttcgccgcgttgatgagttcgtctgcgaggcattcggcaatggtcttga 488
>gb|AY857462.1| Suberites domuncula S5 mRNA, complete cds Length = 624 Score = 85.7 bits (43), Expect = 1e-13 Identities = 100/119 (84%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||||| |||||| ||||| || | ||| || |||||||| |||||||| || Sbjct: 624 ttaacggttagacttggctacacgttccagctcatctttcttctttatggcgtaggaatt 565 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||| ||||| ||||||||||| || ||||||||||| ||||| |||||| |||||| Sbjct: 564 ggatgaaccctttgcagcattgataagttcatcagcaagacactctgcaatgctcttga 506
>gb|BC102374.1| Bos taurus ribosomal protein S5, mRNA (cDNA clone MGC:127574 IMAGE:7951084), complete cds Length = 746 Score = 85.7 bits (43), Expect = 1e-13 Identities = 97/115 (84%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| || ||||| | |||||||||||||||||||||||| ||||| Sbjct: 685 cggttagacttggccacgcgctccagctcgtccttcttcttgatggcgtaggaattggag 626 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||||| || || ||||| || ||||| || |||||||| ||||||||||||| Sbjct: 625 gagcccttagctgcgttgattagttcatccgccaggcactcggcaatggtcttga 571
>gb|BT021032.1| Bos taurus ribosomal protein S5 (RPS5), mRNA, complete cds Length = 714 Score = 85.7 bits (43), Expect = 1e-13 Identities = 97/115 (84%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| || ||||| | |||||||||||||||||||||||| ||||| Sbjct: 668 cggttagacttggccacgcgctccagctcgtccttcttcttgatggcgtaggaattggag 609 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||||| || || ||||| || ||||| || |||||||| ||||||||||||| Sbjct: 608 gagcccttagctgcgttgattagttcatccgccaggcactcggcaatggtcttga 554
>ref|XM_751645.1| Ustilago maydis 521 hypothetical protein (UM00591.1) partial mRNA Length = 747 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Minus Query: 186 ggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggc 245 |||||||||||| |||||||| ||||||||||||||| |||||| ||||||||||| Sbjct: 732 ggcaacacgctccatctcgtcacgcttcttgatggcgtacgagttggacgagcccttggc 673 Query: 246 agcattgatcagctcatcagcaaggcactc 275 ||| ||||| ||||| ||||| |||||||| Sbjct: 672 agcgttgatgagctcgtcagcgaggcactc 643
>ref|NM_142150.2| Drosophila melanogaster Ribosomal protein S5b CG7014-RA (RpS5b), mRNA Length = 899 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || | |||||| || ||||| | |||||||||||||||||||||||| || Sbjct: 805 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 746 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 275 |||| || |||||||| || ||||||||||||||||| || ||||| Sbjct: 745 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 700
>gb|AY071138.1| Drosophila melanogaster RE17836 full length cDNA Length = 888 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || | |||||| || ||||| | |||||||||||||||||||||||| || Sbjct: 778 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 719 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 275 |||| || |||||||| || ||||||||||||||||| || ||||| Sbjct: 718 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 673
>gb|AC008136.4|AC008136 Drosophila melanogaster, chromosome 3R, region 88D-88E, BAC clone BACR08H11, complete sequence Length = 154890 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || | |||||| || ||||| | |||||||||||||||||||||||| || Sbjct: 88987 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 89046 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 275 |||| || |||||||| || ||||||||||||||||| || ||||| Sbjct: 89047 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 89092
>gb|AC005721.3|AC005721 Drosophila melanogaster, chromosome 3R, region 88D8-88E1, BAC clone BACR48E23, complete sequence Length = 203183 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || | |||||| || ||||| | |||||||||||||||||||||||| || Sbjct: 66606 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 66665 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 275 |||| || |||||||| || ||||||||||||||||| || ||||| Sbjct: 66666 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 66711
>gb|AE003706.5| Drosophila melanogaster chromosome 3R, section 44 of 118 of the complete sequence Length = 270961 Score = 83.8 bits (42), Expect = 4e-13 Identities = 90/106 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || | |||||| || ||||| | |||||||||||||||||||||||| || Sbjct: 203133 cttaacgattcgacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagt 203192 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactc 275 |||| || |||||||| || ||||||||||||||||| || ||||| Sbjct: 203193 tggaggatcccttggcggcgttgatcagctcatcagccagacactc 203238
>ref|NM_173232.1| Danio rerio ribosomal protein S5 (rps5), mRNA Length = 702 Score = 81.8 bits (41), Expect = 2e-12 Identities = 172/213 (80%), Gaps = 2/213 (0%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| || | ||| | ||| || |||||||||||||||||| |||| | Sbjct: 644 cggttagacttggccactctctccagctcatctttcttcttgatggcgtaagagttgtag 585 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 || ||||||||||| ||||| ||||| |||||||| ||||| || |||||||||| || Sbjct: 584 gaacccttggcagcgttgatgagctcgtcagcaagacactctgcgatggtcttgatgttc 525 Query: 295 cggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcct 353 | |||||| ||| || || ||||||||| || || ||||||||||||| || || | Sbjct: 524 ctgaaagcagct-tctcttgcaccagtgcagagcagccagatggcctggttgactctgcg 466 Query: 354 gaggggggagatatccacagcctgtctcctcac 386 |||||||| | ||| ||||||||||||||||| Sbjct: 465 caggggggacacatcaacagcctgtctcctcac 433 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 415 tcctcacgtgggccactgttgatgat 440 |||||||| ||||||||||||||||| Sbjct: 404 tcctcacgagggccactgttgatgat 379
>emb|AJ005346.1|CAA005346 Cicer arietinum mRNA for 40S ribosomal protein S5 Length = 724 Score = 81.8 bits (41), Expect = 2e-12 Identities = 67/76 (88%) Strand = Plus / Minus Query: 361 gagatatccacagcctgtctcctcacaacaccagntgacccaattcgggtagcatcctca 420 ||||||||||||||||||||||| ||||| |||| |||||||| || |||||||| ||| Sbjct: 405 gagatatccacagcctgtctccttacaactccagcagacccaatacgagtagcatcttca 346 Query: 421 cgtgggccactgttga 436 || || |||||||||| Sbjct: 345 cggggaccactgttga 330 Score = 56.0 bits (28), Expect = 1e-04 Identities = 91/112 (81%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 ||||||| || ||||| ||||| | ||| || || || || |||||||| || ||||||| Sbjct: 596 cttaacgatttgccttagcaactctctcaatttcatcttttttcttgattgcataactgt 537 Query: 230 tggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaat 281 ||||||| || || || ||||| || || ||||||||||| || |||||||| Sbjct: 536 tggatgaaccttttgctgcattaataagttcatcagcaagacattcagcaat 485
>gb|AF506223.1| Danio rerio 40S ribosomal protein S5 (rps5) mRNA, complete cds Length = 702 Score = 81.8 bits (41), Expect = 2e-12 Identities = 172/213 (80%), Gaps = 2/213 (0%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| || | ||| | ||| || |||||||||||||||||| |||| | Sbjct: 644 cggttagacttggccactctctccagctcatctttcttcttgatggcgtaagagttgtag 585 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 || ||||||||||| ||||| ||||| |||||||| ||||| || |||||||||| || Sbjct: 584 gaacccttggcagcgttgatgagctcgtcagcaagacactctgcgatggtcttgatgttc 525 Query: 295 cggaaagc-gctctccctggcaccagtggtcagaaggtagatggcctggttcaccctcct 353 | |||||| ||| || || ||||||||| || || ||||||||||||| || || | Sbjct: 524 ctgaaagcagct-tctcttgcaccagtgcagagcagccagatggcctggttgactctgcg 466 Query: 354 gaggggggagatatccacagcctgtctcctcac 386 |||||||| | ||| ||||||||||||||||| Sbjct: 465 caggggggacacatcaacagcctgtctcctcac 433 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 415 tcctcacgtgggccactgttgatgat 440 |||||||| ||||||||||||||||| Sbjct: 404 tcctcacgagggccactgttgatgat 379
>ref|XM_370161.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein (MG06658.4) partial mRNA Length = 564 Score = 79.8 bits (40), Expect = 7e-12 Identities = 91/108 (84%) Strand = Plus / Minus Query: 237 gcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacattacg 296 ||||||||| || ||||||| ||| ||||| | ||||||||| |||| |||||| || || Sbjct: 498 gcccttggcggcgttgatcaactcctcagccaagcactcagcgatggacttgacgttgcg 439 Query: 297 gaaagcgctctccctggcaccagtggtcagaaggtagatggcctggtt 344 ||||| | ||| | ||||||||||||||| ||| ||||||||||||| Sbjct: 438 gaaagaggcctcgcgggcaccagtggtcaggagggagatggcctggtt 391
>ref|XM_653355.1| Aspergillus nidulans FGSC A4 40S ribosomal protein S5 (AN0843.2), mRNA Length = 570 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 190 acacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagca 249 |||||||| | |||||||||||||||||| ||||| |||||| ||||||||| || Sbjct: 551 acacgctcaagctcgtccttcttcttgatagcgtaggagttggagctgcccttggcggcg 492 Query: 250 ttgatcagctcatcagcaaggcactcagcaatggtcttga 289 ||||| ||||| ||||||||||||||||| ||| |||||| Sbjct: 491 ttgataagctcctcagcaaggcactcagcgatgctcttga 452
>ref|NM_009095.1| Mus musculus ribosomal protein S5 (Rps5), mRNA Length = 763 Score = 79.8 bits (40), Expect = 7e-12 Identities = 106/128 (82%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 676 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 617 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || ||| |||||| || Sbjct: 616 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatgttcttgatgttc 557 Query: 295 cggaaagc 302 |||||||| Sbjct: 556 cggaaagc 549
>emb|X58465.1|RNRPS5 Rat mRNA for ribosomal protein S5 Length = 744 Score = 79.8 bits (40), Expect = 7e-12 Identities = 106/128 (82%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || ||||||||||| || || |||||| Sbjct: 683 cggttagacttggccacacgctccagttcatctttcttcttgatagcataggagttggag 624 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||| |||||| || |||||||| |||||||||||||| |||||||||| || Sbjct: 623 gagcccttgcgagcattaatgagctcatctgcaaggcactcagcgatggtcttgatgttc 564 Query: 295 cggaaagc 302 |||||||| Sbjct: 563 cggaaagc 556
>gb|U78085.1|MMU78085 Mus musculus ribosomal protein S5 mRNA, complete cds Length = 763 Score = 79.8 bits (40), Expect = 7e-12 Identities = 106/128 (82%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | || || |||||||||||||| || ||||| Sbjct: 676 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 617 Query: 235 gagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttgacatta 294 ||||||||||||||||| || |||||||| ||||||||||| || ||| |||||| || Sbjct: 616 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatgttcttgatgttc 557 Query: 295 cggaaagc 302 |||||||| Sbjct: 556 cggaaagc 549
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 77.8 bits (39), Expect = 3e-11 Identities = 63/71 (88%) Strand = Plus / Plus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | ||||||||||||||| ||||||||| |||||| Sbjct: 962752 cggttagacttggcgacacgctcaagctcgtccttcttcttaatggcgtaagagttggaa 962811 Query: 235 gagcccttggc 245 ||||||||||| Sbjct: 962812 gagcccttggc 962822
>ref|XM_567915.1| Cryptococcus neoformans var. neoformans JEC21 40s ribosomal protein s5-1 (CNK03230) partial mRNA Length = 889 Score = 77.8 bits (39), Expect = 3e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 175 cggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggat 234 ||||||| |||||| |||||||| | ||||||||||||||| ||||||||| |||||| Sbjct: 735 cggttagacttggcgacacgctcaagctcgtccttcttcttaatggcgtaagagttggaa 676 Query: 235 gagcccttggc 245 ||||||||||| Sbjct: 675 gagcccttggc 665
>gb|AC104212.3| Homo sapiens chromosome 8, clone RP11-941H19, complete sequence Length = 196806 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||| |||| ||| | |||||||||||||||| | || || |||||| |||||||| Sbjct: 155461 cttggccacacactcaagctcgtccttcttcttgctagcataggagttggaggagccctt 155402 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 | ||||| |||| |||||||| || ||| |||||||||||||||||| Sbjct: 155401 gacagcactgatgagctcatctgccaggaactcagcaatggtcttga 155355
>dbj|AB199894.1| Crassostrea gigas mRNA for ribosomal protein S5, complete cds Length = 674 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagccctt 242 |||||||||||| || | || ||||||||||||||||| | ||| || || ||||| Sbjct: 616 cttggcaacacgttccaattcatccttcttcttgatggcatgggagtttgaagatccctt 557 Query: 243 ggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 556 ggcagcattgatcagctcatcagccaaacactcagcaatagtcttga 510 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 415 tcctcacgtgggccactgttgatgat 440 |||||||| ||||||||||||||||| Sbjct: 384 tcctcacgggggccactgttgatgat 359
>gb|AY130369.1| Branchiostoma lanceolatum ribosomal protein S5 mRNA, partial cds Length = 533 Score = 77.8 bits (39), Expect = 3e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 205 tccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctcatca 264 |||||||||||||| ||||| |||||| || ||||||||||||||||| || |||||| Sbjct: 528 tccttcttcttgatagcgtaggagttggaggatcccttggcagcattgatgagttcatca 469 Query: 265 gcaaggcactcagcaatggtctt 287 || | |||||||||||| ||||| Sbjct: 468 gccaagcactcagcaatcgtctt 446 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 332 agatggcctggttcaccctcctgaggggggagatatccacagcctgtct 380 ||||||||||||| || |||||||| ||||| | |||||||||||||| Sbjct: 401 agatggcctggttgactctcctgagaggggacacgtccacagcctgtct 353
>gb|DQ440005.1| Aedes aegypti clone AE-198A ribosomal protein S5 mRNA, complete cds Length = 660 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 202 tcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctca 261 ||||||||||||||||||||||| |||||| || ||||| ||||| |||||||||||| Sbjct: 629 tcgtccttcttcttgatggcgtacgagttggaggatcccttagcagcgttgatcagctca 570 Query: 262 tcagcaaggcactcagcaatggtctt 287 ||||| | ||| || || |||||||| Sbjct: 569 tcagccaagcattcggcgatggtctt 544
>emb|BX059487.1|CNS09I2B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 75.8 bits (38), Expect = 1e-10 Identities = 80/94 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| ||||||||||||||| | ||| |||||||||||||||||||| || Sbjct: 750 cttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgtacgagt 691 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 690 tcgacgaacccttcgcggcgttgatcagctcatc 657
>emb|BX050132.1|CNS09AUG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 75.8 bits (38), Expect = 1e-10 Identities = 80/94 (85%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| ||||||||||||||| | ||| |||||||||||||||||||| || Sbjct: 726 cttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgtacgagt 667 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 666 tcgacgaacccttcgcggcgttgatcagctcatc 633
>emb|CR938304.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YD20AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 888 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 202 tcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctca 261 ||||||||||||||||||||||| |||||| || ||||| ||||| |||||||||||| Sbjct: 682 tcgtccttcttcttgatggcgtacgagttggaggatcccttagcagcgttgatcagctca 623 Query: 262 tcagcaaggcactcagcaatggtctt 287 ||||| | ||| || || |||||||| Sbjct: 622 tcagccaagcattcggcgatggtctt 597
>emb|CR938303.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 3-prime end of clone KW0AAA2YD20BBM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 796 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Plus Query: 202 tcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctca 261 ||||||||||||||||||||||| |||||| || ||||| ||||| |||||||||||| Sbjct: 187 tcgtccttcttcttgatggcgtacgagttggaggatcccttagcagcgttgatcagctca 246 Query: 262 tcagcaaggcactcagcaatggtctt 287 ||||| | ||| || || |||||||| Sbjct: 247 tcagccaagcattcggcgatggtctt 272
>emb|CR938121.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YJ20AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 717 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 202 tcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctca 261 ||||||||||||||||||||||| |||||| || ||||| ||||| |||||||||||| Sbjct: 682 tcgtccttcttcttgatggcgtacgagttggaggatcccttagcagcgttgatcagctca 623 Query: 262 tcagcaaggcactcagcaatggtctt 287 ||||| | ||| || || |||||||| Sbjct: 622 tcagccaagcattcggcgatggtctt 597
>gb|AY130451.1| Petromyzon marinus ribosomal protein S5 mRNA, partial cds Length = 555 Score = 75.8 bits (38), Expect = 1e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 190 acacgctcgatctcgtccttcttcttgatggcgtaactgttggatgagcccttggcagca 249 |||||||| | ||| || |||||| |||||||||| |||||| |||||||||||||| Sbjct: 548 acacgctccagctcatctttcttcctgatggcgtacgagttggaagagcccttggcagcg 489 Query: 250 ttgatcagctcatcagcaaggcactc 275 ||||| ||||||||||| |||||||| Sbjct: 488 ttgatgagctcatcagcgaggcactc 463
>gb|AF426408.1|AF426408 Drosophila virilis MEI-217 (mei-217) and MEI-218 (mei-218) genes, complete cds Length = 9598 Score = 73.8 bits (37), Expect = 4e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 169 tcttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactg 228 ||||||||||||| ||||||||||||||| | ||||| ||||||||||||||||| | Sbjct: 3264 tcttaacggttagacttggcaacacgctccaattcgtctttcttcttgatggcgtacgag 3205 Query: 229 ttggatgagccct 241 |||||||| |||| Sbjct: 3204 ttggatgaaccct 3192 Score = 46.1 bits (23), Expect = 0.096 Identities = 44/51 (86%) Strand = Plus / Minus Query: 239 ccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 ||||||| |||||||| |||||||| || | ||||| ||||||||||||| Sbjct: 2632 ccttggcggcattgatgagctcatcggccaaacactcggcaatggtcttga 2582
>gb|AC012313.7| Homo sapiens chromosome 19 clone CTD-2619J13, complete sequence Length = 185417 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 239 ccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 52803 ccttggcagcattgatgagctcatctgccaggcactcagcaatggtctt 52755 Score = 46.1 bits (23), Expect = 0.096 Identities = 35/39 (89%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggc 221 |||||| |||||||| | ||||||||||||||| ||||| Sbjct: 52945 cttggccacacgctccagctcgtccttcttcttaatggc 52907
>dbj|AB061853.2| Homo sapiens RPS5 gene for ribosomal protein S5, complete cds Length = 7444 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 239 ccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 6601 ccttggcagcattgatgagctcatctgccaggcactcagcaatggtctt 6553 Score = 46.1 bits (23), Expect = 0.096 Identities = 35/39 (89%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggc 221 |||||| |||||||| | ||||||||||||||| ||||| Sbjct: 6743 cttggccacacgctccagctcgtccttcttcttaatggc 6705
>dbj|AB209803.1| Homo sapiens mRNA for ribosomal protein S5 variant protein Length = 1745 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 239 ccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 1539 ccttggcagcattgatgagctcatctgccaggcactcagcaatggtctt 1491 Score = 46.1 bits (23), Expect = 0.096 Identities = 35/39 (89%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggc 221 |||||| |||||||| | ||||||||||||||| ||||| Sbjct: 1681 cttggccacacgctccagctcgtccttcttcttaatggc 1643
>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II, complete sequence Length = 867699 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 169 tcttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactg 228 ||||||||||| | ||||||||| | ||| | |||||||||||||||||||||||| | Sbjct: 723792 tcttaacggttggacttggcaactctctccaactcgtccttcttcttgatggcgtaggag 723733 Query: 229 ttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttg 288 |||| || ||||| || || ||||| ||||| ||||| | | |||||||||||||||| Sbjct: 723732 gtggaggaacccttagcggcgttgattagctcctcagccaaggtctcagcaatggtcttg 723673 Query: 289 a 289 | Sbjct: 723672 a 723672
>dbj|AB007149.1| Homo sapiens gene for ribosomal protein S5, partial cds Length = 291 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 239 ccttggcagcattgatcagctcatcagcaaggcactcagcaatggtctt 287 |||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 100 ccttggcagcattgatgagctcatctgccaggcactcagcaatggtctt 52 Score = 46.1 bits (23), Expect = 0.096 Identities = 35/39 (89%) Strand = Plus / Minus Query: 183 cttggcaacacgctcgatctcgtccttcttcttgatggc 221 |||||| |||||||| | ||||||||||||||| ||||| Sbjct: 242 cttggccacacgctccagctcgtccttcttcttaatggc 204
>gb|AC005896.3| Arabidopsis thaliana chromosome 2 clone F3G5 map ve018, complete sequence Length = 119001 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 226 ctgttggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtc 285 |||||||| || ||||| ||||||||||| || |||||||||||||||||||| || ||| Sbjct: 17246 ctgttggaagatccctttgcagcattgatgagttcatcagcaaggcactcagcgattgtc 17305 Query: 286 ttga 289 |||| Sbjct: 17306 ttga 17309 Score = 40.1 bits (20), Expect = 5.9 Identities = 44/52 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggc 221 ||||||| || ||||| ||||| | ||| ||||| || |||||||||||||| Sbjct: 17096 cttaacgattggccttagcaactctctcaatctcatctttcttcttgatggc 17147
>emb|AJ563480.1|CGI563480 Crassostrea gigas partial mRNA for ribosomal protein S5 (rps5 gene) Length = 628 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 238 cccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 ||||||||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 561 cccttggcagcattgatcagctcatcagccaaacactcagcaatagtcttga 510 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 415 tcctcacgtgggccactgttgatgat 440 |||||||| ||||||||||||||||| Sbjct: 384 tcctcacgggggccactgttgatgat 359
>emb|BX035842.1|CNS08ZTI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 69.9 bits (35), Expect = 7e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgta 224 |||| ||||||| ||||||||||||||| | ||| |||||||||||||||||||| Sbjct: 738 cttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgta 684
>gb|AF429979.1| Spodoptera frugiperda ribosomal protein S5 mRNA, complete cds Length = 732 Score = 69.9 bits (35), Expect = 7e-09 Identities = 92/111 (82%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | ||| ||||||||||| | ||| ||||||||||||||||| ||| ||| Sbjct: 696 ttaacggttggacttagcaacacgctccaactcatccttcttcttgatggcataagagtt 637 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaat 281 ||||| ||||| || || ||||| || |||||||| | ||||||||||| Sbjct: 636 tgatgaacccttcgctgcgttgataagttcatcagcgacacactcagcaat 586
>ref|NM_208472.1| Eremothecium gossypii ABR171Wp (ABR171W), mRNA Length = 678 Score = 69.9 bits (35), Expect = 7e-09 Identities = 98/119 (82%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | ||||||||| | ||| | |||||||||||||||||||||||| | | Sbjct: 678 ttaacggttggacttggcaactctctccaactcgtccttcttcttgatggcgtaggaggt 619 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 ||| || ||||| || || ||||| ||||| ||||| | | ||||||||||||||||| Sbjct: 618 ggaggaacccttagcggcgttgattagctcctcagccaaggtctcagcaatggtcttga 560
>emb|CT033676.1| Platynereis dumerilii EST IB0AAA16AH02EM1 Length = 687 Score = 69.9 bits (35), Expect = 7e-09 Identities = 98/119 (82%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | |||||||||||| ||||| ||||| || Sbjct: 632 ttaacggttggacttggcgacacgctccaactcgtccttctttttgatagcgtatgaatt 573 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||| |||||||| || ||||||||||| || || || ||||| || || ||||||| Sbjct: 572 ggatgatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttga 514
>emb|CT033675.1| Platynereis dumerilii EST IB0AAA16AH02FM1 Length = 687 Score = 69.9 bits (35), Expect = 7e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | |||||||||||| ||||| ||||| || Sbjct: 56 ttaacggttggacttggcgacacgctccaactcgtccttctttttgatagcgtatgaatt 115 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||| |||||||| || ||||||||||| || || || ||||| || || ||||||| Sbjct: 116 ggatgatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttga 174
>emb|CT033316.1| Platynereis dumerilii EST IB0AAA22CF06FM1 Length = 812 Score = 69.9 bits (35), Expect = 7e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | ||||||||| |||||||| ||||| || Sbjct: 73 ttaacggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaatt 132 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||| |||||||| || ||||||||||| || || || ||||| || || ||||||| Sbjct: 133 ggatgatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttga 191
>emb|CT032678.1| Platynereis dumerilii EST IB0AAA33CA06EM1 Length = 720 Score = 69.9 bits (35), Expect = 7e-09 Identities = 98/119 (82%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | ||||||||| |||||||| ||||| || Sbjct: 646 ttaacggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaatt 587 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||| |||||||| || ||||||||||| || || || ||||| || || ||||||| Sbjct: 586 ggatgatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttga 528
>emb|CT032568.1| Platynereis dumerilii EST IB0AAA36BC12EM1 Length = 704 Score = 69.9 bits (35), Expect = 7e-09 Identities = 98/119 (82%) Strand = Plus / Minus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | ||||||||| |||||||| ||||| || Sbjct: 632 ttaacggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaatt 573 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||| |||||||| || ||||||||||| || || || ||||| || || ||||||| Sbjct: 572 ggatgatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttga 514
>emb|CT032567.1| Platynereis dumerilii EST IB0AAA36BC12FM1 Length = 704 Score = 69.9 bits (35), Expect = 7e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 171 ttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgtt 230 ||||||||| | |||||| |||||||| | ||||||||| |||||||| ||||| || Sbjct: 73 ttaacggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaatt 132 Query: 231 ggatgagcccttggcagcattgatcagctcatcagcaaggcactcagcaatggtcttga 289 |||||| |||||||| || ||||||||||| || || || ||||| || || ||||||| Sbjct: 133 ggatgatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttga 191
>gb|AY826153.1| Aedes albopictus clone AL_39 ribosomal protein S5 mRNA, complete cds Length = 660 Score = 67.9 bits (34), Expect = 3e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 202 tcgtccttcttcttgatggcgtaactgttggatgagcccttggcagcattgatcagctca 261 ||||||||||||||||||||||| |||||| || ||||| || || |||||||||||| Sbjct: 629 tcgtccttcttcttgatggcgtacgagttggaggatcccttagcggcgttgatcagctca 570 Query: 262 tcagcaaggcactcagcaatggtctt 287 ||||| | ||| || || |||||||| Sbjct: 569 tcagccaagcattcggcgatggtctt 544
>emb|BX070858.1|CNS09QU6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8AF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 337 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 396 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 397 tcgacgaacccttcgcggcgttgatcagctcatc 430
>emb|BX069638.1|CNS09PWA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 323 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 382 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 383 tcgacgaacccttcgcggcgttgatcagctcatc 416
>emb|BX060986.1|CNS09J7Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 358 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 417 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 418 tcgacgaacccttcgcggcgttgatcagctcatc 451
>emb|BX060985.1|CNS09J7X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 692 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 633 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 632 tcgacgaacccttcgcggcgttgatcagctcatc 599
>emb|BX069150.1|CNS09PIQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 736 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 381 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 440 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 441 tcgacgaacccttcgcggcgttgatcagctcatc 474
>emb|BX069149.1|CNS09PIP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 737 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 678 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 677 tcgacgaacccttcgcggcgttgatcagctcatc 644
>emb|BX068414.1|CNS09OYA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 754 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 695 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 694 tcgacgaacccttcgcggcgttgatcagctcatc 661
>emb|BX067806.1|CNS09OHE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 367 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 426 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 427 tcgacgaacccttcgcggcgttgatcagctcatc 460
>emb|BX067805.1|CNS09OHD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1032 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 737 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 678 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 677 tcgacgaacccttcgcggcgttgatcagctcatc 644
>emb|BX067168.1|CNS09NZO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 613 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 401 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 460 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 461 tcgacgaacccttcgcggcgttgatcagctcatc 494
>emb|BX067167.1|CNS09NZN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 756 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 697 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 696 tcgacgaacccttcgcggcgttgatcagctcatc 663
>emb|BX066614.1|CNS09NKA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 381 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 440 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 441 tcgacgaacccttcgcggcgttgatcagctcatc 474
>emb|BX066613.1|CNS09NK9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 741 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 682 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 681 tcgacgaacccttcgcggcgttgatcagctcatc 648
>emb|BX066319.1|CNS09NC3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 738 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 679 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 678 tcgacgaacccttcgcggcgttgatcagctcatc 645
>emb|BX065223.1|CNS09MHN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 719 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 660 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 659 tcgacgaacccttcgcggcgttgatcagctcatc 626
>emb|BX064990.1|CNS09MB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 812 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 569 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 510 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 509 tcgacgaacccttcgcggcgttgatcagctcatc 476
>emb|BX064166.1|CNS09LOA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1044 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 738 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 679 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 678 tcgacgaacccttcgcggcgttgatcagctcatc 645
>emb|BX062350.1|CNS09K9U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 734 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 675 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 674 tcgacgaacccttcgcggcgttgatcagctcatc 641
>emb|BX061779.1|CNS09JTZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 733 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 674 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 673 tcgacgaacccttcgcggcgttgatcagctcatc 640
>emb|BX060576.1|CNS09IWK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 727 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 668 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 667 tcgacgaacccttcgcggcgttgatcagctcatc 634
>emb|BX060097.1|CNS09IJ9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643
>emb|BX059728.1|CNS09I90 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 351 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 410 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 411 tcgacgaacccttcgcggcgttgatcagctcatc 444
>emb|BX059727.1|CNS09I8Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 568 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 509 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 508 tcgacgaacccttcgcggcgttgatcagctcatc 475
>emb|BX059488.1|CNS09I2C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 656 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 383 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 442 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 443 tcgacgaacccttcgcggcgttgatcagctcatc 476
>emb|BX058348.1|CNS09H6O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 525 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 375 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 434 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 435 tcgacgaacccttcgcggcgttgatcagctcatc 468
>emb|BX055955.1|CNS09FC7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 476 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 341 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 400 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 401 tcgacgaacccttcgcggcgttgatcagctcatc 434
>emb|BX056006.1|CNS09FDM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 544 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 346 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 405 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 406 tcgacgaacccttcgcggcgttgatcagctcatc 439
>emb|BX055290.1|CNS09ETQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 330 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 389 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 390 tcgacgaacccttcgcggcgttgatcagctcatc 423
>emb|BX054593.1|CNS09EAD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 525 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 466 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 465 tcgacgaacccttcgcggcgttgatcagctcatc 432
>emb|BX054183.1|CNS09DYZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32BA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 381 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 440 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 441 tcgacgaacccttcgcggcgttgatcagctcatc 474
>emb|BX054182.1|CNS09DYY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 503 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 401 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 342 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 341 tcgacgaacccttcgcggcgttgatcagctcatc 308
>emb|BX054146.1|CNS09DXY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 702 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 643 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 642 tcgacgaacccttcgcggcgttgatcagctcatc 609
>emb|BX051928.1|CNS09C8C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC29CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643
>emb|BX050054.1|CNS09ASA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 794 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 604 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 545 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 544 tcgacgaacccttcgcggcgttgatcagctcatc 511
>emb|BX049760.1|CNS09AK4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 786 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 728 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 669 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 668 tcgacgaacccttcgcggcgttgatcagctcatc 635
>emb|BX030899.1|CNS08W07 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 740 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 681 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 680 tcgacgaacccttcgcggcgttgatcagctcatc 647
>emb|BX047653.1|CNS098XL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 739 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 680 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 679 tcgacgaacccttcgcggcgttgatcagctcatc 646
>emb|BX047407.1|CNS098QR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 319 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 378 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 379 tcgacgaacccttcgcggcgttgatcagctcatc 412
>emb|BX047406.1|CNS098QQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 701 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 642 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 641 tcgacgaacccttcgcggcgttgatcagctcatc 608
>emb|BX047180.1|CNS098KG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 568 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 509 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 508 tcgacgaacccttcgcggcgttgatcagctcatc 475
>emb|BX046292.1|CNS097VS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 737 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 678 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 677 tcgacgaacccttcgcggcgttgatcagctcatc 644
>emb|BX045880.1|CNS097KC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2AH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 634 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 326 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 385 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 386 tcgacgaacccttcgcggcgttgatcagctcatc 419
>emb|BX045879.1|CNS097KB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 662 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 603 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 602 tcgacgaacccttcgcggcgttgatcagctcatc 569
>emb|BX042957.1|CNS095B5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 399 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 458 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 459 tcgacgaacccttcgcggcgttgatcagctcatc 492
>emb|BX042956.1|CNS095B4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 760 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 701 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 700 tcgacgaacccttcgcggcgttgatcagctcatc 667
>emb|BX043656.1|CNS095UK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 741 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 682 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 681 tcgacgaacccttcgcggcgttgatcagctcatc 648
>emb|BX043117.1|CNS095FL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 636 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 365 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 424 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 425 tcgacgaacccttcgcggcgttgatcagctcatc 458
>emb|BX042340.1|CNS094U0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC14BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 558 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 369 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 428 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 429 tcgacgaacccttcgcggcgttgatcagctcatc 462
>emb|BX041676.1|CNS094BK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 379 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 438 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 439 tcgacgaacccttcgcggcgttgatcagctcatc 472
>emb|BX041675.1|CNS094BJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 827 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 728 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 669 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 668 tcgacgaacccttcgcggcgttgatcagctcatc 635
>emb|BX041951.1|CNS094J7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 778 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 391 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 450 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 451 tcgacgaacccttcgcggcgttgatcagctcatc 484
>emb|BX041207.1|CNS093YJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 692 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 357 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 416 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 417 tcgacgaacccttcgcggcgttgatcagctcatc 450
>emb|BX040008.1|CNS09318 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 374 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 433 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 434 tcgacgaacccttcgcggcgttgatcagctcatc 467
>emb|BX040007.1|CNS09317 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 743 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 684 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 683 tcgacgaacccttcgcggcgttgatcagctcatc 650
>emb|BX039701.1|CNS092SP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10AE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 741 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 682 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 681 tcgacgaacccttcgcggcgttgatcagctcatc 648
>emb|BX037484.1|CNS09134 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9DH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 357 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 416 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 417 tcgacgaacccttcgcggcgttgatcagctcatc 450
>emb|BX037483.1|CNS09133 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9DH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 727 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 668 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 667 tcgacgaacccttcgcggcgttgatcagctcatc 634
>emb|BX037292.1|CNS090XS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 691 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 632 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 631 tcgacgaacccttcgcggcgttgatcagctcatc 598
>emb|BX037168.1|CNS090UC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 370 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 429 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 430 tcgacgaacccttcgcggcgttgatcagctcatc 463
>emb|BX037167.1|CNS090UB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 776 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 717 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 716 tcgacgaacccttcgcggcgttgatcagctcatc 683
>emb|BX036321.1|CNS0906T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 378 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 437 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 438 tcgacgaacccttcgcggcgttgatcagctcatc 471
>emb|BX036320.1|CNS0906S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 782 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 723 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 722 tcgacgaacccttcgcggcgttgatcagctcatc 689
>emb|BX036089.1|CNS0900D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 343 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 402 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 403 tcgacgaacccttcgcggcgttgatcagctcatc 436
>emb|BX036088.1|CNS0900C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 569 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 510 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 509 tcgacgaacccttcgcggcgttgatcagctcatc 476
>emb|BX035877.1|CNS08ZUH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 395 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 454 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 455 tcgacgaacccttcgcggcgttgatcagctcatc 488
>emb|BX035876.1|CNS08ZUG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 748 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 689 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 688 tcgacgaacccttcgcggcgttgatcagctcatc 655
>emb|BX035843.1|CNS08ZTJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 379 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 438 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 439 tcgacgaacccttcgcggcgttgatcagctcatc 472
>emb|BX034797.1|CNS08Z0H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643
>emb|BX034367.1|CNS08YOJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1022 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 353 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 412 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 413 tcgacgaacccttcgcggcgttgatcagctcatc 446
>emb|BX034366.1|CNS08YOI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1068 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 748 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 689 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 688 tcgacgaacccttcgcggcgttgatcagctcatc 655
>emb|BX034032.1|CNS08YF8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 270 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 329 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 330 tcgacgaacccttcgcggcgttgatcagctcatc 363
>emb|BX034031.1|CNS08YF7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 593 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 534 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 533 tcgacgaacccttcgcggcgttgatcagctcatc 500
>emb|BX033399.1|CNS08XXN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 735 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 676 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 675 tcgacgaacccttcgcggcgttgatcagctcatc 642
>emb|BX032461.1|CNS08X7L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48BD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 757 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 387 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 446 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 447 tcgacgaacccttcgcggcgttgatcagctcatc 480
>emb|BX032460.1|CNS08X7K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48BD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 843 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 819 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 760 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 759 tcgacgaacccttcgcggcgttgatcagctcatc 726
>emb|BX032232.1|CNS08X18 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 384 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 74 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 133 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 134 tcgacgaacccttcgcggcgttgatcagctcatc 167
>emb|BX031884.1|CNS08WRK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643
>emb|BX031803.1|CNS08WPB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 375 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 434 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 435 tcgacgaacccttcgcggcgttgatcagctcatc 468
>emb|BX031740.1|CNS08WNK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 382 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 441 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 442 tcgacgaacccttcgcggcgttgatcagctcatc 475
>emb|BX031739.1|CNS08WNJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 736 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 677 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 676 tcgacgaacccttcgcggcgttgatcagctcatc 643
>emb|BX031421.1|CNS08WEP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 795 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Plus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 386 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 445 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 446 tcgacgaacccttcgcggcgttgatcagctcatc 479
>emb|BX031420.1|CNS08WEO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 67.9 bits (34), Expect = 3e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 170 cttaacggttagccttggcaacacgctcgatctcgtccttcttcttgatggcgtaactgt 229 |||| ||||||| |||||| |||||||| | ||| |||||||||||||||||||| || Sbjct: 744 cttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgagt 685 Query: 230 tggatgagcccttggcagcattgatcagctcatc 263 | || || ||||| || || |||||||||||||| Sbjct: 684 tcgacgaacccttcgcggcgttgatcagctcatc 651 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,781,136 Number of Sequences: 3902068 Number of extensions: 3781136 Number of successful extensions: 79320 Number of sequences better than 10.0: 473 Number of HSP's better than 10.0 without gapping: 467 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 78378 Number of HSP's gapped (non-prelim): 870 length of query: 440 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 418 effective length of database: 17,147,199,772 effective search space: 7167529504696 effective search space used: 7167529504696 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
