ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags25d15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT008930.1| Triticum aestivum clone wde1f.pk003.h2:fis, full ... 96 4e-17
2gb|AC140237.4| Mus musculus BAC clone RP24-279G5 from 3, complet... 42 0.56
3gb|AC140238.3| Mus musculus BAC clone RP24-279O7 from 3, complet... 42 0.56
4gb|AC140416.2| Mus musculus BAC clone RP24-347A16 from 6, comple... 42 0.56
5emb|AL671993.7| Mouse DNA sequence from clone RP23-428E5 on chro... 42 0.56
6gb|AC009230.3| Homo sapiens BAC clone RP11-343B21 from 2, comple... 40 2.2
7gb|AC007238.3| Homo sapiens BAC clone RP11-19M18 from 2, complet... 40 2.2
8gb|AC006367.3|AC006367 Homo sapiens BAC clone RP11-167L9 from 7p... 40 2.2
9gb|AC103663.15| Mus musculus chromosome 1, clone RP23-219O12, co... 40 2.2
10gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome 38 8.7
11gb|AY714780.1| Homo sapiens carboxypeptidase B2 (plasma, carboxy... 38 8.7
12gb|AC147216.3| Pan troglodytes BAC clone RP43-156I12 from 7, com... 38 8.7
13gb|CP000051.1| Chlamydia trachomatis A/HAR-13, complete genome 38 8.7
14gb|AY359242.1| Pseudendoclonium akinetum mitochondrion, complete... 38 8.7
15ref|XM_742994.1| Aspergillus fumigatus Af293 hypothetical protei... 38 8.7
16emb|AL672032.6| Human DNA sequence from clone RP11-308B5 on chro... 38 8.7
17emb|AL358253.16| Human DNA sequence from clone RP11-460G22 on ch... 38 8.7
18emb|AL356264.12| Human DNA sequence from clone RP11-452P23 on ch... 38 8.7
19emb|AL160287.18| Human DNA sequence from clone RP11-128B16 on ch... 38 8.7
20emb|AL137141.10| Human DNA sequence from clone RP11-139H14 on ch... 38 8.7
21emb|BX957223.1| Methanococcus maripaludis S2 complete genome; se... 38 8.7
22gb|AC011424.4| Homo sapiens chromosome 5 clone P1_1242F12, compl... 38 8.7
23gb|AE001273.1| Chlamydia trachomatis D/UW-3/CX, complete genome 38 8.7
24emb|AL021447.3|CEF19B2 Caenorhabditis elegans Cosmid F19B2, comp... 38 8.7
25emb|CR354534.15| Zebrafish DNA sequence from clone CH211-140C18 ... 38 8.7
26emb|AL691462.12| Mouse DNA sequence from clone RP23-267F7 on chr... 38 8.7

>gb|BT008930.1| Triticum aestivum clone wde1f.pk003.h2:fis, full insert mRNA sequence
          Length = 2371

 Score = 95.6 bits (48), Expect = 4e-17
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                        
Query: 89   atgataagatgaaacaactatcaagtatcctttcaaatatctgatgccctaatgctttca 148
            ||||||| ||||||||| ||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 2154 atgataacatgaaacaattatcaagtatcctctcaaatatctgatgccctaaagctttca 2095

                    
Query: 149  tggttgaa 156
            || |||||
Sbjct: 2094 tgcttgaa 2087



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 16   ttttgtgatggggaactagcatca 39
            ||||||||||||||||||||||||
Sbjct: 2220 ttttgtgatggggaactagcatca 2197



to top

>gb|AC140237.4| Mus musculus BAC clone RP24-279G5 from 3, complete sequence
          Length = 155999

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 99    gaaacaactatcaagtatcctttcaaata 127
             |||||||||||||| ||||||| ||||||
Sbjct: 17946 gaaacaactatcaaatatccttacaaata 17918



to top

>gb|AC140238.3| Mus musculus BAC clone RP24-279O7 from 3, complete sequence
          Length = 174633

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 99    gaaacaactatcaagtatcctttcaaata 127
             |||||||||||||| ||||||| ||||||
Sbjct: 89195 gaaacaactatcaaatatccttacaaata 89223



to top

>gb|AC140416.2| Mus musculus BAC clone RP24-347A16 from 6, complete sequence
          Length = 188390

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 109   tcaagtatcctttcaaatatc 129
             |||||||||||||||||||||
Sbjct: 80876 tcaagtatcctttcaaatatc 80856



to top

>emb|AL671993.7| Mouse DNA sequence from clone RP23-428E5 on chromosome X, complete
             sequence
          Length = 194106

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 13    gagttttgtgatggggaacta 33
             |||||||||||||||||||||
Sbjct: 89496 gagttttgtgatggggaacta 89476



to top

>gb|AC009230.3| Homo sapiens BAC clone RP11-343B21 from 2, complete sequence
          Length = 173993

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 115    atcctttcaaatatctgatg 134
              ||||||||||||||||||||
Sbjct: 105655 atcctttcaaatatctgatg 105636



to top

>gb|AC007238.3| Homo sapiens BAC clone RP11-19M18 from 2, complete sequence
          Length = 169147

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 122    caaatatctgatgccctaat 141
              ||||||||||||||||||||
Sbjct: 147571 caaatatctgatgccctaat 147552



to top

>gb|AC006367.3|AC006367 Homo sapiens BAC clone RP11-167L9 from 7p14-p15, complete sequence
          Length = 130469

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    agataattcagagttttgtgatgg 26
            ||||| ||||||||||||||||||
Sbjct: 8714 agatatttcagagttttgtgatgg 8691



to top

>gb|AC103663.15| Mus musculus chromosome 1, clone RP23-219O12, complete sequence
          Length = 212662

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 17     tttgtgatggggaactagca 36
              ||||||||||||||||||||
Sbjct: 199936 tttgtgatggggaactagca 199917



to top

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 7      aattcagagttttgtgatgggga 29
              |||||| ||||||||||||||||
Sbjct: 368392 aattcaaagttttgtgatgggga 368414



to top

>gb|AY714780.1| Homo sapiens carboxypeptidase B2 (plasma, carboxypeptidase U) (CPB2)
             gene, complete cds
          Length = 55829

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   tcctttcaaatatctgatg 134
             |||||||||||||||||||
Sbjct: 22329 tcctttcaaatatctgatg 22347



to top

>gb|AC147216.3| Pan troglodytes BAC clone RP43-156I12 from 7, complete sequence
          Length = 199965

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     ttacaatattccccaaatg 63
              |||||||||||||||||||
Sbjct: 107083 ttacaatattccccaaatg 107065



to top

>gb|CP000051.1| Chlamydia trachomatis A/HAR-13, complete genome
          Length = 1044459

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 106    ctatcaagtatcctttcaaatat 128
              |||||||||| ||||||||||||
Sbjct: 161094 ctatcaagtagcctttcaaatat 161116



to top

>gb|AY359242.1| Pseudendoclonium akinetum mitochondrion, complete genome
          Length = 95880

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    ctaaatttaacagccaact 88
             |||||||||||||||||||
Sbjct: 44735 ctaaatttaacagccaact 44753



to top

>ref|XM_742994.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g02550)
           partial mRNA
          Length = 1884

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 86  actatgataagatgaaaca 104
           |||||||||||||||||||
Sbjct: 554 actatgataagatgaaaca 572



to top

>emb|AL672032.6| Human DNA sequence from clone RP11-308B5 on chromosome X Contains a
             novel gene, the 5' end of the PLAC1 gene for
             placenta-specific 1, a ribosomal protein L21 (RPL21)
             pseudogene, a ribosomal protein S7 (RPS7) pseudogene and
             the 3' end of the LOC169090 gene, complete sequence
          Length = 209317

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    caatattccccaaatgtct 66
             |||||||||||||||||||
Sbjct: 85625 caatattccccaaatgtct 85643



 Score = 38.2 bits (19), Expect = 8.7
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 36    atcataatnttacaatattccccaaa 61
             |||| ||| |||||||||||||||||
Sbjct: 26071 atcaaaatgttacaatattccccaaa 26046



to top

>emb|AL358253.16| Human DNA sequence from clone RP11-460G22 on chromosome 1 Contains the
             3' end of the gene for a novel protein (KIAA0459), the
             PLA2G2E gene for phospholipase A2 group IIE and the
             PLA2G2A gene for phospholipase A2 group IIA (platelets,
             synovial fluid), complete sequence
          Length = 101824

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    ttccccaaatgtctgaact 71
             |||||||||||||||||||
Sbjct: 19343 ttccccaaatgtctgaact 19325



to top

>emb|AL356264.12| Human DNA sequence from clone RP11-452P23 on chromosome 13 Contains
             asmall nuclear ribonucleoprotein polypeptide F
             (SNRPF)(SMF) pseudogene, complete sequence
          Length = 93247

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    aactaaatttaacagccaa 86
             |||||||||||||||||||
Sbjct: 55228 aactaaatttaacagccaa 55246



to top

>emb|AL160287.18| Human DNA sequence from clone RP11-128B16 on chromosome 10p11.1-11.23
             Contains the 3' end of the APBB1IP gene for amyloid beta
             (A4) precursor protein-binding family B member 1
             interacting protein and two novel genes, complete sequence
          Length = 144666

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 7     aattcagagttttgtgatg 25
             |||||||||||||||||||
Sbjct: 90671 aattcagagttttgtgatg 90653



to top

>emb|AL137141.10| Human DNA sequence from clone RP11-139H14 on chromosome 13 Contains the
              5' end of the CPB2 gene for carboxypeptidase B2 (plasma,
              carboxypeptidase U), 2 novel genes, the LCP1 gene for
              lymphocyte cytosolic protein 1 (L-plastin) and a CpG
              Island, complete sequence
          Length = 180680

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 116    tcctttcaaatatctgatg 134
              |||||||||||||||||||
Sbjct: 167551 tcctttcaaatatctgatg 167569



to top

>emb|BX957223.1| Methanococcus maripaludis S2 complete genome; segment 5/5
          Length = 268122

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   ctatcaagtatcctttcaa 124
             |||||||||||||||||||
Sbjct: 88420 ctatcaagtatcctttcaa 88438



to top

>gb|AC011424.4| Homo sapiens chromosome 5 clone P1_1242F12, complete sequence
          Length = 84991

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 110   caagtatcctttcaaatat 128
             |||||||||||||||||||
Sbjct: 35520 caagtatcctttcaaatat 35502



to top

>gb|AE001273.1| Chlamydia trachomatis D/UW-3/CX, complete genome
          Length = 1042519

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 106    ctatcaagtatcctttcaaatat 128
              |||||||||| ||||||||||||
Sbjct: 160391 ctatcaagtagcctttcaaatat 160413



to top

>emb|AL021447.3|CEF19B2 Caenorhabditis elegans Cosmid F19B2, complete sequence
          Length = 38950

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 85    aactatgataagatgaaac 103
             |||||||||||||||||||
Sbjct: 27871 aactatgataagatgaaac 27853



to top

>emb|CR354534.15| Zebrafish DNA sequence from clone CH211-140C18 in linkage group 23,
              complete sequence
          Length = 189794

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 108    atcaagtatcctttcaaat 126
              |||||||||||||||||||
Sbjct: 109748 atcaagtatcctttcaaat 109766



to top

>emb|AL691462.12| Mouse DNA sequence from clone RP23-267F7 on chromosome 2, complete
             sequence
          Length = 61310

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     aattcagagttttgtgatg 25
             |||||||||||||||||||
Sbjct: 33744 aattcagagttttgtgatg 33762


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,636,383
Number of Sequences: 3902068
Number of extensions: 1636383
Number of successful extensions: 103109
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 103027
Number of HSP's gapped (non-prelim): 82
length of query: 178
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 156
effective length of database: 17,147,199,772
effective search space: 2674963164432
effective search space used: 2674963164432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top