Clone Name	rbags25c17
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8,...	541	e-151
2	dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B15...	525	e-146
3	emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B	517	e-143
4	dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6,...	511	e-142
5	gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence	492	e-136
6	ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA	488	e-134
7	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	488	e-134
8	dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic D...	488	e-134
9	gb|BT016429.1| Zea mays clone Contig262 mRNA sequence	482	e-133
10	emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221)	482	e-133
11	ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA	476	e-131
12	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	476	e-131
13	dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic D...	476	e-131
14	dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic D...	476	e-131
15	gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full i...	474	e-130
16	ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA	468	e-129
17	gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full...	468	e-129
18	dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D...	468	e-129
19	ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA	466	e-128
20	ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA	464	e-127
21	ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA	460	e-126
22	dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complet...	460	e-126
23	ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA	458	e-126
24	ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predic...	456	e-125
25	gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome...	456	e-125
26	gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome...	456	e-125
27	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	456	e-125
28	ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA	454	e-124
29	gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds	454	e-124
30	gb|BT016519.1| Zea mays clone Contig352 mRNA sequence	450	e-123
31	emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4)	442	e-121
32	gb|BT016478.1| Zea mays clone Contig311 mRNA sequence	426	e-116
33	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	426	e-116
34	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	426	e-116
35	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	426	e-116
36	emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214)	418	e-114
37	emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3)	412	e-112
38	gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence	410	e-111
39	gb|BT016885.1| Zea mays clone Contig718 mRNA sequence	410	e-111
40	gb|BT016350.1| Zea mays clone Contig183 mRNA sequence	410	e-111
41	dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D...	363	4e-97
42	ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predic...	357	2e-95
43	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	357	2e-95
44	ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predic...	349	6e-93
45	dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D...	349	6e-93
46	dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D...	349	6e-93
47	gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partia...	323	3e-85
48	emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B	305	8e-80
49	dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B12...	301	1e-78
50	gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds	289	5e-75
51	gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, parti...	250	4e-63
52	gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partia...	240	4e-60
53	gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partia...	230	4e-57
54	gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),...	226	6e-56
55	gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partia...	220	4e-54
56	dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clon...	218	1e-53
57	gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial...	218	1e-53
58	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	212	9e-52
59	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	212	9e-52
60	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	194	2e-46
61	gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c...	153	7e-34
62	ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus simila...	151	3e-33
63	ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus simila...	151	3e-33
64	gb|AF025667.1|AF025667 Gossypium hirsutum histone H2B1 mRNA, com...	143	7e-31
65	ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG1...	141	3e-30
66	emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC...	141	3e-30
67	dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone ...	141	3e-30
68	emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F0...	141	3e-30
69	dbj|AP006674.1| Lotus japonicus genomic DNA, chromosome 3, clone...	137	4e-29
70	ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B hist...	133	6e-28
71	ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone ...	133	6e-28
72	ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B hist...	133	6e-28
73	ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B hist...	133	6e-28
74	ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B hist...	133	6e-28
75	ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B hist...	133	6e-28
76	ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus simila...	127	4e-26
77	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	125	2e-25
78	gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:...	125	2e-25
79	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	125	2e-25
80	gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosome 5 l...	123	6e-25
81	gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromosome 5...	123	6e-25
82	gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome 5 loc...	123	6e-25
83	gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosome 5 l...	123	6e-25
84	gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosome 5 l...	123	6e-25
85	gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosome 5 l...	123	6e-25
86	gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome 5 lo...	123	6e-25
87	gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosome 5 l...	123	6e-25
88	gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosome 5 l...	123	6e-25
89	gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosome 5 l...	123	6e-25
90	gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosome 5 l...	123	6e-25
91	ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (N...	121	2e-24
92	ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (N...	121	2e-24
93	ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 29...	119	1e-23
94	ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (p...	119	1e-23
95	gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 ...	117	4e-23
96	ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260...	117	4e-23
97	ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B...	117	4e-23
98	ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B...	117	4e-23
99	emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09	117	4e-23
100	gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosome 5 l...	115	2e-22
101	gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome 5 lo...	115	2e-22
102	gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosome 5 l...	115	2e-22
103	gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosome 5 l...	115	2e-22
104	gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromosome ...	115	2e-22
105	gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromosome 5...	115	2e-22
106	gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosome 5 l...	115	2e-22
107	gb|AF471814.1| Arabidopsis thaliana ecotype SU-0 chromosome 5 lo...	115	2e-22
108	gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome 5 lo...	115	2e-22
109	gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome 5 lo...	115	2e-22
110	gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosome 5 l...	115	2e-22
111	gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome 5 lo...	115	2e-22
112	gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome 5 lo...	115	2e-22
113	gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosome 5 l...	115	2e-22
114	gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome 5 lo...	115	2e-22
115	gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome 5 lo...	115	2e-22
116	ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus simila...	113	6e-22
117	ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus simila...	113	6e-22
118	gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
119	gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
120	ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H...	111	2e-21
121	ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3...	111	2e-21
122	ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477...	111	2e-21
123	ref|XM_608099.2| PREDICTED: Bos taurus similar to Histone H2B 29...	111	2e-21
124	gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
125	gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IM...	111	2e-21
126	ref|XM_868693.1| PREDICTED: Bos taurus similar to H2B histone fa...	111	2e-21
127	ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 29...	111	2e-21
128	ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA	111	2e-21
129	ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA	111	2e-21
130	gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds	111	2e-21
131	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	111	2e-21
132	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	111	2e-21
133	ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus simila...	111	2e-21
134	ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus simila...	111	2e-21
135	emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A	111	2e-21
136	emb|X14731.1|CMHIST2B Duck H2B histone gene	111	2e-21
137	emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone ...	111	2e-21
138	emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone ...	111	2e-21
139	emb|CR541895.1| Homo sapiens full open reading frame cDNA clone ...	111	2e-21
140	gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MG...	111	2e-21
141	emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from cl...	111	2e-21
142	dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU20115...	111	2e-21
143	dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG20083...	111	2e-21
144	ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudo...	111	2e-21
145	gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, comple...	111	2e-21
146	gb|AY131980.1| Homo sapiens histone H2B (HIST3H2BA) pseudogene, ...	111	2e-21
147	gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, comple...	111	2e-21
148	ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H...	111	2e-21
149	gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870....	111	2e-21
150	emb|AJ329611.1|HSA329611 Homo sapiens genomic sequence surroundi...	111	2e-21
151	gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	111	2e-21
152	gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	111	2e-21
153	gb|BC111653.1| Bos taurus cDNA clone MGC:137516 IMAGE:8026091, c...	111	2e-21
154	ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA	111	2e-21
155	gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MG...	111	2e-21
156	gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end	111	2e-21
157	emb|AJ343028.1|HSA343028 Homo sapiens genomic sequence surroundi...	111	2e-21
158	gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds	111	2e-21
159	gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA cl...	109	9e-21
160	ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-s...	109	9e-21
161	emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr...	109	9e-21
162	emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2...	109	9e-21
163	emb|BX072512.1|CNS09S44 Single read from an extremity of a full-...	109	9e-21
164	emb|BX072414.1|CNS09S1E Single read from an extremity of a full-...	109	9e-21
165	emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-...	109	9e-21
166	emb|BX051496.1|CNS09BWC Single read from an extremity of a full-...	109	9e-21
167	emb|BX051495.1|CNS09BWB Single read from an extremity of a full-...	109	9e-21
168	emb|BX047440.1|CNS098RO Single read from an extremity of a full-...	109	9e-21
169	emb|BX038423.1|CNS091T7 Single read from an extremity of a full-...	109	9e-21
170	emb|BX034441.1|CNS08YQL Single read from an extremity of a full-...	109	9e-21
171	emb|BX032827.1|CNS08XHR Single read from an extremity of a full-...	109	9e-21
172	emb|BX031663.1|CNS08WLF Single read from an extremity of a full-...	109	9e-21
173	emb|BX022107.1|CNS08P7Z Single read from an extremity of a full-...	109	9e-21
174	emb|BX021771.1|CNS08OYN Single read from an extremity of a full-...	109	9e-21
175	emb|BX021770.1|CNS08OYM Single read from an extremity of a full-...	109	9e-21
176	emb|BX014618.1|CNS08JFY Single read from an extremity of a full-...	109	9e-21
177	emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-...	109	9e-21
178	emb|BX012776.1|CNS08I0S Single read from an extremity of a full-...	109	9e-21
179	emb|BX012380.1|CNS08HPS Single read from an extremity of a full-...	109	9e-21
180	emb|BX009211.1|CNS08F9R Single read from an extremity of a full-...	109	9e-21
181	emb|BX008531.1|CNS08EQV Single read from an extremity of a full-...	109	9e-21
182	emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B	109	9e-21
183	ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2b...	109	9e-21
184	gb|AF471834.1| Arabidopsis thaliana ecotype BLA-10 chromosome 5 ...	109	9e-21
185	gb|AF471833.1| Arabidopsis thaliana ecotype PLA-0 chromosome 5 l...	109	9e-21
186	ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudo...	109	9e-21
187	ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudo...	109	9e-21
188	gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, ...	109	9e-21
189	gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, ...	109	9e-21
190	ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582 ...	109	9e-21
191	ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097 ...	109	9e-21
192	ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080 ...	109	9e-21
193	ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674 ...	109	9e-21
194	ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043 ...	109	9e-21
195	ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106 ...	109	9e-21
196	ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003 ...	109	9e-21
197	dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, c...	109	9e-21
198	gb|BC106916.1| Homo sapiens similar to histone H2B histone famil...	109	9e-21
199	gb|BC073925.1| Homo sapiens similar to histone H2B histone famil...	109	9e-21
200	emb|Z59559.1|HS163A6R H.sapiens CpG island DNA genomic Mse1 frag...	107	4e-20
201	gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	105	1e-19
202	gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM...	105	1e-19
203	ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histo...	105	1e-19
204	ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H...	105	1e-19
205	ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histo...	105	1e-19
206	gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MG...	105	1e-19
207	ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BF...	105	1e-19
208	ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA	105	1e-19
209	gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	105	1e-19
210	ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 29...	105	1e-19
211	ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone fa...	105	1e-19
212	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	105	1e-19
213	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	105	1e-19
214	ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA	105	1e-19
215	ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA	105	1e-19
216	gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IM...	105	1e-19
217	ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
218	ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
219	ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
220	ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
221	ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B hist...	105	1e-19
222	ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B hist...	105	1e-19
223	ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B hist...	105	1e-19
224	ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
225	ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B hist...	105	1e-19
226	ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
227	ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B hist...	105	1e-19
228	ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-s...	105	1e-19
229	ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
230	ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
231	ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B hist...	105	1e-19
232	ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B hist...	105	1e-19
233	ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
234	ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone ...	105	1e-19
235	ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ...	105	1e-19
236	ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone ...	105	1e-19
237	ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ...	105	1e-19
238	gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA ...	105	1e-19
239	gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, comple...	105	1e-19
240	gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, comple...	105	1e-19
241	gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, comple...	105	1e-19
242	emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o...	105	1e-19
243	emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro...	105	1e-19
244	emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o...	105	1e-19
245	emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2...	105	1e-19
246	emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, c...	105	1e-19
247	gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	105	1e-19
248	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	105	1e-19
249	dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family p...	105	1e-19
250	emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (...	105	1e-19
251	emb|Z57636.1|HS187F7F H.sapiens CpG island DNA genomic Mse1 frag...	105	1e-19
252	dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	105	1e-19
253	ref|NG_000827.2| Homo sapiens genomic histone family microcluste...	105	1e-19
254	gb|BC108737.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MG...	105	1e-19
255	emb|Z80783.1|HSH2BL H.sapiens H2B/l gene	105	1e-19
256	dbj|AP001051.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	105	1e-19
257	dbj|AP001050.1| Homo sapiens genomic DNA, chromosome 21, clone:K...	105	1e-19
258	gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG...	103	6e-19
259	gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MG...	103	6e-19
260	ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA	103	6e-19
261	ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA	103	6e-19
262	ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone...	103	6e-19
263	ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone...	103	6e-19
264	ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone...	103	6e-19
265	ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone...	103	6e-19
266	ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ...	103	6e-19
267	gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MG...	103	6e-19
268	gb|BC051921.1| Mus musculus histone 3, H2ba, mRNA (cDNA clone MG...	103	6e-19
269	ref|XM_868991.1| PREDICTED: Bos taurus similar to Histone H2B 29...	103	6e-19
270	ref|NM_003522.3| Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA	103	6e-19
271	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	103	6e-19
272	ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone ...	103	6e-19
273	ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone ...	103	6e-19
274	ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B ...	103	6e-19
275	ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B ...	103	6e-19
276	ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone ...	103	6e-19
277	gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MG...	103	6e-19
278	gb|AF531289.1| Homo sapiens histone H2B (HIST1H2BF) gene, comple...	103	6e-19
279	emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA	103	6e-19
280	gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG...	103	6e-19
281	gb|BC056264.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IM...	103	6e-19
282	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	103	6e-19
283	ref|XM_792924.1| PREDICTED: Strongylocentrotus purpuratus simila...	103	6e-19
284	emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq...	103	6e-19
285	ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA	103	6e-19
286	emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq...	103	6e-19
287	emb|X07762.1|GGH2AB7 Chicken DNA for pCH22.0B histone H2A/H2B se...	103	6e-19
288	emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	103	6e-19
289	emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)	103	6e-19
290	emb|X02621.1|MMHISH2B Mouse gene for histone H2b	103	6e-19
291	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	103	6e-19
292	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	103	6e-19
293	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	103	6e-19
294	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	103	6e-19
295	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	103	6e-19
296	gb|BC096123.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG...	103	6e-19
297	emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b	103	6e-19
298	gb|BC096120.1| Homo sapiens histone 1, H2bf, mRNA (cDNA clone MG...	103	6e-19
299	gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MG...	103	6e-19
300	gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MG...	103	6e-19
301	gb|BC108143.1| Bos taurus similar to Histone H2B 291B, mRNA (cDN...	103	6e-19
302	ref|NM_001037469.1| Bos taurus similar to Histone H2B 291B (MGC1...	103	6e-19
303	dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-le...	103	6e-19
304	dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	103	6e-19
305	dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN f...	103	6e-19
306	dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN f...	103	6e-19
307	dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RI...	103	6e-19
308	dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIK...	103	6e-19
309	dbj|AK018765.1| Mus musculus adult male cerebellum cDNA, RIKEN f...	103	6e-19
310	ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA	103	6e-19
311	ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA	103	6e-19
312	ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA	103	6e-19
313	ref|NM_178200.1| Mus musculus histone 1, H2bm (Hist1h2bm), mRNA	103	6e-19
314	ref|NM_178202.1| Mus musculus histone 1, H2bp (Hist1h2bp), mRNA	103	6e-19
315	ref|NM_030082.1| Mus musculus histone 3, H2ba (Hist3h2ba), mRNA	103	6e-19
316	ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p...	103	6e-19
317	gb|AY158942.1| Mus musculus histone protein Hist3h2ba gene, comp...	103	6e-19
318	gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp...	103	6e-19
319	gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp...	103	6e-19
320	gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, comp...	103	6e-19
321	gb|AY158934.1| Mus musculus histone protein Hist1h2bg gene, comp...	103	6e-19
322	gb|AY158931.1| Mus musculus histone protein Hist1h2bk gene, comp...	103	6e-19
323	gb|AY158930.1| Mus musculus histone protein Hist1h2bp gene, comp...	103	6e-19
324	gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, comp...	103	6e-19
325	gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, comp...	103	6e-19
326	gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, comp...	103	6e-19
327	gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp...	103	6e-19
328	gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp...	103	6e-19
329	emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0)	103	6e-19
330	emb|X05098.1|GGH2B5 Chicken histone H2B gene (pBBA-3.0)	103	6e-19
331	emb|X05097.1|GGH2B4 Chicken histone H2B gene (pPP2d-2.3)	103	6e-19
332	emb|X05096.1|GGH2B3 Chicken histone H2B gene (pRR3c-3.5)	103	6e-19
333	emb|X05095.1|GGH2B2 Chicken histone H2B gene (pRR2e-3.5)	103	6e-19
334	emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3)	103	6e-19
335	ref|NM_175665.1| Mus musculus histone 1, H2bk (Hist1h2bk), mRNA	103	6e-19
336	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	103	6e-19
337	gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds	103	6e-19
338	gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks	103	6e-19
339	emb|Z80779.1|HSH2BG H.sapiens H2B/g gene	103	6e-19
340	dbj|D70896.1| Gallus gallus DNA for histone H2B, complete cds	103	6e-19
341	ref|NM_122194.2| Arabidopsis thaliana DNA binding AT5G22880 mRNA...	101	2e-18
342	ref|XM_518295.1| PREDICTED: Pan troglodytes similar to H2B histo...	101	2e-18
343	gb|BT025507.1| Arabidopsis thaliana At5g22880 mRNA, complete cds	101	2e-18
344	ref|XM_532763.2| PREDICTED: Canis familiaris similar to testis-s...	101	2e-18
345	emb|CR669650.2|CNS0FFO8 Tetraodon nigroviridis full-length cDNA	101	2e-18
346	emb|BX068880.1|CNS09PB8 Single read from an extremity of a full-...	101	2e-18
347	emb|BX053939.1|CNS09DS7 Single read from an extremity of a full-...	101	2e-18
348	emb|BX026873.1|CNS08SWD Single read from an extremity of a full-...	101	2e-18
349	emb|BX014617.1|CNS08JFX Single read from an extremity of a full-...	101	2e-18
350	emb|BX013308.1|CNS08IFK Single read from an extremity of a full-...	101	2e-18
351	emb|BX008532.1|CNS08EQW Single read from an extremity of a full-...	101	2e-18
352	emb|Y07745.1|ATHISH2BL A.thaliana mRNA histone H2B like protein	101	2e-18
353	emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes	101	2e-18
354	gb|AF471843.1| Arabidopsis thaliana ecotype MA-0 chromosome 5 lo...	101	2e-18
355	gb|AF471842.1| Arabidopsis thaliana ecotype DI-0 chromosome 5 lo...	101	2e-18
356	gb|AF471841.1| Arabidopsis thaliana ecotype AA-0 chromosome 5 lo...	101	2e-18
357	gb|AF471840.1| Arabidopsis thaliana ecotype GY-0 chromosome 5 lo...	101	2e-18
358	gb|AF471839.1| Arabidopsis thaliana ecotype AG-0 chromosome 5 lo...	101	2e-18
359	gb|AF471838.1| Arabidopsis thaliana ecotype COL-0 chromosome 5 l...	101	2e-18
360	gb|AF471837.1| Arabidopsis thaliana ecotype MT-0 chromosome 5 lo...	101	2e-18
361	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	101	2e-18
362	emb|BX833190.1|CNS0A0CG Arabidopsis thaliana Full-length cDNA Co...	101	2e-18
363	dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D...	101	2e-18
364	dbj|AB005243.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	101	2e-18
365	dbj|AK106505.1| Oryza sativa (japonica cultivar-group) cDNA clon...	101	2e-18
366	gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes,...	101	2e-18
367	ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261...	100	9e-18
368	gb|AY656810.1| Homo sapiens H2B/t variant gene, complete cds	100	9e-18
369	gb|AY648853.1| Homo sapiens histone H2B/s (HIST2H2BD) gene, comp...	100	9e-18
370	ref|XM_868522.1| PREDICTED: Bos taurus similar to Histone H2B 29...	100	9e-18
371	gb|BC071638.1| Homo sapiens cDNA clone IMAGE:4390105, containing...	100	9e-18
372	gb|BC068044.1| Homo sapiens cDNA clone IMAGE:6380649, containing...	100	9e-18
373	emb|BX038797.1|CNS0923L Single read from an extremity of a full-...	100	9e-18
374	gb|DQ118972.1| Toxoplasma gondii histone 2B variant 2 mRNA, comp...	100	9e-18
375	ref|XM_936779.1| PREDICTED: Homo sapiens similar to H2B histone ...	100	9e-18
376	ref|NG_002619.1| Homo sapiens histone 2, H2bc (HIST2H2BC) pseudo...	100	9e-18
377	ref|NG_002620.1| Homo sapiens histone 2, H2bd (HIST2H2BD) pseudo...	100	9e-18
378	gb|AY131977.1| Homo sapiens histone H2B (HIST2H2BC) pseudogene, ...	100	9e-18
379	gb|AY131978.1| Homo sapiens histone H2B (HIST2H2BD) pseudogene, ...	100	9e-18
380	ref|NM_125384.2| Arabidopsis thaliana DNA binding AT5G59910 mRNA...	98	4e-17
381	gb|BT020297.1| Arabidopsis thaliana At5g59910 gene, complete cds	98	4e-17
382	ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal...	98	4e-17
383	ref|XM_527258.1| PREDICTED: Pan troglodytes similar to histone H...	98	4e-17
384	ref|XM_518287.1| PREDICTED: Pan troglodytes similar to Histone H...	98	4e-17
385	ref|NM_175664.1| Mus musculus histone 1, H2bb (Hist1h2bb), mRNA	98	4e-17
386	gb|BC082774.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone IM...	98	4e-17
387	gb|BT025512.1| Arabidopsis thaliana At5g59910 mRNA, complete cds	98	4e-17
388	ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone...	98	4e-17
389	ref|XM_582734.2| PREDICTED: Bos taurus similar to Histone H2B 29...	98	4e-17
390	ref|NM_021063.2| Homo sapiens histone 1, H2bd (HIST1H2BD), trans...	98	4e-17
391	ref|NM_138720.1| Homo sapiens histone 1, H2bd (HIST1H2BD), trans...	98	4e-17
392	ref|NM_003519.3| Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA	98	4e-17
393	ref|XM_988254.1| PREDICTED: Mus musculus similar to Histone H2B ...	98	4e-17
394	gb|AF531295.1| Homo sapiens histone H2B (HIST1H2BL) gene, comple...	98	4e-17
395	gb|AF531287.1| Homo sapiens histone H2B (HIST1H2BD) gene, comple...	98	4e-17
396	ref|NM_022643.1| Rattus norvegicus histone 1, H2ba (Hist1h2ba), ...	98	4e-17
397	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	98	4e-17
398	emb|Z83740.1|HSZ83740 H.sapiens hH2B/c gene	98	4e-17
399	emb|X90778.1|MMTSHIS2B M.musculus H2B gene	98	4e-17
400	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	98	4e-17
401	emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	98	4e-17
402	emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones	98	4e-17
403	emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone...	98	4e-17
404	emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr...	98	4e-17
405	emb|AJ223353.1|HSAJ3353 Homo sapiens mRNA for histone H2B, clone...	98	4e-17
406	emb|CR859861.1| Pongo pygmaeus mRNA; cDNA DKFZp469M064 (from clo...	98	4e-17
407	gb|BC096122.1| Homo sapiens histone 1, H2bd, transcript variant ...	98	4e-17
408	gb|BC002842.2| Homo sapiens histone 1, H2bd, transcript variant ...	98	4e-17
409	gb|AY057643.1| Arabidopsis thaliana AT5g59910/mmn10_130 mRNA, co...	98	4e-17
410	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	98	4e-17
411	emb|CR353801.1| Gallus gallus finished cDNA, clone ChEST919h3	98	4e-17
412	gb|BC093761.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG...	98	4e-17
413	gb|BC093759.1| Homo sapiens histone 1, H2bl, mRNA (cDNA clone MG...	98	4e-17
414	ref|NM_022647.1| Rattus norvegicus histone 1, H2bl (Hist1h2bl), ...	98	4e-17
415	gb|BC092138.1| Mus musculus histone 1, H2bh, mRNA (cDNA clone MG...	98	4e-17
416	ref|NM_175663.1| Mus musculus histone 1, H2ba (Hist1h2ba), mRNA	98	4e-17
417	ref|NM_178195.1| Mus musculus histone 1, H2bf (Hist1h2bf), mRNA	98	4e-17
418	ref|NM_178198.1| Mus musculus histone 1, H2bj (Hist1h2bj), mRNA	98	4e-17
419	ref|XM_214483.3| PREDICTED: Rattus norvegicus histone 1, H2bn (p...	98	4e-17
420	gb|AY158939.1| Mus musculus histone protein Hist1h2ba gene, comp...	98	4e-17
421	gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, comp...	98	4e-17
422	gb|AY158933.1| Mus musculus histone protein Hist1h2bh gene, comp...	98	4e-17
423	gb|AY158932.1| Mus musculus histone protein Hist1h2bj gene, comp...	98	4e-17
424	gb|AY158907.1| Mus musculus histone protein Hist1h1e gene, compl...	98	4e-17
425	ref|NM_214554.1| Strongylocentrotus purpuratus late histone L3 H...	98	4e-17
426	emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4)	98	4e-17
427	emb|X57263.1|GGH2B4G Chicken gene for histone H2B-IV	98	4e-17
428	dbj|AB015475.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	98	4e-17
429	gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H...	98	4e-17
430	ref|NM_178197.1| Mus musculus histone 1, H2bh (Hist1h2bh), mRNA	98	4e-17
431	gb|DQ268853.1| Solanum tuberosum clone 167E08 histone H2B-like p...	98	4e-17
432	gb|M18046.1|RATHISTSA Rat testis-specific histone H2B mRNA, comp...	98	4e-17
433	gb|M18045.1|RATHISTS Rat testis-specific histone TH2B mRNA, comp...	98	4e-17
434	gb|M60751.1|HUMHISAF Human histone H2B.1 (H2B) gene, complete cds	98	4e-17
435	gb|M14143.1|SUPH2A1 P.miliaris histone H2B-2.2 gene, complete cds	98	4e-17
436	ref|XM_527282.1| PREDICTED: Pan troglodytes similar to HIST1H2BM...	96	1e-16
437	ref|NM_206882.1| Mus musculus histone 3, H2bb (Hist3h2bb), mRNA	96	1e-16
438	gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	96	1e-16
439	gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	96	1e-16
440	gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	96	1e-16
441	ref|XM_598166.2| PREDICTED: Bos taurus similar to Histone H2B 29...	96	1e-16
442	ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA	96	1e-16
443	gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IM...	96	1e-16
444	gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, comple...	96	1e-16
445	gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MG...	96	1e-16
446	gb|BC112625.1| Bos taurus MGC133641 protein, mRNA (cDNA clone MG...	96	1e-16
447	emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene	96	1e-16
448	emb|Z46225.1|HTHISH2B H.tubulosa gene encoding histone H2B	96	1e-16
449	emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi...	96	1e-16
450	gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:1122...	96	1e-16
451	ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2...	96	1e-16
452	ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2...	96	1e-16
453	ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA	96	1e-16
454	gb|AY158943.1| Mus musculus histone protein Hist3h2bb gene, comp...	96	1e-16
455	gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl...	96	1e-16
456	gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp...	96	1e-16
457	dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501	96	1e-16
458	dbj|AK108119.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
459	emb|Z58592.1|HS45C9F H.sapiens CpG island DNA genomic Mse1 fragm...	96	1e-16
460	gb|BC079458.1| Rattus norvegicus histone 1, H2bh, mRNA (cDNA clo...	96	1e-16
461	gb|M84798.1|TIGH2B2A Tigriopus californicus histone H2B-2 gene, ...	96	1e-16
462	gb|M25487.1|MUSHIS2B Mus musculus histone H2b mRNA, 3' end	96	1e-16
463	gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene...	96	1e-16
464	gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	96	1e-16
465	emb|CR719344.2|CNS0GHZQ Tetraodon nigroviridis full-length cDNA	94	6e-16
466	emb|CR698920.2|CNS0G28K Tetraodon nigroviridis full-length cDNA	94	6e-16
467	emb|CR689567.2|CNS0FV0R Tetraodon nigroviridis full-length cDNA	94	6e-16
468	emb|CR686222.2|CNS0FSFU Tetraodon nigroviridis full-length cDNA	94	6e-16
469	emb|BX047441.1|CNS098RP Single read from an extremity of a full-...	94	6e-16
470	emb|BX009212.1|CNS08F9S Single read from an extremity of a full-...	94	6e-16
471	emb|AJ556871.1|XLA556871 Expression vector pET3-H2B H2B gene for...	94	6e-16
472	gb|AF471844.1| Arabidopsis thaliana ecotype KIL-0 chromosome 5 l...	94	6e-16
473	gb|AF471836.1| Arabidopsis thaliana ecotype LM-2 chromosome 5 lo...	94	6e-16
474	gb|AF471835.1| Arabidopsis thaliana ecotype DI-1 chromosome 5 lo...	94	6e-16
475	gb|AY086049.1| Arabidopsis thaliana clone 20822 mRNA, complete s...	94	6e-16
476	dbj|AP004665.4| Oryza sativa (japonica cultivar-group) genomic D...	94	6e-16
477	dbj|AP004558.3| Oryza sativa (japonica cultivar-group) genomic D...	94	6e-16
478	gb|J00981.1|XELHIS2BL xenopus laevis h2b histone gene & flanks	94	6e-16
479	dbj|AK158416.1| Mus musculus adult inner ear cDNA, RIKEN full-le...	92	2e-15
480	gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2...	92	2e-15
481	emb|Z57637.1|HS187F7R H.sapiens CpG island DNA genomic Mse1 frag...	92	2e-15
482	ref|XM_482672.1| Oryza sativa (japonica cultivar-group), mRNA	90	9e-15
483	ref|XM_518889.1| PREDICTED: Pan troglodytes similar to histone H...	90	9e-15
484	ref|XM_518288.1| PREDICTED: Pan troglodytes similar to Histone H...	90	9e-15
485	ref|XM_865948.1| PREDICTED: Bos taurus similar to Histone H2B 29...	90	9e-15
486	ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA	90	9e-15
487	gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, comple...	90	9e-15
488	gb|AF531288.1| Homo sapiens histone H2B (HIST1H2BE) gene, comple...	90	9e-15
489	emb|Z80780.1|HSH2BH H.sapiens H2B/h gene	90	9e-15
490	gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	90	9e-15
491	gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	90	9e-15
492	gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	90	9e-15
493	gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MG...	90	9e-15
494	dbj|AB220463.1| Macaca fascicularis mRNA, clone QflA-14990: simi...	90	9e-15
495	dbj|AB168579.1| Macaca fascicularis testis cDNA clone: QtsA-1317...	90	9e-15
496	gb|BC109769.1| Bos taurus cDNA clone MGC:133753 IMAGE:8062200, c...	90	9e-15
497	gb|BC101750.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MG...	90	9e-15
498	gb|BC101748.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MG...	90	9e-15
499	ref|NM_003523.2| Homo sapiens histone 1, H2be (HIST1H2BE), mRNA	90	9e-15
500	gb|DQ252495.1| Solanum tuberosum clone 067A06 histone H2B-like m...	90	9e-15

---

>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds
          Length = 592

 Score =  541 bits (273), Expect = e-151
 Identities = 297/305 (97%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 472 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 413

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 412 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 353

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           || |  ||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 352 tagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 293

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 292 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 233

                                                                       
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttg 528
           |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 232 ttgaagatgtagatcttgtacgtctccacgctcttcttcgacttcttcttccccttcttg 173

                
Query: 529 tcgcc 533
           |||||
Sbjct: 172 tcgcc 168

---

>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds
          Length = 3209

 Score =  525 bits (265), Expect = e-146
 Identities = 295/305 (96%)
 Strand = Plus / Minus

                                                                        
Query: 229  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1698 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcct 1639

                                                                        
Query: 289  gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1638 gggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttcttgttg 1579

                                                                        
Query: 349  tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
            |||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1578 taccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaaggag 1519

                                                                        
Query: 409  ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1518 ttcgtgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttcagcacc 1459

                                                                        
Query: 469  ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttg 528
            |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1458 ttgaagatgtagatcttgtacgtctccatgctcttcttggacttcttcttccccttcttc 1399

                 
Query: 529  tcgcc 533
            |||||
Sbjct: 1398 tcgcc 1394

---

>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B
          Length = 712

 Score =  517 bits (261), Expect = e-143
 Identities = 294/305 (96%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 516 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 457

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 456 gggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttgttg 397

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           |||| ||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||
Sbjct: 396 taccgcgccagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 337

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           |||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||
Sbjct: 336 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcagcacc 277

                                                                       
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttg 528
           |||||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 276 ttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttgcccttcttg 217

                
Query: 529 tcgcc 533
           |||||
Sbjct: 216 tcgcc 212

---

>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds
          Length = 564

 Score =  511 bits (258), Expect = e-142
 Identities = 288/298 (96%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 414 ctaggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 355

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 354 ctcgccggggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggctt 295

                                                                       
Query: 342 cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
           ||||||||| | ||| |||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 294 cttgttgtagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgat 235

                                                                       
Query: 402 gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 234 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 175

                                                                     
Query: 462 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttc 519
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 174 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttcttc 117

---

>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence
          Length = 574

 Score =  492 bits (248), Expect = e-136
 Identities = 293/308 (95%)
 Strand = Plus / Minus

                                                                       
Query: 223 taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 282
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 525 taggacgaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttggcgagc 466

                                                                       
Query: 283 tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 342
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 tcgccgggtagaacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 406

                                                                       
Query: 343 ttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatg 402
           |||||||| |  ||||||||||| | ||||||||| ||||||||||||||||||||||||
Sbjct: 405 ttgttgtagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtcgttgatg 346

                                                                       
Query: 403 aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 345 aatgagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttc 286

                                                                       
Query: 463 agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcccc 522
           |||||||||||||||||||||||||||||||| ||||||||||||| |||||||  ||||
Sbjct: 285 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttccgcccc 226

                   
Query: 523 ttcttgtc 530
           ||||||||
Sbjct: 225 ttcttgtc 218

---

>ref|XM_483094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 453

 Score =  488 bits (246), Expect = e-134
 Identities = 276/286 (96%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 385

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 384 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 325

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
           ||| ||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 324 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 265

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 264 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 205

                                                         
Query: 471 gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
           ||||||||| |||||||| ||||||||||||||||||| |||||||
Sbjct: 204 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttc 159

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  488 bits (246), Expect = e-134
 Identities = 276/286 (96%)
 Strand = Plus / Minus

                                                                            
Query: 231      ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24254615 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 24254556

                                                                            
Query: 291      gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 24254555 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 24254496

                                                                            
Query: 351      cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
                ||| ||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 24254495 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 24254436

                                                                            
Query: 411      catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
                |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 24254435 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 24254376

                                                              
Query: 471      gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
                ||||||||| |||||||| ||||||||||||||||||| |||||||
Sbjct: 24254375 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttc 24254330



 Score =  212 bits (107), Expect = 9e-52
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                            
Query: 232      gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 291
                |||||||||||||||||||| |  |||||||||||||| |||||||||||||||||| ||
Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054

                                                                            
Query: 292      aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 351
                |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994

                                                   
Query: 352      ctcgcgagcttggcggactcgccggcaagcttctc 386
                |  ||||||||||||| ||| ||| ||||||||||
Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagcttctc 24250959



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 107/127 (84%)
 Strand = Plus / Minus

                                                                            
Query: 377      caagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggaga 436
                ||||||||| ||||||| ||||||||||||||||||| |||||||||||||| ||||| |
Sbjct: 21802133 caagcttcttgaagatgccgttgatgaaggagttcataatggacatggccttagaggata 21802074

                                                                            
Query: 437      tgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcga 496
                |||| |||| |   || | || ||| || |||||||| || ||||||||||| ||||| |
Sbjct: 21802073 tgccaatgttcatatgtatctacttcagtaccttgaacatatagatcttgtatgtctcca 21802014

                       
Query: 497      cgctctt 503
                | |||||
Sbjct: 21802013 cactctt 21802007



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                            
Query: 382      ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 441
                ||||||| ||| || ||||||||||||||||||||||||||| ||||||| || ||||| 
Sbjct: 11770130 ttctcgaggatttcattgatgaaggagttcatgatggacatgaccttggacgatatgcca 11770189

                                                                            
Query: 442      atgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctc 501
                || ||| | |||| || ||  || |||||||| |||| ||||||||| ||||| |  |||
Sbjct: 11770190 atatccagatgcatctactccagtaccttgaatatgtcgatcttgtatgtctcaatactc 11770249

                      
Query: 502      ttcttg 507
                ||||||
Sbjct: 11770250 ttcttg 11770255



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                   
Query: 397      ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
                |||||||||||||||||||||||| |  |||||| ||| |||| |||||||
Sbjct: 17523219 ttgatgaaggagttcatgatggacgtaaccttgggggatatgctgatgtcc 17523269



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 379      agcttctcgaagatgtcgttgatgaaggagttcatg 414
                |||||||||||||||| | ||| |||||||||||||
Sbjct: 11729270 agcttctcgaagatgttgatgaagaaggagttcatg 11729305



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 472      aagatgtagatcttgtacgtctc 494
                |||||||||||||||||||||||
Sbjct: 13970925 aagatgtagatcttgtacgtctc 13970947



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 43/49 (87%), Gaps = 3/49 (6%)
 Strand = Plus / Plus

                                                                 
Query: 456      ctgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttc 504
                |||||| ||||||||||||||   ||||||||| |||||||| ||||||
Sbjct: 11729347 ctgctttagcaccttgaagat---gatcttgtaagtctcgacactcttc 11729392



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 467     ccttgaagatgtagatcttgtacgtctcgacgctc 501
               |||| ||||||||||||||||| ||||| ||||||
Sbjct: 2876125 cctttaagatgtagatcttgtaggtctctacgctc 2876159



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 379      agcttctcgaagatgtcgttgatgaa 404
                ||||||||||||||||| ||||||||
Sbjct: 19095814 agcttctcgaagatgtctttgatgaa 19095839



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 382      ttctcgaagatgtcgttgatgaagga 407
                |||||||||||||||||| |||||||
Sbjct: 15287651 ttctcgaagatgtcgttggtgaagga 15287626



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 381      cttctcgaagatgtcgttgatgaa 404
                ||||||||||||||| ||||||||
Sbjct: 13969661 cttctcgaagatgtcattgatgaa 13969684

---

>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0605H02
          Length = 175547

 Score =  488 bits (246), Expect = e-134
 Identities = 276/286 (96%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120954 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 120895

                                                                          
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 120894 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 120835

                                                                          
Query: 351    cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
              ||| ||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 120834 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 120775

                                                                          
Query: 411    catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
              |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 120774 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 120715

                                                            
Query: 471    gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
              ||||||||| |||||||| ||||||||||||||||||| |||||||
Sbjct: 120714 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttc 120669



 Score =  212 bits (107), Expect = 9e-52
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                          
Query: 232    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 291
              |||||||||||||||||||| |  |||||||||||||| |||||||||||||||||| ||
Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393

                                                                          
Query: 292    aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 351
              |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333

                                                 
Query: 352    ctcgcgagcttggcggactcgccggcaagcttctc 386
              |  ||||||||||||| ||| ||| ||||||||||
Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagcttctc 117298

---

>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence
          Length = 564

 Score =  482 bits (243), Expect = e-133
 Identities = 282/295 (95%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 404 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 345

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           ||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 344 ctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggctt 285

                                                                       
Query: 342 cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
           ||||||||||| |||||||||||||| |||| |||| |||||||||||||||||||||||
Sbjct: 284 cttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 225

                                                                       
Query: 402 gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 224 gaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctgctt 165

                                                                  
Query: 462 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
            |||||||||||||||||||||||||| ||||| ||||||||||||  |||||||
Sbjct: 164 cagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttc 110

---

>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221)
          Length = 653

 Score =  482 bits (243), Expect = e-133
 Identities = 282/295 (95%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 470 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 411

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           ||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 410 ctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtgggctt 351

                                                                       
Query: 342 cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
           ||||||||||| |||||||||||||| |||| |||| |||||||||||||||||||||||
Sbjct: 350 cttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgat 291

                                                                       
Query: 402 gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 290 gaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctgctt 231

                                                                  
Query: 462 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
            |||||||||||||||||||||||||| ||||| ||||||||||||  |||||||
Sbjct: 230 cagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttc 176

---

>ref|NM_184399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  476 bits (240), Expect = e-131
 Identities = 276/288 (95%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 336

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           || | |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 335 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 216

                                                           
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
           |||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  476 bits (240), Expect = e-131
 Identities = 276/288 (95%)
 Strand = Plus / Plus

                                                                           
Query: 229     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
               |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2819242 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 2819301

                                                                           
Query: 289     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 2819302 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 2819361

                                                                           
Query: 349     tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
               || | |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 2819362 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2819421

                                                                           
Query: 409     ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
               |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 2819422 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2819481

                                                               
Query: 469     ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
               |||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 2819482 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2819529



 Score =  468 bits (236), Expect = e-129
 Identities = 275/288 (95%)
 Strand = Plus / Minus

                                                                           
Query: 229     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2673933 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 2673874

                                                                           
Query: 289     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2673873 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2673814

                                                                           
Query: 349     tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
               || |  ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 2673813 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 2673754

                                                                           
Query: 409     ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
               ||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||
Sbjct: 2673753 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 2673694

                                                               
Query: 469     ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
               |||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 2673693 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2673646



 Score =  466 bits (235), Expect = e-128
 Identities = 280/295 (94%)
 Strand = Plus / Plus

                                                                           
Query: 222     ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
               |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 2837046 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 2837105

                                                                           
Query: 282     ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 2837106 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 2837165

                                                                           
Query: 342     cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
               ||||||||| | |||||||||||||||||| ||||| |||||||||||||| || |||||
Sbjct: 2837166 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 2837225

                                                                           
Query: 402     gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
               ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 2837226 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 2837285

                                                                      
Query: 462     gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
               ||||||||||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 2837286 gagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2837340



 Score =  464 bits (234), Expect = e-127
 Identities = 279/294 (94%)
 Strand = Plus / Minus

                                                                           
Query: 229     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
               |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2686256 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 2686197

                                                                           
Query: 289     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2686196 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 2686137

                                                                           
Query: 349     tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
               || |  ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 2686136 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 2686077

                                                                           
Query: 409     ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
               |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 2686076 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 2686017

                                                                     
Query: 469     ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcccc 522
               |||||||||||||||||||| ||||||||||||||||| | ||||||| |||||
Sbjct: 2686016 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctcccc 2685963



 Score =  460 bits (232), Expect = e-126
 Identities = 262/272 (96%)
 Strand = Plus / Plus

                                                                           
Query: 235     aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2843672 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 2843731

                                                                           
Query: 295     acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 354
               |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 2843732 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 2843791

                                                                           
Query: 355     gcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatg 414
               ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2843792 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 2843851

                                                                           
Query: 415     atggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaag 474
               |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 2843852 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 2843911

                                               
Query: 475     atgtagatcttgtacgtctcgacgctcttctt 506
               |||||||||||||| |||||||||||||||||
Sbjct: 2843912 atgtagatcttgtaggtctcgacgctcttctt 2843943



 Score =  458 bits (231), Expect = e-126
 Identities = 264/275 (96%)
 Strand = Plus / Plus

                                                                           
Query: 232     gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 291
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2856608 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 2856667

                                                                           
Query: 292     aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 351
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 2856668 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 2856727

                                                                           
Query: 352     ctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttc 411
               |  ||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 2856728 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 2856787

                                                                           
Query: 412     atgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttg 471
               ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 2856788 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 2856847

                                                  
Query: 472     aagatgtagatcttgtacgtctcgacgctcttctt 506
               ||||||||||||||||| |||||||||||||||||
Sbjct: 2856848 aagatgtagatcttgtaggtctcgacgctcttctt 2856882



 Score =  454 bits (229), Expect = e-124
 Identities = 277/293 (94%)
 Strand = Plus / Minus

                                                                           
Query: 229     gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
               |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2871648 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 2871589

                                                                           
Query: 289     gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2871588 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 2871529

                                                                           
Query: 349     tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
               || |  ||||||||||||| |||| |||| ||||||||||||||||||||||||||||||
Sbjct: 2871528 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 2871469

                                                                           
Query: 409     ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
               |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 2871468 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 2871409

                                                                    
Query: 469     ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccc 521
               |||||||||||||||||||| ||||||||||||||||| | ||||||| ||||
Sbjct: 2871408 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccc 2871356



 Score =  363 bits (183), Expect = 4e-97
 Identities = 272/303 (89%), Gaps = 9/303 (2%)
 Strand = Plus / Plus

                                                                            
Query: 231      ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793

                                                                            
Query: 291      gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
                ||||||||||||||||||||||| |||||| |||||||||  | ||||||||||||||||
Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853

                                                                            
Query: 351      cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
                 |  ||||| | ||||| |||    || ||||||||||||||||||||||||||||||||
Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913

                                                                            
Query: 411      catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
                |||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 17421914 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 17421973

                                                                            
Query: 471      gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtc 530
                ||||||||||||         ||||||||||||||| | ||||||| |||||||||||||
Sbjct: 17421974 gaagatgtagat---------ctcgacgctcttcttcgccttcttcctccccttcttgtc 17422024

                   
Query: 531      gcc 533
                |||
Sbjct: 17422025 gcc 17422027



 Score =  349 bits (176), Expect = 6e-93
 Identities = 275/308 (89%)
 Strand = Plus / Plus

                                                                            
Query: 226      gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
                ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 36007436 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 36007495

                                                                            
Query: 286      ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
                ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 36007496 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 36007555

                                                                            
Query: 346      ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
                ||||| |  |||||   ||||| |||   ||| |||||||||||||| ||||||||||| 
Sbjct: 36007556 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 36007615

                                                                            
Query: 406      gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
                ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 36007616 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 36007675

                                                                            
Query: 466      accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
                |||||||| ||||||||||| || || |||||||||||||||| ||||||||||||||||
Sbjct: 36007676 accttgaaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttc 36007735

                        
Query: 526      ttgtcgcc 533
                || |||||
Sbjct: 36007736 ttctcgcc 36007743



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                                  
Query: 378      aagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggcct 427
                |||||||||||| | ||||||||||||||| |||||||| ||||||||||
Sbjct: 30942126 aagcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 481      atcttgtacgtctcgacgctcttcttg 507
                ||||||||||||||||| |||||||||
Sbjct: 19540170 atcttgtacgtctcgacactcttcttg 19540196



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 464      gcaccttgaagatgtagatcttgtac 489
                ||||||||||||||| ||||||||||
Sbjct: 30476512 gcaccttgaagatgttgatcttgtac 30476487



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 463      agcaccttgaagatgtagatcttgta 488
                |||||||||||||| |||||||||||
Sbjct: 12269803 agcaccttgaagatatagatcttgta 12269778



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 382   ttctcgaagatgtcgttgatgaaggagtt 410
             |||| |||||||||||||||||| |||||
Sbjct: 80259 ttcttgaagatgtcgttgatgaatgagtt 80287



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 465      caccttgaagatgtagatct 484
                ||||||||||||||||||||
Sbjct: 20051339 caccttgaagatgtagatct 20051320

---

>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0030H07
          Length = 168253

 Score =  476 bits (240), Expect = e-131
 Identities = 276/288 (95%)
 Strand = Plus / Plus

                                                                         
Query: 229   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
             |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 26240 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 26299

                                                                         
Query: 289   gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 26300 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 26359

                                                                         
Query: 349   tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
             || | |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 26360 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 26419

                                                                         
Query: 409   ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
             |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 26420 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 26479

                                                             
Query: 469   ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
             |||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 26480 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 26527



 Score =  466 bits (235), Expect = e-128
 Identities = 280/295 (94%)
 Strand = Plus / Plus

                                                                         
Query: 222   ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
             |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 44044 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 44103

                                                                         
Query: 282   ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 44104 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 44163

                                                                         
Query: 342   cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
             ||||||||| | |||||||||||||||||| ||||| |||||||||||||| || |||||
Sbjct: 44164 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 44223

                                                                         
Query: 402   gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
             ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 44224 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 44283

                                                                    
Query: 462   gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
             ||||||||||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 44284 gagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 44338



 Score =  460 bits (232), Expect = e-126
 Identities = 262/272 (96%)
 Strand = Plus / Plus

                                                                         
Query: 235   aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50670 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 50729

                                                                         
Query: 295   acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 354
             |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 50730 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 50789

                                                                         
Query: 355   gcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatg 414
             ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 50790 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 50849

                                                                         
Query: 415   atggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaag 474
             |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 50850 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 50909

                                             
Query: 475   atgtagatcttgtacgtctcgacgctcttctt 506
             |||||||||||||| |||||||||||||||||
Sbjct: 50910 atgtagatcttgtaggtctcgacgctcttctt 50941



 Score =  458 bits (231), Expect = e-126
 Identities = 264/275 (96%)
 Strand = Plus / Plus

                                                                         
Query: 232   gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 291
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 63606 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 63665

                                                                         
Query: 292   aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 351
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 63666 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 63725

                                                                         
Query: 352   ctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttc 411
             |  ||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 63726 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 63785

                                                                         
Query: 412   atgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttg 471
             ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 63786 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 63845

                                                
Query: 472   aagatgtagatcttgtacgtctcgacgctcttctt 506
             ||||||||||||||||| |||||||||||||||||
Sbjct: 63846 aagatgtagatcttgtaggtctcgacgctcttctt 63880



 Score =  454 bits (229), Expect = e-124
 Identities = 277/293 (94%)
 Strand = Plus / Minus

                                                                         
Query: 229   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
             |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 78646 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 78587

                                                                         
Query: 289   gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 78586 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 78527

                                                                         
Query: 349   tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
             || |  ||||||||||||| |||| |||| ||||||||||||||||||||||||||||||
Sbjct: 78526 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 78467

                                                                         
Query: 409   ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
             |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 78466 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 78407

                                                                  
Query: 469   ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccc 521
             |||||||||||||||||||| ||||||||||||||||| | ||||||| ||||
Sbjct: 78406 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccc 78354

---

>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0009G03
          Length = 163526

 Score =  476 bits (240), Expect = e-131
 Identities = 276/288 (95%)
 Strand = Plus / Plus

                                                                          
Query: 229    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
              |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124919 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgccg 124978

                                                                          
Query: 289    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 124979 gggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgttg 125038

                                                                          
Query: 349    tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
              || | |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 125039 tagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 125098

                                                                          
Query: 409    ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
              |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 125099 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 125158

                                                              
Query: 469    ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
              |||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 125159 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 125206



 Score =  466 bits (235), Expect = e-128
 Identities = 280/295 (94%)
 Strand = Plus / Plus

                                                                          
Query: 222    ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
              |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 142723 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 142782

                                                                          
Query: 282    ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 142783 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 142842

                                                                          
Query: 342    cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
              ||||||||| | |||||||||||||||||| ||||| |||||||||||||| || |||||
Sbjct: 142843 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 142902

                                                                          
Query: 402    gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
              ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 142903 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 142962

                                                                     
Query: 462    gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
              ||||||||||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 142963 gagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 143017



 Score =  460 bits (232), Expect = e-126
 Identities = 262/272 (96%)
 Strand = Plus / Plus

                                                                          
Query: 235    aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149349 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 149408

                                                                          
Query: 295    acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 354
              |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 149409 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 149468

                                                                          
Query: 355    gcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatg 414
              ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 149469 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 149528

                                                                          
Query: 415    atggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaag 474
              |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 149529 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 149588

                                              
Query: 475    atgtagatcttgtacgtctcgacgctcttctt 506
              |||||||||||||| |||||||||||||||||
Sbjct: 149589 atgtagatcttgtaggtctcgacgctcttctt 149620



 Score =  458 bits (231), Expect = e-126
 Identities = 264/275 (96%)
 Strand = Plus / Plus

                                                                          
Query: 232    gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 291
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 162285 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 162344

                                                                          
Query: 292    aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 351
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 162345 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 162404

                                                                          
Query: 352    ctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttc 411
              |  ||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 162405 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 162464

                                                                          
Query: 412    atgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttg 471
              ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 162465 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 162524

                                                 
Query: 472    aagatgtagatcttgtacgtctcgacgctcttctt 506
              ||||||||||||||||| |||||||||||||||||
Sbjct: 162525 aagatgtagatcttgtaggtctcgacgctcttctt 162559

---

>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA
           sequence
          Length = 940

 Score =  474 bits (239), Expect = e-130
 Identities = 275/287 (95%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 779 ctaggatgaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggcgag 720

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 719 ctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggctt 660

                                                                       
Query: 342 cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
           ||||||||| |  ||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 659 cttgttgtagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgttgat 600

                                                                       
Query: 402 gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 599 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 540

                                                          
Query: 462 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttgg 508
           ||||||||||||||||||||||||||||||||| |||| ||||||||
Sbjct: 539 gagcaccttgaagatgtagatcttgtacgtctccacgcccttcttgg 493

---

>ref|NM_184371.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  468 bits (236), Expect = e-129
 Identities = 275/288 (95%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           || |  ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 276

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           ||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 216

                                                           
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
           |||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168

---

>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA
           sequence
          Length = 764

 Score =  468 bits (236), Expect = e-129
 Identities = 290/308 (94%)
 Strand = Plus / Minus

                                                                       
Query: 226 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
           ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 548 gacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcg 489

                                                                       
Query: 286 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 488 ccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 429

                                                                       
Query: 346 ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
           |||||||  ||||||||||||| |||  |||| |||||||||||||||||||||||||||
Sbjct: 428 ttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 369

                                                                       
Query: 406 gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
           ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || 
Sbjct: 368 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagg 309

                                                                       
Query: 466 accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
           ||||||||||||||||||||||| ||||| ||||||||||| | ||||||| | ||||||
Sbjct: 308 accttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttcctacccttc 249

                   
Query: 526 ttgtcgcc 533
           ||||||||
Sbjct: 248 ttgtcgcc 241

---

>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0434B04
          Length = 167029

 Score =  468 bits (236), Expect = e-129
 Identities = 275/288 (95%)
 Strand = Plus / Minus

                                                                          
Query: 229    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 123708 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 123649

                                                                          
Query: 289    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 123648 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 123589

                                                                          
Query: 349    tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
              || |  ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 123588 tagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggag 123529

                                                                          
Query: 409    ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
              ||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||
Sbjct: 123528 ttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcacc 123469

                                                              
Query: 469    ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
              |||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 123468 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 123421



 Score =  464 bits (234), Expect = e-127
 Identities = 279/294 (94%)
 Strand = Plus / Minus

                                                                          
Query: 229    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
              |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 136031 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 135972

                                                                          
Query: 289    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135971 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 135912

                                                                          
Query: 349    tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
              || |  ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 135911 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 135852

                                                                          
Query: 409    ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
              |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 135851 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 135792

                                                                    
Query: 469    ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcccc 522
              |||||||||||||||||||| ||||||||||||||||| | ||||||| |||||
Sbjct: 135791 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctcccc 135738

---

>ref|NM_184403.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  466 bits (235), Expect = e-128
 Identities = 280/295 (94%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 462 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 403

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 343

                                                                       
Query: 342 cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
           ||||||||| | |||||||||||||||||| ||||| |||||||||||||| || |||||
Sbjct: 342 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 283

                                                                       
Query: 402 gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
           ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 282 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 223

                                                                  
Query: 462 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
           ||||||||||||||||||||||||||| ||||||||||||||||| | |||||||
Sbjct: 222 gagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168

---

>ref|NM_184374.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  464 bits (234), Expect = e-127
 Identities = 279/294 (94%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           |||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 455 gaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccg 396

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 336

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           || |  ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 335 tagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaaggag 276

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 275 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcacc 216

                                                                 
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcccc 522
           |||||||||||||||||||| ||||||||||||||||| | ||||||| |||||
Sbjct: 215 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctcccc 162

---

>ref|NM_184405.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  460 bits (232), Expect = e-126
 Identities = 262/272 (96%)
 Strand = Plus / Minus

                                                                       
Query: 235 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 390

                                                                       
Query: 295 acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 354
           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 389 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 330

                                                                       
Query: 355 gcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatg 414
           ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 329 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 270

                                                                       
Query: 415 atggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaag 474
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 269 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 210

                                           
Query: 475 atgtagatcttgtacgtctcgacgctcttctt 506
           |||||||||||||| |||||||||||||||||
Sbjct: 209 atgtagatcttgtaggtctcgacgctcttctt 178

---

>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds
          Length = 552

 Score =  460 bits (232), Expect = e-126
 Identities = 262/272 (96%)
 Strand = Plus / Minus

                                                                       
Query: 235 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 aacttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggagg 406

                                                                       
Query: 295 acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 354
           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |  
Sbjct: 405 acgaggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgg 346

                                                                       
Query: 355 gcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatg 414
           ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 345 gcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatg 286

                                                                       
Query: 415 atggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaag 474
           |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 285 atggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaag 226

                                           
Query: 475 atgtagatcttgtacgtctcgacgctcttctt 506
           |||||||||||||| |||||||||||||||||
Sbjct: 225 atgtagatcttgtaggtctcgacgctcttctt 194

---

>ref|NM_184407.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 462

 Score =  458 bits (231), Expect = e-126
 Identities = 264/275 (96%)
 Strand = Plus / Minus

                                                                       
Query: 232 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 291
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 452 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccgggg 393

                                                                       
Query: 292 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 351
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 392 aggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttgttgtag 333

                                                                       
Query: 352 ctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttc 411
           |  ||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||
Sbjct: 332 cgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggagttc 273

                                                                       
Query: 412 atgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttg 471
           ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 272 atgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcaccttg 213

                                              
Query: 472 aagatgtagatcttgtacgtctcgacgctcttctt 506
           ||||||||||||||||| |||||||||||||||||
Sbjct: 212 aagatgtagatcttgtaggtctcgacgctcttctt 178

---

>ref|XM_475912.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  456 bits (230), Expect = e-125
 Identities = 266/278 (95%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 452 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 393

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 392 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           || |  ||||||||||||| |||| |||| ||||||||||||||||||||||||||||||
Sbjct: 332 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 273

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||
Sbjct: 272 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 213

                                                 
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttctt 506
           |||||||||||||||||||| ||||| |||||||||||
Sbjct: 212 ttgaagatgtagatcttgtaggtctccacgctcttctt 175

---

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score =  456 bits (230), Expect = e-125
 Identities = 266/278 (95%)
 Strand = Plus / Minus

                                                                          
Query: 229    gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176400 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 176341

                                                                          
Query: 289    gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 176340 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 176281

                                                                          
Query: 349    tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
              || |  ||||||||||||| |||| |||| ||||||||||||||||||||||||||||||
Sbjct: 176280 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 176221

                                                                          
Query: 409    ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
              |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||
Sbjct: 176220 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 176161

                                                    
Query: 469    ttgaagatgtagatcttgtacgtctcgacgctcttctt 506
              |||||||||||||||||||| ||||| |||||||||||
Sbjct: 176160 ttgaagatgtagatcttgtaggtctccacgctcttctt 176123

---

>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08,
             complete sequence
          Length = 119500

 Score =  456 bits (230), Expect = e-125
 Identities = 266/278 (95%)
 Strand = Plus / Minus

                                                                         
Query: 229   gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27082 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 27023

                                                                         
Query: 289   gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 27022 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 26963

                                                                         
Query: 349   tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
             || |  ||||||||||||| |||| |||| ||||||||||||||||||||||||||||||
Sbjct: 26962 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 26903

                                                                         
Query: 409   ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
             |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||
Sbjct: 26902 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 26843

                                                   
Query: 469   ttgaagatgtagatcttgtacgtctcgacgctcttctt 506
             |||||||||||||||||||| ||||| |||||||||||
Sbjct: 26842 ttgaagatgtagatcttgtaggtctccacgctcttctt 26805

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  456 bits (230), Expect = e-125
 Identities = 266/278 (95%)
 Strand = Plus / Minus

                                                                            
Query: 229      gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28392158 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 28392099

                                                                            
Query: 289      gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 28392098 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 28392039

                                                                            
Query: 349      tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
                || |  ||||||||||||| |||| |||| ||||||||||||||||||||||||||||||
Sbjct: 28392038 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 28391979

                                                                            
Query: 409      ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
                |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||
Sbjct: 28391978 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaacc 28391919

                                                      
Query: 469      ttgaagatgtagatcttgtacgtctcgacgctcttctt 506
                |||||||||||||||||||| ||||| |||||||||||
Sbjct: 28391918 ttgaagatgtagatcttgtaggtctccacgctcttctt 28391881



 Score =  357 bits (180), Expect = 2e-95
 Identities = 276/308 (89%)
 Strand = Plus / Minus

                                                                            
Query: 223      taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 282
                ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 22480470 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 22480411

                                                                            
Query: 283      tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 342
                ||||||||||||||||| || || |||||||||||||| ||||||||||| |||||||||
Sbjct: 22480410 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 22480351

                                                                            
Query: 343      ttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatg 402
                ||||||||||| || ||| | |||| |||     | ||||||||||| |||||||||| |
Sbjct: 22480350 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 22480291

                                                                            
Query: 403      aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
                ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 22480290 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 22480231

                                                                            
Query: 463      agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcccc 522
                |||||||||||||||||||| || || ||||| ||||| ||||| | |||||||||||||
Sbjct: 22480230 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttcccc 22480171

                        
Query: 523      ttcttgtc 530
                ||||||||
Sbjct: 22480170 ttcttgtc 22480163



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 379     agcttctcgaagatgtcgttgatgaa 404
               ||||||||||||||||||||||||||
Sbjct: 3720744 agcttctcgaagatgtcgttgatgaa 3720769



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 455     cctgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttg 507
               |||||||  ||||||||||||||||||| ||||| ||||| |  |||||||||
Sbjct: 6896155 cctgcttctgcaccttgaagatgtagatattgtaggtctccatactcttcttg 6896207



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                           
Query: 377     caagcttctcgaagatgtcgttgatgaa 404
               ||||||||||||||||||| ||||||||
Sbjct: 6238960 caagcttctcgaagatgtctttgatgaa 6238933



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 465      caccttgaagatgtagatcttgt 487
                |||||||||||||||||||||||
Sbjct: 25447111 caccttgaagatgtagatcttgt 25447133



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 379      agcttctcgaagatgtcgttgatgaa 404
                ||||||||| ||||||||||||||||
Sbjct: 29356936 agcttctcggagatgtcgttgatgaa 29356961



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 379      agcttctcgaagatgtcgttgatgaa 404
                |||||||||||||||||||| |||||
Sbjct: 18422088 agcttctcgaagatgtcgttaatgaa 18422063

---

>ref|NM_184409.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 468

 Score =  454 bits (229), Expect = e-124
 Identities = 277/293 (94%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 461 gaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgccg 402

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 401 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 342

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           || |  ||||||||||||| |||| |||| ||||||||||||||||||||||||||||||
Sbjct: 341 tagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaaggag 282

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 281 ttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcacc 222

                                                                
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccc 521
           |||||||||||||||||||| ||||||||||||||||| | ||||||| ||||
Sbjct: 221 ttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccc 169

---

>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds
          Length = 678

 Score =  454 bits (229), Expect = e-124
 Identities = 286/305 (93%)
 Strand = Plus / Minus

                                                                       
Query: 226 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
           ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 481 gacgaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcg 422

                                                                       
Query: 286 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 421 ccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 362

                                                                       
Query: 346 ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
           |||||||  ||||||||||||| |||  |||| |||||||||||||||||||||||||||
Sbjct: 361 ttgtaccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 302

                                                                       
Query: 406 gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
           ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| || 
Sbjct: 301 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcagg 242

                                                                       
Query: 466 accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
           ||||||||||||||||||||||| ||||| ||||||||||| | ||||||| | ||||||
Sbjct: 241 accttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttcctacccttc 182

                
Query: 526 ttgtc 530
           |||||
Sbjct: 181 ttgtc 177

---

>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence
          Length = 789

 Score =  450 bits (227), Expect = e-123
 Identities = 284/303 (93%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||
Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
           ||  |||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           |||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||
Sbjct: 342 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacctt 283

                                                                       
Query: 471 gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtc 530
           |||||||||||| ||||| ||||| ||||||||||||| |||||||||||||||||| ||
Sbjct: 282 gaagatgtagattttgtaggtctccacgctcttcttggccttcttcttccccttcttctc 223

              
Query: 531 gcc 533
           |||
Sbjct: 222 gcc 220

---

>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4)
          Length = 2361

 Score =  442 bits (223), Expect = e-121
 Identities = 280/299 (93%)
 Strand = Plus / Minus

                                                                        
Query: 235  aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
            |||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 1365 aacttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaagg 1306

                                                                        
Query: 295  acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 354
            |||||||| || || |||||||||||||||||||| |||||||||||||||||||| |  
Sbjct: 1305 acgaggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgg 1246

                                                                        
Query: 355  gcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatg 414
            ||||||||||||| |||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 1245 gcgagcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatg 1186

                                                                        
Query: 415  atggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaag 474
            ||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 1185 atggacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaag 1126

                                                                       
Query: 475  atgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtcgcc 533
            |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||
Sbjct: 1125 atgtagatcttgtacgtctcgacgctcttcttggccttcttcttccccttcttctcgcc 1067

---

>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence
          Length = 836

 Score =  426 bits (215), Expect = e-116
 Identities = 281/303 (92%)
 Strand = Plus / Minus

                                                                       
Query: 226 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
           ||||| |||||||||||||| ||||| ||||| || ||||||||||||||||||||||||
Sbjct: 548 gacgaagtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcg 489

                                                                       
Query: 286 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
           ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 488 ccgggtaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttg 429

                                                                       
Query: 346 ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
           ||||| |  ||||||||||||| |||  |||| |||||||||||||||||||||||||||
Sbjct: 428 ttgtagcgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaag 369

                                                                       
Query: 406 gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
           || ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 368 gaattcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagc 309

                                                                       
Query: 466 accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
           ||||||||||||||||||||||| ||||| |||||||||||||  |||||||| ||||||
Sbjct: 308 accttgaagatgtagatcttgtaggtctccacgctcttcttggctttcttcttgcccttc 249

              
Query: 526 ttg 528
           |||
Sbjct: 248 ttg 246

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  426 bits (215), Expect = e-116
 Identities = 281/303 (92%)
 Strand = Plus / Minus

                                                                           
Query: 231     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265

                                                                           
Query: 291     gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205

                                                                           
Query: 351     cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
                |  |||||   ||||| |||    || ||||||||||||||||||||||||||||||||
Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145

                                                                           
Query: 411     catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
               |||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||
Sbjct: 9465144 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9465085

                                                                           
Query: 471     gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtc 530
               |||||||||||||||||| ||||||||||||||||| | ||||||| |||||||||||||
Sbjct: 9465084 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccccttcttgtc 9465025

                  
Query: 531     gcc 533
               |||
Sbjct: 9465024 gcc 9465022



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 96/114 (84%)
 Strand = Plus / Plus

                                                                            
Query: 381      cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 440
                ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| |||||
Sbjct: 11567062 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgcc 11567121

                                                                      
Query: 441      gatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctc 494
                 |||||| | |  | ||  || || |||||||| ||||||||||| ||||||||
Sbjct: 11567122 aatgtccagatttatctatttcagtaccttgaatatgtagatcttatacgtctc 11567175



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                            
Query: 466      accttgaagatgtagatcttgtacgtct 493
                ||||||||||||||||||||||||||||
Sbjct: 25627644 accttgaagatgtagatcttgtacgtct 25627671



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 379      agcttctcgaagatgtcgttgatgaaggagttcatg 414
                ||||||||||||||||||  ||||||||||||||||
Sbjct: 25627559 agcttctcgaagatgtcgaggatgaaggagttcatg 25627594



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 465      caccttgaagatgtagatcttgtacgtctcgacgctcttcttgg 508
                ||||||||| |||||||||||||| |||| |||  |||||||||
Sbjct: 28216459 caccttgaaaatgtagatcttgtaggtcttgactatcttcttgg 28216416



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 469      ttgaagatgtagatcttgtacgtct 493
                |||||||||||||||||||| ||||
Sbjct: 27003474 ttgaagatgtagatcttgtaggtct 27003450



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 468      cttgaagatgtagatcttgtacgtc 492
                |||||||||||||||||| ||||||
Sbjct: 24070005 cttgaagatgtagatcttatacgtc 24069981



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 465      caccttgaagatgtagatct 484
                ||||||||||||||||||||
Sbjct: 27003565 caccttgaagatgtagatct 27003546



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 39/44 (88%), Gaps = 1/44 (2%)
 Strand = Plus / Plus

                                                            
Query: 377      caagcttctcgaagatgtcgttgat-gaaggagttcatgatgga 419
                |||||||||| ||||||||  |||| |||||||||| |||||||
Sbjct: 20077935 caagcttctccaagatgtcaatgattgaaggagttcttgatgga 20077978



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 500      tcttcttggacttcttcttc 519
                ||||||||||||||||||||
Sbjct: 17550840 tcttcttggacttcttcttc 17550821

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  426 bits (215), Expect = e-116
 Identities = 281/303 (92%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665

                                                                          
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605

                                                                          
Query: 351    cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
               |  |||||   ||||| |||    || ||||||||||||||||||||||||||||||||
Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545

                                                                          
Query: 411    catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
              |||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||
Sbjct: 162544 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 162485

                                                                          
Query: 471    gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtc 530
              |||||||||||||||||| ||||||||||||||||| | ||||||| |||||||||||||
Sbjct: 162484 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccccttcttgtc 162425

                 
Query: 531    gcc 533
              |||
Sbjct: 162424 gcc 162422

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  426 bits (215), Expect = e-116
 Identities = 281/303 (92%)
 Strand = Plus / Minus

                                                                           
Query: 231     ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386

                                                                           
Query: 291     gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326

                                                                           
Query: 351     cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
                |  |||||   ||||| |||    || ||||||||||||||||||||||||||||||||
Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266

                                                                           
Query: 411     catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
               |||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||
Sbjct: 9463265 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9463206

                                                                           
Query: 471     gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtc 530
               |||||||||||||||||| ||||||||||||||||| | ||||||| |||||||||||||
Sbjct: 9463205 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttcctccccttcttgtc 9463146

                  
Query: 531     gcc 533
               |||
Sbjct: 9463145 gcc 9463143



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 96/114 (84%)
 Strand = Plus / Plus

                                                                            
Query: 381      cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 440
                ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| |||||
Sbjct: 11563825 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgcc 11563884

                                                                      
Query: 441      gatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctc 494
                 |||||| | |  | ||  || || |||||||| ||||||||||| ||||||||
Sbjct: 11563885 aatgtccagatttatctatttcagtaccttgaatatgtagatcttatacgtctc 11563938



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                            
Query: 466      accttgaagatgtagatcttgtacgtct 493
                ||||||||||||||||||||||||||||
Sbjct: 25718953 accttgaagatgtagatcttgtacgtct 25718980



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 379      agcttctcgaagatgtcgttgatgaaggagttcatg 414
                ||||||||||||||||||  ||||||||||||||||
Sbjct: 25718868 agcttctcgaagatgtcgaggatgaaggagttcatg 25718903



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 465      caccttgaagatgtagatcttgtacgtctcgacgctcttcttgg 508
                ||||||||| |||||||||||||| |||| |||  |||||||||
Sbjct: 28307783 caccttgaaaatgtagatcttgtaggtcttgactatcttcttgg 28307740



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 469      ttgaagatgtagatcttgtacgtct 493
                |||||||||||||||||||| ||||
Sbjct: 27094797 ttgaagatgtagatcttgtaggtct 27094773



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 468      cttgaagatgtagatcttgtacgtc 492
                |||||||||||||||||| ||||||
Sbjct: 23987474 cttgaagatgtagatcttatacgtc 23987450



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 465      caccttgaagatgtagatct 484
                ||||||||||||||||||||
Sbjct: 27094888 caccttgaagatgtagatct 27094869



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 39/44 (88%), Gaps = 1/44 (2%)
 Strand = Plus / Plus

                                                            
Query: 377      caagcttctcgaagatgtcgttgat-gaaggagttcatgatgga 419
                |||||||||| ||||||||  |||| |||||||||| |||||||
Sbjct: 20070963 caagcttctccaagatgtcaatgattgaaggagttcttgatgga 20071006



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 500      tcttcttggacttcttcttc 519
                ||||||||||||||||||||
Sbjct: 17544381 tcttcttggacttcttcttc 17544362

---

>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214)
          Length = 580

 Score =  418 bits (211), Expect = e-114
 Identities = 280/303 (92%)
 Strand = Plus / Minus

                                                                       
Query: 226 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
           |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 455 gacgaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcgagctcc 396

                                                                       
Query: 286 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
           ||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||
Sbjct: 395 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttg 336

                                                                       
Query: 346 ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
           ||||| | ||| ||||||||||||||| | || |||||||||||||||||||||||||||
Sbjct: 335 ttgtagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaag 276

                                                                       
Query: 406 gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
           |||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||
Sbjct: 275 gagttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagc 216

                                                                       
Query: 466 accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
           ||||||||||||||||||||||| ||||| |||  |||||| | |||||| |||||||||
Sbjct: 215 accttgaagatgtagatcttgtaggtctccacggacttcttcgccttctttttccccttc 156

              
Query: 526 ttg 528
           |||
Sbjct: 155 ttg 153

---

>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3)
          Length = 1728

 Score =  412 bits (208), Expect = e-112
 Identities = 277/300 (92%)
 Strand = Plus / Minus

                                                                       
Query: 229 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 489 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 430

                                                                       
Query: 289 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
           |||||||||||||| || |||||||||||||| |||||||||| ||||||||||||||| 
Sbjct: 429 gggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttcttgtta 370

                                                                       
Query: 349 tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
           || | ||| ||||||||||||||| | || ||||||||||||||||||||||||||||||
Sbjct: 369 tagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaaggag 310

                                                                       
Query: 409 ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
           ||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||
Sbjct: 309 ttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcacc 250

                                                                       
Query: 469 ttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttg 528
           |||||||||||||||||||| ||||| |||  |||||| |  ||||| ||||||||||||
Sbjct: 249 ttgaagatgtagatcttgtaggtctccacggacttcttcgctttctttttccccttcttg 190

---

>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence
          Length = 574

 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 306 ctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 247

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           ||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 246 ctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggctt 187

                                                                       
Query: 342 cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
           |||||| || | ||| |||||||||| |||  | || |||||||||||||| ||||| ||
Sbjct: 186 cttgttatagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgttaat 127

                                                                       
Query: 402 gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
           ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 126 gaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctgctt 67

                                                                      
Query: 462 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcc 520
            |||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||
Sbjct: 66  cagcaccttgaagatgtagatcttgtaggtctccacgctcttcttggccttcttcttcc 8

---

>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence
          Length = 568

 Score =  410 bits (207), Expect = e-111
 Identities = 279/303 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 ggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggg 267

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           |||||||||||| ||||||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 266 gaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggcttcttgttgta 207

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
           || ||| |||||||| | |||  | || ||||||||||||||||||||||||||||||||
Sbjct: 206 ccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttgatgaaggagtt 147

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           ||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||
Sbjct: 146 catgatggacatggccttggacgagatgccaatgtccgggtgcacctgcttcagcacctt 87

                                                                       
Query: 471 gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtc 530
           |||||||||||||||||||||||| ||   |||||| | |||||||||||||||||| ||
Sbjct: 86  gaagatgtagatcttgtacgtctccaccgacttctttgccttcttcttccccttcttctc 27

              
Query: 531 gcc 533
           |||
Sbjct: 26  gcc 24

---

>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence
          Length = 706

 Score =  410 bits (207), Expect = e-111
 Identities = 282/307 (91%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 514 ctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 455

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           ||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 454 ctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtaggctt 395

                                                                       
Query: 342 cttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgat 401
           |||||| || | |||||||||||||| |||  | || |||||||||||||| ||||| ||
Sbjct: 394 cttgttatagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgttaat 335

                                                                       
Query: 402 gaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgctt 461
           ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 334 gaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctgctt 275

                                                                       
Query: 462 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccc 521
            |||||||||||||||||||||||||| ||||| ||||||||||||  ||||||||| ||
Sbjct: 274 cagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttcttgcc 215

                  
Query: 522 cttcttg 528
           | |||||
Sbjct: 214 cctcttg 208

---

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  363 bits (183), Expect = 4e-97
 Identities = 272/303 (89%), Gaps = 9/303 (2%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185

                                                                         
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
             ||||||||||||||||||||||| |||||| |||||||||  | ||||||||||||||||
Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245

                                                                         
Query: 351   cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
              |  ||||| | ||||| |||    || ||||||||||||||||||||||||||||||||
Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305

                                                                         
Query: 411   catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
             |||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 75306 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 75365

                                                                         
Query: 471   gaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttcttgtc 530
             ||||||||||||         ||||||||||||||| | ||||||| |||||||||||||
Sbjct: 75366 gaagatgtagat---------ctcgacgctcttcttcgccttcttcctccccttcttgtc 75416

                
Query: 531   gcc 533
             |||
Sbjct: 75417 gcc 75419

---

>ref|XM_475367.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 375

 Score =  357 bits (180), Expect = 2e-95
 Identities = 276/308 (89%)
 Strand = Plus / Minus

                                                                       
Query: 223 taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 282
           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 374 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 315

                                                                       
Query: 283 tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 342
           ||||||||||||||||| || || |||||||||||||| ||||||||||| |||||||||
Sbjct: 314 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 255

                                                                       
Query: 343 ttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatg 402
           ||||||||||| || ||| | |||| |||     | ||||||||||| |||||||||| |
Sbjct: 254 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 195

                                                                       
Query: 403 aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
           ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 194 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 135

                                                                       
Query: 463 agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcccc 522
           |||||||||||||||||||| || || ||||| ||||| ||||| | |||||||||||||
Sbjct: 134 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttcccc 75

                   
Query: 523 ttcttgtc 530
           ||||||||
Sbjct: 74  ttcttgtc 67

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  357 bits (180), Expect = 2e-95
 Identities = 276/308 (89%)
 Strand = Plus / Minus

                                                                         
Query: 223   taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 282
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 69877 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 69818

                                                                         
Query: 283   tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 342
             ||||||||||||||||| || || |||||||||||||| ||||||||||| |||||||||
Sbjct: 69817 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 69758

                                                                         
Query: 343   ttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatg 402
             ||||||||||| || ||| | |||| |||     | ||||||||||| |||||||||| |
Sbjct: 69757 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 69698

                                                                         
Query: 403   aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
             ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||||
Sbjct: 69697 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 69638

                                                                         
Query: 463   agcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttcccc 522
             |||||||||||||||||||| || || ||||| ||||| ||||| | |||||||||||||
Sbjct: 69637 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttcccc 69578

                     
Query: 523   ttcttgtc 530
             ||||||||
Sbjct: 69577 ttcttgtc 69570

---

>ref|NM_190523.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 420

 Score =  349 bits (176), Expect = 6e-93
 Identities = 275/308 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
           ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 416 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 357

                                                                       
Query: 286 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
           ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 356 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 297

                                                                       
Query: 346 ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
           ||||| |  |||||   ||||| |||   ||| |||||||||||||| ||||||||||| 
Sbjct: 296 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 237

                                                                       
Query: 406 gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
           ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 236 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 177

                                                                       
Query: 466 accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
           |||||||| ||||||||||| || || |||||||||||||||| ||||||||||||||||
Sbjct: 176 accttgaaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttc 117

                   
Query: 526 ttgtcgcc 533
           || |||||
Sbjct: 116 ttctcgcc 109

---

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  349 bits (176), Expect = 6e-93
 Identities = 275/308 (89%)
 Strand = Plus / Plus

                                                                         
Query: 226   gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
             ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 20161 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 20220

                                                                         
Query: 286   ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
             ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 20221 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 20280

                                                                         
Query: 346   ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
             ||||| |  |||||   ||||| |||   ||| |||||||||||||| ||||||||||| 
Sbjct: 20281 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 20340

                                                                         
Query: 406   gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
             ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 20341 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 20400

                                                                         
Query: 466   accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
             |||||||| ||||||||||| || || |||||||||||||||| ||||||||||||||||
Sbjct: 20401 accttgaaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttc 20460

                     
Query: 526   ttgtcgcc 533
             || |||||
Sbjct: 20461 ttctcgcc 20468

---

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  349 bits (176), Expect = 6e-93
 Identities = 275/308 (89%)
 Strand = Plus / Plus

                                                                          
Query: 226    gacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 285
              ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 106114 gacgacgtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcg 106173

                                                                          
Query: 286    ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 345
              ||||||||||||||||| || |||||||||||||| |||||||||||||| |||||||||
Sbjct: 106174 ccggggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttg 106233

                                                                          
Query: 346    ttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaag 405
              ||||| |  |||||   ||||| |||   ||| |||||||||||||| ||||||||||| 
Sbjct: 106234 ttgtagcgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaac 106293

                                                                          
Query: 406    gagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagc 465
              ||||||||||| |||||||||||||| || || ||||| || || |||||||||||||| 
Sbjct: 106294 gagttcatgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgagg 106353

                                                                          
Query: 466    accttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttcttccccttc 525
              |||||||| ||||||||||| || || |||||||||||||||| ||||||||||||||||
Sbjct: 106354 accttgaaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttc 106413

                      
Query: 526    ttgtcgcc 533
              || |||||
Sbjct: 106414 ttctcgcc 106421

---

>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds
          Length = 410

 Score =  323 bits (163), Expect = 3e-85
 Identities = 193/203 (95%)
 Strand = Plus / Minus

                                                                       
Query: 232 gtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 291
           ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 203 gtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgagctcgccgggg 144

                                                                       
Query: 292 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 84

                                                                       
Query: 352 ctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttc 411
           || ||||||||||||||||| || || |  ||||||||||||||| ||||||||||||||
Sbjct: 83  ctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgatgaaggagttc 24

                                  
Query: 412 atgatggacatggccttggagga 434
           ||||||||||||||| |||||||
Sbjct: 23  atgatggacatggccctggagga 1

---

>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B
          Length = 492

 Score =  305 bits (154), Expect = 8e-80
 Identities = 244/274 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
            |  || ||   || || |||   ||| |||||||||||||||||||||||||| |||||
Sbjct: 332 gcgggccaggcgggaggcctcctgggccagcttctcgaagatgtcgttgatgaacgagtt 273

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           ||||||   ||| ||||||   ||||| |||||||||||||| |||||||| || |||||
Sbjct: 272 catgatccccatcgccttgctcgagatcccgatgtccgggtggacctgcttcaggacctt 213

                                             
Query: 471 gaagatgtagatcttgtacgtctcgacgctcttc 504
           |||||||||||||||||||||||| |||||||||
Sbjct: 212 gaagatgtagatcttgtacgtctccacgctcttc 179

---

>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds
          Length = 2901

 Score =  301 bits (152), Expect = 1e-78
 Identities = 248/280 (88%)
 Strand = Plus / Minus

                                                                        
Query: 239  tggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacga 298
            |||| ||||||||||| ||||||||||||||||||||||| |||||||| || | ||| |
Sbjct: 1985 tggtaacggccttggttccctcggagacggcgtgcttggcaagctcgcctggaaagacaa 1926

                                                                        
Query: 299  ggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcga 358
            |||| ||||  |||||||||||||| |||||||||||||||||||||||||| |  ||||
Sbjct: 1925 ggcgcacggcagtctggatctcccgagaggtgatggtgggcttcttgttgtagcgtgcga 1866

                                                                        
Query: 359  gcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatgg 418
            |||| || ||||| ||||| ||||||||||||||||||||||||| |||||| |||||||
Sbjct: 1865 gctttgccgactctccggcgagcttctcgaagatgtcgttgatgatggagttgatgatgg 1806

                                                                        
Query: 419  acatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgt 478
            |||| |  ||||||||||| || |||| |||||  | |||||||||||||||||||||||
Sbjct: 1805 acattgatttggaggagatacccatgttcgggtcaatctgcttgagcaccttgaagatgt 1746

                                                    
Query: 479  agatcttgtacgtctcgacgctcttcttggacttcttctt 518
            |||||||||||||||||  ||||||||||| |||||||||
Sbjct: 1745 agatcttgtacgtctcgttgctcttcttggccttcttctt 1706

---

>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds
          Length = 627

 Score =  289 bits (146), Expect = 5e-75
 Identities = 242/274 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||| ||||| | |||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
            |  || ||    | ||||||   ||| ||||||||||||||||||||||||||||||||
Sbjct: 399 gcgggccaggcgagaggactcctgggcgagcttctcgaagatgtcgttgatgaaggagtt 340

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           ||||||   ||||||||||   ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 339 catgatccccatggccttgctcgagatccctatgtccgggtggacctgcttcagcacctt 280

                                             
Query: 471 gaagatgtagatcttgtacgtctcgacgctcttc 504
           ||| |||||||||||||||||||| |||| ||||
Sbjct: 279 gaatatgtagatcttgtacgtctccacgcccttc 246

---

>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds
          Length = 427

 Score =  250 bits (126), Expect = 4e-63
 Identities = 135/138 (97%)
 Strand = Plus / Minus

                                                                       
Query: 379 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 438
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 141 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 82

                                                                       
Query: 439 ccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacg 498
           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 81  ccgatgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacg 22

                             
Query: 499 ctcttcttggacttcttc 516
           |||||||||| |||||||
Sbjct: 21  ctcttcttggccttcttc 4



 Score =  198 bits (100), Expect = 1e-47
 Identities = 115/120 (95%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           |||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170

---

>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds
          Length = 402

 Score =  240 bits (121), Expect = 4e-60
 Identities = 142/149 (95%)
 Strand = Plus / Minus

                                                                       
Query: 382 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 441
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 386 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 327

                                                                       
Query: 442 atgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctc 501
           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||  |
Sbjct: 326 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacggac 267

                                        
Query: 502 ttcttggacttcttcttccccttcttgtc 530
           ||||||  ||||||||||  |||||||||
Sbjct: 266 ttcttgttcttcttcttcgacttcttgtc 238

---

>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds
          Length = 375

 Score =  230 bits (116), Expect = 4e-57
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                       
Query: 382 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 441
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 359 ttctcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggagatgccg 300

                                                                       
Query: 442 atgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctc 501
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||  |
Sbjct: 299 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacggac 240

                                           
Query: 502 ttcttggacttcttcttccccttcttgtcgcc 533
           ||||| | ||||||||| |||||||| |||||
Sbjct: 239 ttctttgccttcttcttgcccttcttctcgcc 208

---

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score =  226 bits (114), Expect = 6e-56
 Identities = 228/266 (85%)
 Strand = Plus / Minus

                                                                        
Query: 229  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
            |||||||||||||| ||||||||||||||||| || || ||||||||||| |||||||||
Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152

                                                                        
Query: 289  gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
            || || || ||||| |||| |||||||||||| |||||||| | ||||||||||||||||
Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092

                                                                        
Query: 349  tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
            || |     ||||||| || ||||  ||| | |||||| ||||||||||||||||||  |
Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032

                                                                        
Query: 409  ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
            |||||||||||||||||||||  |  ||||||| |||| |||||||||||||||||||||
Sbjct: 4031 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3972

                                      
Query: 469  ttgaagatgtagatcttgtacgtctc 494
            ||| ||||||| | |||||| |||||
Sbjct: 3971 ttgtagatgtacagcttgtaggtctc 3946

---

>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds
          Length = 397

 Score =  220 bits (111), Expect = 4e-54
 Identities = 129/135 (95%)
 Strand = Plus / Minus

                                                                       
Query: 382 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 441
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 322

                                                                       
Query: 442 atgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctc 501
           ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 321 atgtcggggtggacctgcttgagcaccttgaaaatgtagatcttgtaggtctcgacgctc 262

                          
Query: 502 ttcttggacttcttc 516
           ||||||  |||||||
Sbjct: 261 ttcttgcccttcttc 247

---

>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full
           insert sequence
          Length = 288

 Score =  218 bits (110), Expect = 1e-53
 Identities = 122/126 (96%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 281
           |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 134 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 75

                                                                       
Query: 282 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 341
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 74  ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 15

                 
Query: 342 cttgtt 347
           ||||||
Sbjct: 14  cttgtt 9

---

>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds
          Length = 478

 Score =  218 bits (110), Expect = 1e-53
 Identities = 233/274 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           ||||||||| || ||||||||||| || || || || ||||||||||||||||| || ||
Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||| ||||| |  |||||||||||||| |||||||| ||||| || || |||||||||||
Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
           |||||||||| |||  |||||   ||| ||||||||||| |||||||||||||||  |||
Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           ||||||   ||||||||||  |||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 94  catgattcccatggccttgctggagatcccgatgtcagggtggacctgcttcagcacctt 35

                                             
Query: 471 gaagatgtagatcttgtacgtctcgacgctcttc 504
           ||| ||||| |||||||| ||||| |||||||||
Sbjct: 34  gaaaatgtaaatcttgtaggtctcaacgctcttc 1

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  212 bits (107), Expect = 9e-52
 Identities = 227/267 (85%)
 Strand = Plus / Plus

                                                                        
Query: 228  cgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 287
            ||||||||||||||| ||||||||||||||||| || || ||||||||||| ||||||||
Sbjct: 3039 cgaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcc 3098

                                                                        
Query: 288  ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 347
             || || || ||||| |||| |||||||||||| |||||||| | |||||||||||||||
Sbjct: 3099 aggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgtt 3158

                                                                        
Query: 348  gtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaagga 407
            ||| |     ||||||| || ||||  ||| | |||||| ||||||||||||||||||  
Sbjct: 3159 gtagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagct 3218

                                                                        
Query: 408  gttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcac 467
            ||||||||| ||||||||||||  |  ||||||| |||| ||||||||||||||||||||
Sbjct: 3219 gttcatgatagacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcac 3278

                                       
Query: 468  cttgaagatgtagatcttgtacgtctc 494
            |||| ||||||| | |||||| |||||
Sbjct: 3279 cttgtagatgtacagcttgtaggtctc 3305

---

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  212 bits (107), Expect = 9e-52
 Identities = 227/267 (85%)
 Strand = Plus / Plus

                                                                        
Query: 228  cgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 287
            ||||||||||||||| ||||||||||||||||| || || ||||||||||| ||||||||
Sbjct: 2337 cgaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcc 2396

                                                                        
Query: 288  ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 347
            ||| || || ||||| || | |||||||||||| |||||||| | |||||||||||||||
Sbjct: 2397 gggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgtt 2456

                                                                        
Query: 348  gtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaagga 407
            ||| |     ||||||| || |||   ||| | |||||| ||||||||||||||||||  
Sbjct: 2457 gtagcggctcagcttggaggcctcagtggccaccttctcaaagatgtcgttgatgaagct 2516

                                                                        
Query: 408  gttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcac 467
            ||||||||||||||||||||||  |  ||||||| |||| ||||||||||||||||||||
Sbjct: 2517 gttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcac 2576

                                       
Query: 468  cttgaagatgtagatcttgtacgtctc 494
            |||| ||||||| | |||||| |||||
Sbjct: 2577 cttgtagatgtacagcttgtaggtctc 2603

---

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  194 bits (98), Expect = 2e-46
 Identities = 224/266 (84%)
 Strand = Plus / Plus

                                                                        
Query: 229  gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 288
            |||||||||||||| ||||||||||||||||| || || |||||||| || ||||| |||
Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515

                                                                        
Query: 289  gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 348
            || || || ||||| |||| |||||||||||| || ||||| | ||||||||||||||||
Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575

                                                                        
Query: 349  tacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggag 408
            || |     ||||||| || ||||  ||| | |||||| ||||||||||||||||||  |
Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635

                                                                        
Query: 409  ttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacc 468
            |||||||||||||||||||||  |  ||||||| |||| |||||||||||||||||||||
Sbjct: 2636 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2695

                                      
Query: 469  ttgaagatgtagatcttgtacgtctc 494
            ||| | ||||| | |||||| |||||
Sbjct: 2696 ttgtatatgtacagcttgtaggtctc 2721

---

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score =  153 bits (77), Expect = 7e-34
 Identities = 224/273 (82%)
 Strand = Plus / Minus

                                                                        
Query: 223  taggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 282
            |||| ||| |||||||||||||| ||||||||||||||||| |||||||||||||| |||
Sbjct: 1592 taggccgacgtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagc 1533

                                                                        
Query: 283  tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 342
            ||||| || || || ||||| || |  ||||| || || || || || | ||||||||||
Sbjct: 1532 tcgcccggaagaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggcttc 1473

                                                                        
Query: 343  ttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatg 402
            |||||||| |     ||||||| || ||||  ||||| |||||| |||||||||||||||
Sbjct: 1472 ttgttgtagcggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgatg 1413

                                                                        
Query: 403  aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
            |||  |||||| || ||||||||||| |||  ||||||| | || |||||||||||||| 
Sbjct: 1412 aagctgttcataatcgacatggccttcgagctgatgccggtatcggggtgcacctgcttc 1353

                                             
Query: 463  agcaccttgaagatgtagatcttgtacgtctcg 495
            | ||||||| | ||||| | |||||| ||||||
Sbjct: 1352 aacaccttgtaaatgtaaagcttgtaggtctcg 1320

---

>ref|XM_782648.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC582704), mRNA
          Length = 372

 Score =  151 bits (76), Expect = 3e-33
 Identities = 208/252 (82%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggg 301

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 241

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
           | | || ||   ||  || || |||||||    ||||||||  ||||||| ||||  |||
Sbjct: 240 cttggcaagacgggaagattcaccggcaatgcgctcgaagacatcgttgacgaagctgtt 181

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           |||||||||||||||||||  |||||| ||  |||| ||||| |||||||| || |||||
Sbjct: 180 catgatggacatggccttgctggagataccagtgtcggggtggacctgcttcagaacctt 121

                       
Query: 471 gaagatgtagat 482
           | ||||||||||
Sbjct: 120 gtagatgtagat 109

---

>ref|XM_785670.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC585864), mRNA
          Length = 372

 Score =  151 bits (76), Expect = 3e-33
 Identities = 208/252 (82%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctctccggg 301

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 241

                                                                       
Query: 351 cctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagtt 410
           | | || ||   ||  || || |||||||    ||||||||  ||||||| ||||  |||
Sbjct: 240 cttggcaagacgggaagattcaccggcaatgcgctcgaagacatcgttgacgaagctgtt 181

                                                                       
Query: 411 catgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcacctt 470
           |||||||||||||||||||  |||||| ||  |||| ||||| |||||||| || |||||
Sbjct: 180 catgatggacatggccttgctggagataccagtgtcggggtggacctgcttcagaacctt 121

                       
Query: 471 gaagatgtagat 482
           | ||||||||||
Sbjct: 120 gtagatgtagat 109

---

>gb|AF025667.1|AF025667 Gossypium hirsutum histone H2B1 mRNA, complete cds
          Length = 670

 Score =  143 bits (72), Expect = 7e-31
 Identities = 222/272 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
           |||||||| ||||||||||| || || || |||||||||||||| ||||| || || || 
Sbjct: 436 aacttggtcacggccttggtaccttcagaaacggcgtgcttggcaagctcaccaggaagt 377

                                                                       
Query: 295 acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctc 354
           || || |  || | |||||| || |||| ||| ||||||||||| |||||||||||||||
Sbjct: 376 acaagcctaacagcggtctgaatttccctggaagtgatggtgggtttcttgttgtacctc 317

                                                                       
Query: 355 gcgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatg 414
           |||||| | | ||  ||    ||||||||||||||||| || ||||||||   |||||||
Sbjct: 316 gcgagcctagaggcttcttgagcaagcttctcgaagatatcattgatgaaactgttcatg 257

                                                                       
Query: 415 atggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaag 474
           ||   ||| || |||   ||||| |||||||| ||||| || ||||| || |||||||||
Sbjct: 256 atccccatagctttgctagagatcccgatgtcagggtgaacttgcttcaggaccttgaag 197

                                           
Query: 475 atgtagatcttgtacgtctcgacgctcttctt 506
           |||||||||||||| |||||||||||||||||
Sbjct: 196 atgtagatcttgtaggtctcgacgctcttctt 165

---

>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA
          Length = 414

 Score =  141 bits (71), Expect = 3e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                       
Query: 236 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
           ||||||| ||||||||||| ||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 394 acttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggagga 335

                                                                  
Query: 296 cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
            ||||||||| |||||||| ||||| ||||| | |||||||| ||||||||||||
Sbjct: 334 tgaggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgta 280



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||| |||||||||| ||| ||||||| ||||||||||||   |  |||||| ||  |
Sbjct: 246 ctcgaaaatgtcgttgacgaaagagttcaggatggacatggcacggttggagataccagt 187

                                               
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgta 479
           ||| ||||| ||||||||||| |||||| |||||||
Sbjct: 186 gtcggggtggacctgcttgaggaccttgtagatgta 151

---

>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11,
             DP09G08, DP35C12 of chromosome 5  of Podospora anserina
          Length = 322194

 Score =  141 bits (71), Expect = 3e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                         
Query: 236   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
             |||||||||||||||||||||| || || |||||||||||||| ||||||||||| ||||
Sbjct: 23470 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 23411

                                                                    
Query: 296   cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
              |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 23410 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 23356

---

>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds
          Length = 425

 Score =  141 bits (71), Expect = 3e-30
 Identities = 98/107 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  |||||||||| |||||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcggacggcggtctggatctcccgggaggtgatggtgg 263



 Score =  127 bits (64), Expect = 4e-26
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgctcatggccttggaggagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| ||||||||||||||||||
Sbjct: 156 gtcggggtggacctgcttgagcaccttg 129

---

>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora
             anserina
          Length = 103568

 Score =  141 bits (71), Expect = 3e-30
 Identities = 104/115 (90%)
 Strand = Plus / Plus

                                                                         
Query: 236   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
             |||||||||||||||||||||| || || |||||||||||||| ||||||||||| ||||
Sbjct: 81641 acttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaagga 81700

                                                                    
Query: 296   cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
              |||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||
Sbjct: 81701 tgaggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgta 81755

---

>dbj|AP006674.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT30L06, TM0369c,
             complete sequence
          Length = 68065

 Score =  137 bits (69), Expect = 4e-29
 Identities = 123/141 (87%)
 Strand = Plus / Minus

                                                                         
Query: 379   agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 438
             ||||||||||||||||| |||||||||  |||||||||   ||||||||||  |||||| 
Sbjct: 64317 agcttctcgaagatgtcattgatgaagctgttcatgatccccatggccttgctggagatt 64258

                                                                         
Query: 439   ccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacg 498
             |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 64257 ccgatgtcagggtgaacctgcttcagcaccttgaagatgtagatcttgtaagtttccacg 64198

                                  
Query: 499   ctcttcttggacttcttcttc 519
              ||||||| ||| ||||||||
Sbjct: 64197 ttcttcttcgacctcttcttc 64177



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                         
Query: 235   aacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagg 294
             |||||||| || ||||||||||| || || || ||||||||||| |||||||||||||| 
Sbjct: 64461 aacttggtaaccgccttggtgccttcagacacagcgtgcttggcaagctcgccggggaga 64402

                                                                     
Query: 295   acgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
             || |  |  |||| |||||| ||||||| |||||| || || ||||||||||||||
Sbjct: 64401 accaatctcacggcggtctgaatctccctggaggtaatcgtcggcttcttgttgta 64346

---

>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC483173), mRNA
          Length = 2193

 Score =  133 bits (67), Expect = 6e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 279



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |
Sbjct: 232 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 173

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 172 gtcggggtgcacctgcttcagcaccttg 145

---

>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC483164), mRNA
          Length = 659

 Score =  133 bits (67), Expect = 6e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 332 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 286



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |
Sbjct: 239 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 180

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 179 gtcggggtgcacctgcttcagcaccttg 152

---

>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 1 (LOC483169), mRNA
          Length = 432

 Score =  133 bits (67), Expect = 6e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 379 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 320

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 319 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 273



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |
Sbjct: 226 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 167

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 166 gtcggggtgcacctgcttcagcaccttg 139

---

>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 2 (LOC483169), mRNA
          Length = 516

 Score =  133 bits (67), Expect = 6e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 311



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |
Sbjct: 264 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 205

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 204 gtcggggtgcacctgcttcagcaccttg 177

---

>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 5 (LOC483170), mRNA
          Length = 415

 Score =  133 bits (67), Expect = 6e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 263



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129

---

>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           F, transcript variant 4 (LOC483170), mRNA
          Length = 597

 Score =  133 bits (67), Expect = 6e-28
 Identities = 97/107 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 417 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 358

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||||||||||||||||||||
Sbjct: 357 cagcagcaggcgcacggccgtctggatctcccgggaggtgatggtgg 311



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |
Sbjct: 264 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 205

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 204 gtcggggtgcacctgcttcagcaccttg 177

---

>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific
           histone 2b (LOC589998), mRNA
          Length = 372

 Score =  127 bits (64), Expect = 4e-26
 Identities = 106/120 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 300 gaggaggagacggacagcggtctggatctctcggctgctgatggtggccttcttgttgta 241



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||  ||||||| ||||  ||||||||||||||||||||||  |||||| ||  |
Sbjct: 207 ctcgaagacatcgttgacgaagctgttcatgatggacatggccttgctggagataccagt 148

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           ||| ||||| || ||||| || || ||| ||||||||||
Sbjct: 147 gtcggggtgaacttgcttcagaactttgtagatgtagat 109

---

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  125 bits (63), Expect = 2e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                        
Query: 231  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
            |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 2063 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2004

                                                           
Query: 291  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
             | ||  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 2003 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1957



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                        
Query: 403  aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
            |||||||||||||||  |||||||||||| ||||||||| | || |||||||||||||||
Sbjct: 1891 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 1832

                 
Query: 463  agcac 467
            |||||
Sbjct: 1831 agcac 1827

---

>gb|BC077399.1| Xenopus laevis histone H2B, mRNA (cDNA clone MGC:81709
           IMAGE:6865010), complete cds
          Length = 1379

 Score =  125 bits (63), Expect = 2e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 392 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 333

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            | ||  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 332 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 286



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 403 aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
           |||||||||||||||  |||||||||||| ||||||||| | || |||||||||||||||
Sbjct: 220 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 161

                
Query: 463 agcac 467
           |||||
Sbjct: 160 agcac 156

---

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  125 bits (63), Expect = 2e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                        
Query: 231  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
            |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 2073 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccagg 2014

                                                           
Query: 291  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
             | ||  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 2013 caagagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 1967



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                        
Query: 403  aaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttg 462
            |||||||||||||||  |||||||||||| ||||||||| | || |||||||||||||||
Sbjct: 1901 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 1842

                 
Query: 463  agcac 467
            |||||
Sbjct: 1841 agcac 1837

---

>gb|AF471832.1| Arabidopsis thaliana ecotype ITA-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471831.1| Arabidopsis thaliana ecotype KONDARA chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471830.1| Arabidopsis thaliana ecotype TAC chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471829.1| Arabidopsis thaliana ecotype KAS-1 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471821.1| Arabidopsis thaliana ecotype POG-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471820.1| Arabidopsis thaliana ecotype CNT-1 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471819.1| Arabidopsis thaliana ecotype PA-1 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471818.1| Arabidopsis thaliana ecotype CVI-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471817.1| Arabidopsis thaliana ecotype MRK-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471816.1| Arabidopsis thaliana ecotype CAL-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471815.1| Arabidopsis thaliana ecotype HODJA chromosome 5 locus MRN17.5
          Length = 324

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>ref|XM_954347.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  121 bits (61), Expect = 2e-24
 Identities = 199/245 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
           ||||||| |||||||| ||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                       
Query: 296 cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctcg 355
            |||||| || |||||||||||||| || |||| |||||||| ||||||||||||    |
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtaggcag 275

                                                                       
Query: 356 cgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatga 415
           | |||||||  | ||||  |||||    ||||||||| |||||||  || ||||||| ||
Sbjct: 274 caagcttggaagcctcggtggcaacgcgctcgaagatatcgttgacaaacgagttcagga 215

                                                                       
Query: 416 tggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaaga 475
           | ||||||||   |  |||||| ||| | || ||||| ||||||||||| |||||| |||
Sbjct: 214 tagacatggcgcggttggagataccggtatcagggtggacctgcttgaggaccttgtaga 155

                
Query: 476 tgtag 480
           |||||
Sbjct: 154 tgtag 150

---

>ref|XM_331210.1| Neurospora crassa OR74A hypothetical protein (NCU02435.1) partial
           mRNA
          Length = 414

 Score =  121 bits (61), Expect = 2e-24
 Identities = 199/245 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
           ||||||| |||||||| ||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 394 acttggtaacggccttagtgccttccgatacagcgtgcttggcaagctcgccggggagga 335

                                                                       
Query: 296 cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtacctcg 355
            |||||| || |||||||||||||| || |||| |||||||| ||||||||||||    |
Sbjct: 334 tgaggcgaacagaggtctggatctcacgagaggagatggtggacttcttgttgtaggcag 275

                                                                       
Query: 356 cgagcttggcggactcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatga 415
           | |||||||  | ||||  |||||    ||||||||| |||||||  || ||||||| ||
Sbjct: 274 caagcttggaagcctcggtggcaacgcgctcgaagatatcgttgacaaacgagttcagga 215

                                                                       
Query: 416 tggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcaccttgaaga 475
           | ||||||||   |  |||||| ||| | || ||||| ||||||||||| |||||| |||
Sbjct: 214 tagacatggcgcggttggagataccggtatcagggtggacctgcttgaggaccttgtaga 155

                
Query: 476 tgtag 480
           |||||
Sbjct: 154 tgtag 150

---

>ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC529278), mRNA
          Length = 381

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||||||||| |||||||| |||||||||
Sbjct: 156 gtccgggtggacctgcttcagcaccttg 129



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                       
Query: 236 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
           ||||||||||||||||||||||||| || |||||||||||||| || || ||||| || |
Sbjct: 364 acttggtgacggccttggtgccctcagacacggcgtgcttggccagttctccgggaagca 305

                                                   
Query: 296 cgaggcggacggaggtctggatctcccgggaggtgatggt 335
             ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 304 gcaggcgcacggccgtctggatctccctggatgtgatggt 265

---

>ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (predicted)
           (Hist3h2ba_predicted), mRNA
          Length = 585

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           |||||||||||||||||| |||||||||
Sbjct: 156 gtccgggtgcacctgcttcagcaccttg 129



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 284
           |||| |||||||||| ||||||||||| || || ||||| |||||||| |||||
Sbjct: 369 ggtgtacttggtgactgccttggtgccttccgacacggcatgcttggccagctc 316

---

>gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 H2be -like mRNA,
           complete sequence
          Length = 838

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 416 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 357

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  |||||||||||||| |||||||||||||
Sbjct: 356 cagcagcaggcgcacggccgtctggatctcccgcgaggtgatggtgg 310



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||  |
Sbjct: 263 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgcccgt 204

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 203 gtcggggtgcacctgcttcagcaccttg 176

---

>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA
          Length = 753

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 384 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 325

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 324 cagcagcaggcgcacggccgtctggatctcgcgggaggtgatggtgg 278



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 231 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 172

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 171 gtcggggtggacctgcttcagcaccttg 144

---

>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429558), mRNA
          Length = 381

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  |||||||||||||| |||||||||||||
Sbjct: 309 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 263



 Score =  117 bits (59), Expect = 4e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           ||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |||| 
Sbjct: 212 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 153

                                              
Query: 448 gggtgcacctgcttgagcaccttgaagatgtagat 482
           ||||| |||||||| ||||||||| ||| ||||||
Sbjct: 152 gggtggacctgctttagcaccttgtagacgtagat 118

---

>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken
           (LOC429457), partial mRNA
          Length = 628

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 616 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggg 557

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  |||||||||||||| |||||||||||||
Sbjct: 556 cagcagcaggcgcacggctgtctggatctcccgcgaggtgatggtgg 510



 Score =  117 bits (59), Expect = 4e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           ||||||||||||| ||||||||||||||||  |||||||||||||||||||||| |||| 
Sbjct: 459 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 400

                                              
Query: 448 gggtgcacctgcttgagcaccttgaagatgtagat 482
           ||||| |||||||| ||||||||| ||| ||||||
Sbjct: 399 gggtggacctgctttagcaccttgtagacgtagat 365

---

>emb|CR855675.2| Xenopus tropicalis finished cDNA, clone TGas058p09
          Length = 484

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 375 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccagg 316

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 315 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 269



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 394 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgc 453
           |||||||  |||||||||||||||  |||||||||||| ||||||||| | || ||||||
Sbjct: 212 tcgttgacaaaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgc 153

                             
Query: 454 acctgcttgagcaccttg 471
           |||||||| |||||||||
Sbjct: 152 acctgcttcagcaccttg 135

---

>gb|AF471828.1| Arabidopsis thaliana ecotype SORBO chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || ||||||||||||||||| || ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtaccttgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471827.1| Arabidopsis thaliana ecotype EI-2 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || ||||||||||||||||| || ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtaccttgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471826.1| Arabidopsis thaliana ecotype LER-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || ||||||||||||||||| || ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtaccttgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471825.1| Arabidopsis thaliana ecotype LIP-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || ||||||||||||||||| || ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtaccttgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471824.1| Arabidopsis thaliana ecotype PETERGOF chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || ||||||||||||||||| || ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtaccttgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471823.1| Arabidopsis thaliana ecotype DIJON_G chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || ||||||||||||||||| || ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtaccttgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471822.1| Arabidopsis thaliana ecotype CAN-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || ||||||||||||||||| || ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtaccttgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || ||||| | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgcttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471814.1| Arabidopsis thaliana ecotype SU-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471813.1| Arabidopsis thaliana ecotype KA-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471812.1| Arabidopsis thaliana ecotype PI-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471811.1| Arabidopsis thaliana ecotype SEI-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471810.1| Arabidopsis thaliana ecotype WL-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471809.1| Arabidopsis thaliana ecotype YO-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471808.1| Arabidopsis thaliana ecotype TSU-1 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471807.1| Arabidopsis thaliana ecotype NO-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>gb|AF471806.1| Arabidopsis thaliana ecotype BL-1 chromosome 5 locus MRN17.5
          Length = 324

 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 gtctggatctcccgggaggtgatggtgggcttcttgttgtacctcgcgagcttggcggac 369
           ||||| ||||||| ||| || || || |||||||||||||||||||| ||||| |  |||
Sbjct: 12  gtctgaatctccctggaagtaatcgtcggcttcttgttgtacctcgcaagcttcgaagac 71

                                                                       
Query: 370 tcgccggcaagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 429
           || || ||||||||||| ||||| |||||||||||   |||||||||   |||||| |||
Sbjct: 72  tcaccagcaagcttctcaaagatatcgttgatgaaactgttcatgattcccatggctttg 131

                                                                       
Query: 430 gaggagatgccgatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgtac 489
              ||||| |||||||| || || || || || | |||||||||||||||||||||||| 
Sbjct: 132 cttgagattccgatgtctggatgaacttgtttcaacaccttgaagatgtagatcttgtat 191

                                         
Query: 490 gtctcgacgctcttcttggacttcttcttc 519
           ||||| ||| ||||||| ||  ||||||||
Sbjct: 192 gtctcaacgttcttctttgatctcttcttc 221

---

>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC587419), mRNA
          Length = 372

 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 297
           ||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||| |
Sbjct: 353 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccggggaggagg 294

                                                                
Query: 298 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           || | ||| | |||||||| ||| |||  ||||||||| | ||||||||||||
Sbjct: 293 agtctgacagcggtctggacctcacggctggtgatggtagacttcttgttgta 241



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 81/99 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||  ||||||| ||||  ||||||||||||||||||   |  |||||| ||  |
Sbjct: 207 ctcgaagacatcgttgacgaagctgttcatgatggacatggcacggctggagataccagt 148

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           ||| ||||| |||||||| || |||||| ||||||||||
Sbjct: 147 gtcggggtggacctgcttcagaaccttgtagatgtagat 109

---

>ref|XM_781061.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           (LOC581037), mRNA
          Length = 468

 Score =  113 bits (57), Expect = 6e-22
 Identities = 105/121 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| |||||||| |||||||| | ||| |||||
Sbjct: 456 ggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccaactctccggg 397

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| ||||| | |||||||||||| |||  | ||||||||| ||||||||||||
Sbjct: 396 gaggaggagacggacagcggtctggatctctcggctgctgatggtggacttcttgttgta 337

            
Query: 351 c 351
           |
Sbjct: 336 c 336



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 394 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgc 453
           ||||||| ||||  ||||||||||||||||||||||  |||||| ||  |||| ||||| 
Sbjct: 293 tcgttgacgaagctgttcatgatggacatggccttgctggagataccagtgtcggggtgg 234

                                        
Query: 454 acctgcttgagcaccttgaagatgtagat 482
           |||||||| || |||||| ||||||||||
Sbjct: 233 acctgcttcagaaccttgtagatgtagat 205

---

>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733
           IMAGE:40014260), complete cds
          Length = 459

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 217 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 158

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 157 gtcggggtggacctgcttcagcaccttg 130



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264

---

>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734
           IMAGE:40014264), complete cds
          Length = 459

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 217 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 158

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 157 gtcggggtggacctgcttcagcaccttg 130



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 370 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 311

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 264

---

>ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H2B F (H2B 291A)
           (LOC469702), mRNA
          Length = 381

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||| |||| |||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgacagccttagtgcgctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||| || || ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctgcatttcgcgggacgtgatggtgg 263

---

>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701),
           mRNA
          Length = 399

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 234 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 175

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 174 gtcggggtgcacctgcttcagcaccttg 147



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 287
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 387 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgcc 331

---

>ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477), mRNA
          Length = 1068

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129



 Score =  103 bits (52), Expect = 6e-19
 Identities = 95/108 (87%), Gaps = 1/108 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacg-gccttggtgccctcggagacggcgtgcttggcgagctcgccgg 289
           |||| ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 370 ggtgtacttggtgacgcgccttggtgccctcggacacggcgtgcttggccagctcgccgg 311

                                                           
Query: 290 ggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           | || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 310 gcagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263

---

>ref|XM_608099.2| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC529646), mRNA
          Length = 396

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||| ||||| ||||||||| |
Sbjct: 231 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggctttggacgagatgccggt 172

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||||||||| |||||||| |||||||||
Sbjct: 171 gtccgggtggacctgcttcagcaccttg 144



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||| ||||| || || ||||||||||| ||||| |||||
Sbjct: 384 ggtgtacttggtgacggccttggtaccctcagacaccgcgtgcttggccagctccccggg 325

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| |||| |||||||||||||| ||| ||||||||
Sbjct: 324 tagcagcaggcgcacggcggtctggatctccctggatgtgatggt 280

---

>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419
           IMAGE:3936695), complete cds
          Length = 2224

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 240 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 181

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 180 gtcggggtggacctgcttcagcaccttg 153



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 393 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 334

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 287

---

>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with
           apparent retained intron
          Length = 2210

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 228 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 169

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 168 gtcggggtggacctgcttcagcaccttg 141



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 381 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 322

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 321 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 275

---

>ref|XM_868693.1| PREDICTED: Bos taurus similar to H2B histone family, member T
           (LOC616627), mRNA
          Length = 466

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  ||| |||||||| ||||||||| |
Sbjct: 256 ctcgaagatgtcgttgacgaaggagttcatgatgcccatagccttggacgagatgccggt 197

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||||||||| |||||||| |||||||||
Sbjct: 196 gtccgggtggacctgcttcagcaccttg 169



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||| ||||| || || || |||||||| ||||| |||||
Sbjct: 409 ggtgtacttggtgacggccttggtaccctcagacaccgcatgcttggccagctccccggg 350

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 349 cagcagtaggcgcacggccgtctggatctccctggatgtgatggt 305

---

>ref|XM_868885.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC616776), mRNA
          Length = 399

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 229 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 170

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||||||||| || ||||| |||||||||
Sbjct: 169 gtccgggtggacttgcttcagcaccttg 142



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 382 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccggg 323

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            |  |  ||||| |||| |||||||||||||| ||| ||||||||
Sbjct: 322 caacagcaggcgaacggcggtctggatctccctggatgtgatggt 278

---

>ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA
          Length = 452

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 239 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 180

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 179 gtcggggtgcacctgcttcagcaccttg 152



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

---

>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA
          Length = 2223

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305

---

>gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds
          Length = 435

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 238 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 179

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 178 gtcggggtgcacctgcttcagcaccttg 151



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 391 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 332

---

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 148135 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 148194

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| ||||| |||||||| |||||||||
Sbjct: 148195 gtcggggtggacctgcttcagcaccttg 148222



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 73823 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 73882

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| ||||| |||||||| |||||||||
Sbjct: 73883 gtcggggtggacctgcttcagcaccttg 73910



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 147982 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 148041

                                                             
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
               || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 148042 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 148088



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 73670 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 73729

                                                            
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
              || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 73730 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 73776



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Plus

                                                                          
Query: 236    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
              |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 112138 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 112197

                                                        
Query: 296    cgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
                ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 112198 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 112238



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 90/102 (88%), Gaps = 1/102 (0%)
 Strand = Plus / Minus

                                                                          
Query: 236    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
              |||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || |
Sbjct: 105128 acttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagca 105069

                                                        
Query: 296    cgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
                ||||| ||||  |||||||||| |||||| ||||||||||
Sbjct: 105068 gcaggcgcacggccgtctggatct-ccgggacgtgatggtgg 105028



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              ||||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| |
Sbjct: 112285 ctcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggt 112344

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| ||||| ||| |||| |||||||||
Sbjct: 112345 gtcggggtggacccgcttcagcaccttg 112372



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              ||||||||||||||||| ||||||||||||||||  |||||||||| |  |||||||| |
Sbjct: 104981 ctcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggt 104922

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| ||||| ||| |||| |||||||||
Sbjct: 104921 gtcggggtggacccgcttcagcaccttg 104894

---

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 100020 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 100079

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| |||||||||||||| |||||||||
Sbjct: 100080 gtcggggtgcacctgcttcagcaccttg 100107



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 93986 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 93927

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| |||||||||||||| |||||||||
Sbjct: 93926 gtcggggtgcacctgcttcagcaccttg 93899



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 99867 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 99926



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| |||||||||| ||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct: 94140 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 94081

---

>ref|XM_786200.1| PREDICTED: Strongylocentrotus purpuratus similar to H2B histone
           family, member F (LOC586416), mRNA
          Length = 471

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 304

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 303 gaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 425
           ||||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 210 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 169

---

>ref|XM_786178.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B
           291B (LOC586394), mRNA
          Length = 375

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 304

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 303 gaggaggagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 425
           ||||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 210 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 169

---

>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A
          Length = 2964

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 716 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 657

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 656 gtcggggtggacctgcttcagcaccttg 629



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 869 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 810

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 809 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 763

---

>emb|X14731.1|CMHIST2B Duck H2B histone gene
          Length = 1179

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||  |
Sbjct: 889 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgcccgt 830

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 829 gtcggggtgcacctgcttcagcaccttg 802



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 94/106 (88%), Gaps = 2/106 (1%)
 Strand = Plus / Minus

                                                                        
Query: 231  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
            |||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1042 ggtgtacttggtgaccgccttggtgccctcggagacggcgtgcttggccagctcgccggg 983

                                                          
Query: 291  gagga-cgaggcggacggaggtctggatctcccgggaggtgatggt 335
             || | |||  || ||||  |||||||||||||| |||||||||||
Sbjct: 982  cagcagcga-ccgcacggccgtctggatctcccgcgaggtgatggt 938

---

>emb|X06643.1|SPH2BL4 Strongylocentrotus purpuratus late histone gene fragment L4 H2b
          Length = 627

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 314 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggcgagttctccggg 255

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 254 gaggaggagcctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 195



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggc 425
           ||||||||  ||||||| ||||  ||||||||||||||||||
Sbjct: 161 ctcgaagacatcgttgacgaagctgttcatgatggacatggc 120

---

>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b
          Length = 1497

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                        
Query: 231  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
            |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1352 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 1293

                                                                        
Query: 291  gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
            ||||| ||| | ||||  |||||||| ||| ||   ||||||||||| ||||||||||||
Sbjct: 1292 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 1233



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                        
Query: 408  gttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcac 467
            ||||||||||||||||||   |  |||||||||  |||| ||||| |||||||| |||||
Sbjct: 1175 gttcatgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcagcac 1116

                           
Query: 468  cttgaagatgtagat 482
            |||| ||||||||||
Sbjct: 1115 cttgtagatgtagat 1101

---

>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for
           gene HIST2H2BE, histone 2, H2be; complete cds, incl.
           stopcodon
          Length = 381

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263

---

>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767
           IMAGE:40002353), complete cds
          Length = 430

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263

---

>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528)
          Length = 2237

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 411 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 352

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 305

---

>dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU2011564, highly similar
           to HISTONE H2B GL105
          Length = 2181

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggc 269
           |||| |||||||||| ||||||||||||||||| |||||
Sbjct: 372 ggtgtacttggtgaccgccttggtgccctcggacacggc 334



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 310 gtctggatctcccgggaggtgatggtgg 337
           ||||||||||| ||||| ||||||||||
Sbjct: 332 gtctggatctcgcgggatgtgatggtgg 305

---

>dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG2008321, highly similar
           to HISTONE H2B F
          Length = 2359

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 239 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 180

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 179 gtcggggtgcacctgcttcagcaccttg 152



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 392 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 333

---

>ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudogene on chromosome 1
          Length = 1140

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 597 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 538

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 537 gtcggggtgcacctgcttcagcaccttg 510



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct: 751 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 692

---

>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds
          Length = 1137

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 596 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 537

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 536 gtcggggtggacctgcttcagcaccttg 509



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 749 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 690

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 643

---

>gb|AY131980.1| Homo sapiens histone H2B (HIST3H2BA) pseudogene, complete sequence
          Length = 1140

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 597 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 538

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 537 gtcggggtgcacctgcttcagcaccttg 510



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct: 751 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 692

---

>gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, complete cds
          Length = 1137

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 595 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 535 gtcggggtgcacctgcttcagcaccttg 508



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

---

>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA
          Length = 372

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 360 ggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctctccggg 301

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           ||||| ||| | ||||  |||||||| ||| ||   ||||||||||| ||||||||||||
Sbjct: 300 gaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttcttgttgta 241



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 408 gttcatgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttgagcac 467
           ||||||||||||||||||   |  |||||||||  |||| ||||| |||||||| |||||
Sbjct: 183 gttcatgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcagcac 124

                          
Query: 468 cttgaagatgtagat 482
           |||| ||||||||||
Sbjct: 123 cttgtagatgtagat 109

---

>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be
           (HIST2H2BE) mRNA, complete cds
          Length = 381

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263

---

>emb|AJ329611.1|HSA329611 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-RI11C
          Length = 652

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 342 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 283

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 282 gtcggggtgcacctgcttcagcaccttg 255



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/61 (88%), Gaps = 1/61 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgc-ttggcgagctcgccgg 289
           |||| |||||||||| ||||| ||||||||| | ||||||||| ||||| ||||||||||
Sbjct: 497 ggtgtacttggtgacagccttagtgccctcgnacacggcgtgctttggccagctcgccgg 438

            
Query: 290 g 290
           |
Sbjct: 437 g 437

---

>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804
           IMAGE:40014249), complete cds
          Length = 456

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263

---

>gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119802
           IMAGE:40014245), complete cds
          Length = 458

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 369 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 310

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 263

---

>gb|BC111653.1| Bos taurus cDNA clone MGC:137516 IMAGE:8026091, complete cds
          Length = 785

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  ||| |||||||| ||||||||| |
Sbjct: 265 ctcgaagatgtcgttgacgaaggagttcatgatgcccatagccttggacgagatgccggt 206

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||||||||| |||||||| |||||||||
Sbjct: 205 gtccgggtggacctgcttcagcaccttg 178



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||| ||||| || || || |||||||| ||||| |||||
Sbjct: 418 ggtgtacttggtgacggccttggtaccctcagacaccgcatgcttggccagctccccggg 359

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 358 cagcagtaggcgcacggccgtctggatctccctggatgtgatggt 314

---

>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA
          Length = 1858

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 249 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 190

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 189 gtcggggtggacctgcttcagcaccttg 162



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296

---

>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639
           IMAGE:5224812), complete cds
          Length = 1858

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 249 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 190

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 189 gtcggggtggacctgcttcagcaccttg 162



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 402 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 343

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 342 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 296

---

>gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end
          Length = 2100

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 141 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 82

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 81  gtcggggtggacctgcttcagcaccttg 54



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 294 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 235

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 234 cagcagcaggcgcacggccgtctggatctcgcgggatgtgatggtgg 188

---

>emb|AJ343028.1|HSA343028 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-GO20C
          Length = 691

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 122 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 63

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 62  gtcggggtgcacctgcttcagcaccttg 35



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct: 276 ggtgtacttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 217

---

>gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds
          Length = 375

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| |||||||||||||||||||| || |||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggcgagttcaccggg 304

                                                                       
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
           |||||  || | ||| | |||||||| ||| |||  | ||||||||| ||||||||||||
Sbjct: 303 gaggagaagtctgacagcggtctggacctcacggctgctgatggtggacttcttgttgta 244



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||  ||||||| ||||  |||||||||||||||||| |||  |||||||||  |
Sbjct: 210 ctcgaagacatcgttgacgaagctgttcatgatggacatggctttgctggagatgccagt 151

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           ||| ||||| |||||||| || |||||| ||||||||||
Sbjct: 150 gtcggggtggacctgcttcagaaccttgtagatgtagat 112

---

>gb|BC077692.1| Xenopus tropicalis histone 1, H2bk, mRNA (cDNA clone MGC:89948
           IMAGE:7030528), complete cds
          Length = 540

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                       
Query: 394 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgc 453
           |||||||  |||||||||||||||  |||||||||||||||||||||| | || ||||||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggagatgccggtatcggggtgc 187

                             
Query: 454 acctgcttgagcaccttg 471
           |||||||| |||||||||
Sbjct: 186 acctgcttcagcaccttg 169

---

>ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488253), mRNA
          Length = 384

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           ||| |||||||||||||| ||||||||  ||||||||||
Sbjct: 159 gtcggggtgcacctgcttcagcaccttatagatgtagat 121



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268

---

>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four
              novel genes, a novel gene (MGC57827), a ribosomal protein
              L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C)
              pseudogene, the HIST2H2BB gene for histone 2 H2bb, the
              FCGR1B gene for Fc fragment of IgG high affinity Ib
              receptor for (CD64) and three CpG islands, complete
              sequence
          Length = 189539

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 159255 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 159196

                                                             
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
               || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 159195 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 159149



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 159102 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 159043

                                        
Query: 444    gtccgggtgcacctgcttgagcacct 469
              ||| ||||| |||||||| |||||||
Sbjct: 159042 gtcggggtggacctgcttcagcacct 159017

---

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 68592 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 68651

                                                            
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
              || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 68652 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtgg 68698



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             ||||||||||||||||| ||||||||||||||||  ||||| |||||| ||||||||| |
Sbjct: 68745 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggtcttggacgagatgccggt 68804

                                       
Query: 444   gtccgggtgcacctgcttgagcacct 469
             ||| ||||| |||||||| |||||||
Sbjct: 68805 gtcggggtggacctgcttcagcacct 68830

---

>emb|BX072512.1|CNS09S44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 621

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 466 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 407

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 406 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 360



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 313 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 254

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 253 gtccgggtgcacctgcttcagcaccttgtagatgtagat 215

---

>emb|BX072414.1|CNS09S1E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 420 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 479

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 480 gtccgggtgcacctgcttcagcaccttgtagatgtagat 518



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 267 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 326

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 327 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 373

---

>emb|BX053938.1|CNS09DS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 540 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 481

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 480 gtccgggtgcacctgcttcagcaccttgtagatgtagat 442



 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||| |||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 693 ggtgtacttggtaacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 634

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 633 gagcaaaagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 587

---

>emb|BX051496.1|CNS09BWC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 400 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 459

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 460 gtccgggtgcacctgcttcagcaccttgtagatgtagat 498



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 247 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 306

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 307 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 353

---

>emb|BX051495.1|CNS09BWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 463 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 404

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 403 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 357



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 310 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 251

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 250 gtccgggtgcacctgcttcagcaccttgtagatgtagat 212

---

>emb|BX047440.1|CNS098RO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 444 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 385

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 384 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 338



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 291 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 232

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 231 gtccgggtgcacctgcttcagcaccttgtagatgtagat 193

---

>emb|BX038423.1|CNS091T7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 478 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 419

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 418 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 372



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 325 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 266

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 265 gtccgggtgcacctgcttcagcaccttgtagatgtagat 227

---

>emb|BX034441.1|CNS08YQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 401 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 460

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 461 gtccgggtgcacctgcttcagcaccttgtagatgtagat 499



 Score =  101 bits (51), Expect = 2e-18
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 249 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 308

              
Query: 291 gag 293
           |||
Sbjct: 309 gag 311

---

>emb|BX032827.1|CNS08XHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 402

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 401 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 355



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 308 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 249

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 248 gtccgggtgcacctgcttcagcaccttgtagatgtagat 210

---

>emb|BX031663.1|CNS08WLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 770

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 389 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 448

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 449 gtccgggtgcacctgcttcagcaccttgtagatgtagat 487



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 236 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 295

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 296 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 342

---

>emb|BX022107.1|CNS08P7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 389

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 290 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 231

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 230 gtccgggtgcacctgcttcagcaccttgtagatgtagat 192



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 310 gtctggatctcccgggaggtgatggtgg 337
           ||||||||||| ||||| ||||||||||
Sbjct: 364 gtctggatctcgcgggacgtgatggtgg 337

---

>emb|BX021771.1|CNS08OYN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 544

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 245 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 305 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 351



 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||| ||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 398 ctcgaagatgttgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 457

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 458 gtccgggtgcacctgcttcagcaccttgtagatgtagat 496

---

>emb|BX021770.1|CNS08OYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 463

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 315 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 256

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 255 gtccgggtgcacctgcttcagcaccttgtagatgtagat 217



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 255 gccctcggagacggcgtgcttggcgagctcgccggggaggacgaggcggacggaggtctg 314
           ||||||||| |||||||||||| | ||||||||||||||    || || || |  |||||
Sbjct: 444 gccctcggacacggcgtgcttgtccagctcgccggggagttttagtcgcaccgccgtctg 385

                                  
Query: 315 gatctcccgggaggtgatggtgg 337
           |||||| ||||| ||||||||||
Sbjct: 384 gatctcgcgggacgtgatggtgg 362

---

>emb|BX014618.1|CNS08JFY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 331 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 390

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 391 gtccgggtgcacctgcttcagcaccttgtagatgtagat 429



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 94/108 (87%), Gaps = 1/108 (0%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttg-gcgagctcgccgg 289
           |||| |||||||||||||||||||||||||||| |||||||||||| || ||||||||||
Sbjct: 177 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttgtgccagctcgccgg 236

                                                           
Query: 290 ggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           |||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 237 ggagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 284

---

>emb|BX013307.1|CNS08IFJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 299 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 240

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 239 gtccgggtgcacctgcttcagcaccttgtagatgtagat 201

---

>emb|BX012776.1|CNS08I0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 317 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 258

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 257 gtccgggtgcacctgcttcagcaccttgtagatgtagat 219

---

>emb|BX012380.1|CNS08HPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 248 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 307

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 308 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 354



 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  || |||||||  ||| ||||||||||| |||||| |
Sbjct: 401 ctcgaagatgtcgttcacgaagctgtacatgatgctcatcgccttggaggaaatgccggt 460

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 461 gtccgggtgcacctgcttcagcaccttgtagatgtagat 499

---

>emb|BX009211.1|CNS08F9R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 452 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 393

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 392 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 346



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 299 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 240

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 239 gtccgggtgcacctgcttcagcaccttgtagatgtagat 201

---

>emb|BX008531.1|CNS08EQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 297 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 238

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 237 gtccgggtgcacctgcttcagcaccttgtagatgtagat 199



 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 236 acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
           |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
Sbjct: 445 acttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggggagca 386

                                                     
Query: 296 cgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
             || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 385 acagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 344

---

>emb|X98185.1|AGH2B A.gambiae mRNA for histone H2B
          Length = 698

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 423 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 364

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 363 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 317



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 273 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 214

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 213 gtccgggtgcacctgcttcagcaccttgtagatgtagat 175

---

>ref|NM_001006890.1| Xenopus tropicalis histone 1, H2bk (hist1h2bk), mRNA
          Length = 540

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||| || ||||||||||||||||| |||||||||||||| ||||| || ||
Sbjct: 409 ggtgtacttggtaacagccttggtgccctcggacacggcgtgcttggccagctccccagg 350

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  |||||||| | |||||||||||||||||||||||||||||
Sbjct: 349 cagcagcaggcggaccgcggtctggatctcccgggaggtgatggtgg 303



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                       
Query: 394 tcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgc 453
           |||||||  |||||||||||||||  |||||||||||||||||||||| | || ||||||
Sbjct: 246 tcgttgacaaaggagttcatgatgctcatggccttggaggagatgccggtatcggggtgc 187

                             
Query: 454 acctgcttgagcaccttg 471
           |||||||| |||||||||
Sbjct: 186 acctgcttcagcaccttg 169

---

>gb|AF471834.1| Arabidopsis thaliana ecotype BLA-10 chromosome 5 locus MRN17.5
          Length = 324

 Score =  109 bits (55), Expect = 9e-21
 Identities = 151/183 (82%)
 Strand = Plus / Plus

                                                                       
Query: 337 ggcttcttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcg 396
           |||||||||||||||||||| ||||| |  ||||| || ||||| ||||| ||||| |||
Sbjct: 39  ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagtttctcaaagatatcg 98

                                                                       
Query: 397 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacc 456
           ||||||||   |||||||||   |||||| |||   ||||| |||||||| || || || 
Sbjct: 99  ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158

                                                                       
Query: 457 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
           ||||| | |||||||||||||||||||||||| ||||| ||| ||||||| ||  |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctcaacgttcttctttgatctcttc 218

              
Query: 517 ttc 519
           |||
Sbjct: 219 ttc 221

---

>gb|AF471833.1| Arabidopsis thaliana ecotype PLA-0 chromosome 5 locus MRN17.5
          Length = 324

 Score =  109 bits (55), Expect = 9e-21
 Identities = 151/183 (82%)
 Strand = Plus / Plus

                                                                       
Query: 337 ggcttcttgttgtacctcgcgagcttggcggactcgccggcaagcttctcgaagatgtcg 396
           |||||||||||||||||||| ||||| |  ||||| || ||||| ||||| ||||| |||
Sbjct: 39  ggcttcttgttgtacctcgcaagcttcgaagactcaccagcaagtttctcaaagatatcg 98

                                                                       
Query: 397 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacc 456
           ||||||||   |||||||||   |||||| |||   ||||| |||||||| || || || 
Sbjct: 99  ttgatgaaactgttcatgattcccatggctttgcttgagattccgatgtctggatgaact 158

                                                                       
Query: 457 tgcttgagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggacttcttc 516
           ||||| | |||||||||||||||||||||||| ||||| ||| ||||||| ||  |||||
Sbjct: 159 tgcttcaacaccttgaagatgtagatcttgtatgtctcaacgttcttctttgatctcttc 218

              
Query: 517 ttc 519
           |||
Sbjct: 219 ttc 221

---

>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1
          Length = 1137

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536

                                     
Query: 444 gtccgggtgcacctgcttgagcacct 469
           ||| ||||| |||||||| |||||||
Sbjct: 535 gtcggggtggacctgcttcagcacct 510

---

>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1
          Length = 1137

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536

                                     
Query: 444 gtccgggtgcacctgcttgagcacct 469
           ||| ||||| |||||||| |||||||
Sbjct: 535 gtcggggtggacctgcttcagcacct 510

---

>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence
          Length = 1137

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536

                                     
Query: 444 gtccgggtgcacctgcttgagcacct 469
           ||| ||||| |||||||| |||||||
Sbjct: 535 gtcggggtggacctgcttcagcacct 510

---

>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence
          Length = 1137

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 748 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 689

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 642



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536

                                     
Query: 444 gtccgggtgcacctgcttgagcacct 469
           ||| ||||| |||||||| |||||||
Sbjct: 535 gtcggggtggacctgcttcagcacct 510

---

>ref|XM_558160.1| Anopheles gambiae str. PEST ENSANGP00000027582
           (ENSANGG00000022768), partial mRNA
          Length = 513

 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 199 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 258

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 259 gtccgggtgcacctgcttcagcaccttgtagatgtagat 297



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 46  ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 105

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 106 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 152

---

>ref|XM_320334.2| Anopheles gambiae str. PEST ENSANGP00000014097
           (ENSANGG00000011608), mRNA
          Length = 671

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 420 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 361

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 360 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 314



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 267 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 208

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 207 gtccgggtgcacctgcttcagcaccttgtagatgtagat 169

---

>ref|XM_320329.2| Anopheles gambiae str. PEST ENSANGP00000014080
           (ENSANGG00000011591), mRNA
          Length = 695

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 464 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 405

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 404 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 358



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 311 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 252

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 251 gtccgggtgcacctgcttcagcaccttgtagatgtagat 213

---

>ref|XM_314450.2| Anopheles gambiae str. PEST ENSANGP00000000674
           (ENSANGG00000000607), partial mRNA
          Length = 363

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 351 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 292

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 291 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 245



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 198 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 139

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 138 gtccgggtgcacctgcttcagcaccttgtagatgtagat 100

---

>ref|XM_314448.2| Anopheles gambiae str. PEST ENSANGP00000016043
           (ENSANGG00000013554), mRNA
          Length = 704

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 470 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 411

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 410 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 364



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 317 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 258

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 257 gtccgggtgcacctgcttcagcaccttgtagatgtagat 219

---

>ref|XM_306853.2| Anopheles gambiae str. PEST ENSANGP00000000106
           (ENSANGG00000000104), partial mRNA
          Length = 321

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 309 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 250

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 249 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 203



 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 156 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 97

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||  ||||||||||
Sbjct: 96  gtccgggtgcacctgcttcagcaccttatagatgtagat 58

---

>ref|XM_306255.2| Anopheles gambiae str. PEST ENSANGP00000000003
           (ENSANGG00000000003), partial mRNA
          Length = 375

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccggg 304

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
           ||| |  || || || |  ||||||||||| ||||| ||||||||||
Sbjct: 303 gagcaacagtcgcaccgccgtctggatctcgcgggacgtgatggtgg 257



 Score =  109 bits (55), Expect = 9e-21
 Identities = 88/99 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||| | ||||  ||||||||||  ||| ||||||||||| |||||| |
Sbjct: 210 ctcgaagatgtcgttcacgaagctgttcatgatgctcatcgccttggaggaaatgccggt 151

                                                  
Query: 444 gtccgggtgcacctgcttgagcaccttgaagatgtagat 482
           |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 150 gtccgggtgcacctgcttcagcaccttgtagatgtagat 112

---

>dbj|AB085854.1| Rosellinia necatrix hh2b gene for histone H2B, complete cds
          Length = 1819

 Score =  109 bits (55), Expect = 9e-21
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                        
Query: 236  acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
            ||||||||||||||||||| || |||||||| || |||||||| || |||||||||||||
Sbjct: 1295 acttggtgacggccttggtaccttcggagacagcatgcttggcaagttcgccggggagga 1236

                                                                   
Query: 296  cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 350
             ||||||||||||||||||||| || || || |  ||||||  ||||||||||||
Sbjct: 1235 tgaggcggacggaggtctggatttcacgcgaagaaatggtgctcttcttgttgta 1181

---

>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:126031 IMAGE:40032208), complete cds
          Length = 520

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 378 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 319

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 318 cagcagcaggcgcacggccgtctggatctcacgggatgtgatggtgg 272



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 225 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 166

                                     
Query: 444 gtccgggtgcacctgcttgagcacct 469
           ||| ||||| |||||||| |||||||
Sbjct: 165 gtcggggtggacctgcttcagcacct 140

---

>gb|BC073925.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA
           clone MGC:90432 IMAGE:5190019), complete cds
          Length = 2221

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 350 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 291

                                                          
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
            || |  ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct: 290 cagcagcaggcgcacggccgtctggatctcgcgggacgtgatggtgg 244



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||||||||||||||||  ||||| |||||| ||||||||| |
Sbjct: 197 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggtcttggacgagatgccggt 138

                                     
Query: 444 gtccgggtgcacctgcttgagcacct 469
           ||| ||||| |||||||| |||||||
Sbjct: 137 gtcggggtggacctgcttcagcacct 112

---

>emb|Z59559.1|HS163A6R H.sapiens CpG island DNA genomic Mse1 fragment, clone 163a6,
           reverse read cpg163a6.rt1b
          Length = 199

 Score =  107 bits (54), Expect = 4e-20
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 167 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 108

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 107 aagcancaggcgcacggccgtctggatctccctggaggtgatggt 63

---

>gb|BC051872.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:60248
           IMAGE:6526835), complete cds
          Length = 844

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 350

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 349 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 305



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 196

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 195 tcggggtggacctgcttcagcaccttg 169

---

>gb|BC106899.1| Homo sapiens histone 1, H2bg, mRNA (cDNA clone IMAGE:40031316),
           partial cds
          Length = 435

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 368 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 309

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 308 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 264



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 208 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 149

                                
Query: 451 tgcacctgcttgagcaccttg 471
           || ||||| || |||||||||
Sbjct: 148 tggacctgtttcagcaccttg 128

---

>ref|XM_518302.1| PREDICTED: Pan troglodytes similar to H2B histone family, member F
           (LOC462509), mRNA
          Length = 843

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 265



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 212 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 153

                                   
Query: 448 gggtgcacctgcttgagcaccttg 471
           ||||| || ||||| || ||||||
Sbjct: 152 gggtggacttgcttcagtaccttg 129

---

>ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H2B (LOC462508), mRNA
          Length = 1026

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 461 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggg 402

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
           ||| |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 401 gagcagcaggcgcacggccgtctggatctccctggaggtgatggt 357



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||| ||| |
Sbjct: 308 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagataccggt 249

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| |||||||||
Sbjct: 248 gtcggggtggacctgcttcagcaccttg 221

---

>ref|XM_518294.1| PREDICTED: Pan troglodytes similar to H2B histone family, member R
           (LOC462500), mRNA
          Length = 572

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 381 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 322

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 321 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 277



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||| |||||||| |  || || |||||||||  |||||||||||| || |||||| |
Sbjct: 228 ctcgaaaatgtcgttcacaaacgaattcatgatgcccatggccttggacgaaatgccggt 169

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| ||||| |||||||| || ||||||
Sbjct: 168 gtcagggtggacctgcttcagaaccttg 141

---

>gb|BC106720.1| Homo sapiens histone 1, H2bo, mRNA (cDNA clone MGC:119806
           IMAGE:40014271), complete cds
          Length = 441

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 390 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 331

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 330 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 286



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 233 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 174

                                   
Query: 448 gggtgcacctgcttgagcaccttg 471
           ||||| || ||||| |||||||||
Sbjct: 173 gggtggacttgcttcagcaccttg 150

---

>ref|NM_017445.1| Homo sapiens H2B histone family, member S (H2BFS), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 310

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 265



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 215 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 156

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 155 tcggggtggacctgcttcagcaccttg 129

---

>ref|NM_003527.4| Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA
          Length = 467

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 303



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 250 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 191

                                   
Query: 448 gggtgcacctgcttgagcaccttg 471
           ||||| || ||||| |||||||||
Sbjct: 190 gggtggacttgcttcagcaccttg 167

---

>gb|BC000893.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:5132
           IMAGE:3463930), complete cds
          Length = 845

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 411 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 352

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 307



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 257 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 198

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 197 tcggggtggacctgcttcagcaccttg 171

---

>ref|XM_866738.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC615043), mRNA
          Length = 748

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 401 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccggg 342

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  || || ||||  ||||||||||||||||| ||||||||
Sbjct: 341 cagcagaagtcgcacggccgtctggatctcccgggacgtgatggt 297



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||||||||  || ||||||||||||  |||||| ||||| ||||||||| |
Sbjct: 248 ctcgaagatgtcgttgacaaatgagttcatgatgcccatggctttggacgagatgccggt 189

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||||||||||||||| || | |||||||
Sbjct: 188 gtccgggtgcacctgtttcaacaccttg 161

---

>ref|XM_618175.2| PREDICTED: Bos taurus similar to H2B histone family, member F,
           transcript variant 1 (LOC537985), mRNA
          Length = 2304

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||
Sbjct: 385 ggtgtacttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccagg 326

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||||||| ||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctcccgggacgtgatggt 281



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           |||||||||||||||||  || ||||||||||||  ||| |||||||| || || ||| |
Sbjct: 232 ctcgaagatgtcgttgacaaatgagttcatgatgcccatagccttggacgaaataccggt 173

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           |||||||||||||||||| |||||||||
Sbjct: 172 gtccgggtgcacctgcttcagcaccttg 145

---

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 107478 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 107537

                                                           
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 107538 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 107582



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              ||||||||| ||||||| ||||||||||||||||  |||||||||||| ||||||||| |
Sbjct: 183774 ctcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggt 183715

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| ||||| |||||||| |||||||||
Sbjct: 183714 gtcggggtggacctgctttagcaccttg 183687



 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| ||||||||||||||||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 183927 ggtgtacttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccggg 183868

                                                             
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 337
               || |  ||||| ||||  ||||||||||||| ||||||||||||||
Sbjct: 183867 cagcagcaggcgtacggccgtctggatctccctggaggtgatggtgg 183821



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 142538 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 142479

                                                           
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 142478 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 142434



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| |||||||||||||||| ||||||||||| |||||||||||||| || || || ||
Sbjct: 236019 ggtgtacttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccagg 235960

                                                           
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 235959 cagcagcaggcgcacggctgtctggatctccctggaggtgatggt 235915



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 168164 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 168105

                                                           
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
               || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 168104 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 168060



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             ||||||||||||||||| |||||| ||||||||   |||||||||||| ||||||||| |
Sbjct: 27384 ctcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgagatgccggt 27443

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| ||||| |||||||| || ||||||
Sbjct: 27444 gtcggggtggacctgcttcagaaccttg 27471



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              |||||| |||||||||| |||||||||||| ||   ||| |||||||| ||||||||| |
Sbjct: 257191 ctcgaaaatgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggt 257132

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| ||||| |||||||| |||||||||
Sbjct: 257131 gtcggggtggacctgcttcagcaccttg 257104



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              ||||||||||||||||| |||||| ||||||||   ||| |||||||| ||||||||| |
Sbjct: 142385 ctcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggt 142326

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| || || |||||||| |||||||||
Sbjct: 142325 gtcgggatggacctgcttcagcaccttg 142298



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              ||||||||| |||||||  ||||| ||||||||   |||||| ||||||||||||||| |
Sbjct: 235866 ctcgaagatatcgttgacaaaggaattcatgatccccatggctttggaggagatgccggt 235807

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| ||||| || ||||| |||||||||
Sbjct: 235806 gtcggggtggacttgcttcagcaccttg 235779



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                          
Query: 236    acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
              |||||||||| |||||||| || ||||| || ||||||||||| ||||| ||||| || |
Sbjct: 200280 acttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagca 200339

                                                      
Query: 296    cgaggcggacggaggtctggatctcccgggaggtgatggt 335
                || || |||| |||||||||||||| |||||| |||||
Sbjct: 200340 gcagacgcacggcggtctggatctccctggaggtaatggt 200379



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                          
Query: 384    ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
              |||||||||||||||||  ||||| ||||||||   |||||| || |||||||||||| |
Sbjct: 168011 ctcgaagatgtcgttgacaaaggaattcatgatccccatggctttagaggagatgccggt 167952

                                          
Query: 444    gtccgggtgcacctgcttgagcaccttg 471
              ||| ||||| ||||| || |||||||||
Sbjct: 167951 gtcggggtggacctgtttcagcaccttg 167924



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                          
Query: 385    tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
              |||||||||||||| | |||||| |||||||||  |||||||||||| ||||||||  | 
Sbjct: 200429 tcgaagatgtcgttaacgaaggaattcatgatgcccatggccttggatgagatgccagta 200488

                                         
Query: 445    tccgggtgcacctgcttgagcaccttg 471
              || ||||| ||||| || |||||||||
Sbjct: 200489 tcggggtgaacctgttttagcaccttg 200515



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                          
Query: 231    ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
              |||| |||||||||| |||||||||||||| || || ||||| ||||| ||||| |||||
Sbjct: 257344 ggtgtacttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccggg 257285

                                                           
Query: 291    gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
               || |  ||||| || |  || |||||||||| ||| ||||||||
Sbjct: 257284 tagcagcaggcgcacagccgtttggatctccctggaagtgatggt 257240



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                          
Query: 391    atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
              |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 107638 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 107697

                                   
Query: 451    tgcacctgcttgagcaccttg 471
              || ||||| || |||||||||
Sbjct: 107698 tggacctgtttcagcaccttg 107718



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 80/100 (80%)
 Strand = Plus / Plus

                                                                         
Query: 236   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
             ||||||| || ||||| ||||||||||| || || ||||| || ||||| || || || |
Sbjct: 27236 acttggtaactgccttagtgccctcggacacagcatgcttagccagctccccaggcagca 27295

                                                     
Query: 296   cgaggcggacggaggtctggatctcccgggaggtgatggt 335
               ||||| || |  ||||| ||||||| ||||||||||||
Sbjct: 27296 gcaggcgcacagccgtctgaatctccctggaggtgatggt 27335

---

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 621 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 680

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 681 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 725



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 86914 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccgg 86855

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| |||| |||||||||||||| ||||||||||||
Sbjct: 86854 aagcagcaggcgcacggcggtctggatctccctggaggtgatggt 86810



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             ||||||||||||||||| |||||||||||||||   ||||||||| || ||||||||| |
Sbjct: 86761 ctcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaagagatgccggt 86702

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| ||||| |||||||| |||||||||
Sbjct: 86701 gtcggggtggacctgcttcagcaccttg 86674



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 78/88 (88%)
 Strand = Plus / Plus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||| ||| |
Sbjct: 55575 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagataccggt 55634

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| ||||| |||||||| |||||||||
Sbjct: 55635 gtcggggtggacctgcttcagcaccttg 55662



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 55422 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 55481

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 55482 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 55526



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                         
Query: 388   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
             ||||||||||||| |||||||||||||||   ||| |||||||| ||||||||| |||| 
Sbjct: 79197 aagatgtcgttgacgaaggagttcatgattcccatagccttggaagagatgccggtgtcg 79256

                                     
Query: 448   gggtgcacctgcttgagcaccttg 471
             ||||| |||||||| |||||||||
Sbjct: 79257 gggtggacctgcttcagcaccttg 79280



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                         
Query: 236   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
             |||||||||||||||||||||||||||| |||||||||||||| |  || ||||| || |
Sbjct: 79045 acttggtgacggccttggtgccctcggacacggcgtgcttggccaattccccgggtagca 79104

                                                     
Query: 296   cgaggcggacggaggtctggatctcccgggaggtgatggt 335
               ||||| ||||  |||||||||||||  || ||||||||
Sbjct: 79105 gtaggcgcacggccgtctggatctccctcgaagtgatggt 79144



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 778 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 837

                                   
Query: 448 gggtgcacctgcttgagcaccttg 471
           ||||| || ||||| |||||||||
Sbjct: 838 gggtggacttgcttcagcaccttg 861



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 310   gtctggatctcccgggaggtgatggt 335
             ||||||||||||| ||||||||||||
Sbjct: 30318 gtctggatctccctggaggtgatggt 30293

---

>ref|NM_080593.1| Homo sapiens histone 1, H2bk (HIST1H2BK), mRNA
          Length = 820

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 411 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 352

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 351 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 307



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 257 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 198

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 197 tcggggtggacctgcttcagcaccttg 171

---

>ref|NM_003526.2| Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA
          Length = 438

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 310

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 309 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 265



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 209 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 150

                                
Query: 451 tgcacctgcttgagcaccttg 471
           || ||||| || |||||||||
Sbjct: 149 tggacctgtttcagcaccttg 129

---

>gb|BC009612.1| Homo sapiens histone 1, H2bc, mRNA (cDNA clone IMAGE:4102077), with
           apparent retained intron
          Length = 1178

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 391 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 332

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 331 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 287



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 231 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 172

                                
Query: 451 tgcacctgcttgagcaccttg 471
           || ||||| || |||||||||
Sbjct: 171 tggacctgtttcagcaccttg 151

---

>ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC478743), mRNA
          Length = 1047

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153

---

>ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC478743), mRNA
          Length = 487

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153

---

>ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611482), mRNA
          Length = 386

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 374 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 315

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 314 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 270



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 221 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 162

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 161 gtcggggtgcacctgcttcagcaccttg 134

---

>ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC611465), mRNA
          Length = 388

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136

---

>ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC488290), mRNA
          Length = 421

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136

---

>ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B histone family, member R
           (LOC488288), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 159 gtcggggtgcacctgcttcagcaccttg 132

---

>ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC488279), mRNA
          Length = 513

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 438 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 379

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 378 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 334



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 285 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 226

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 225 gtcggggtgcacctgcttcagcaccttg 198

---

>ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488276), mRNA
          Length = 438

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 376 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 317

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 316 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 272



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136

---

>ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B histone family, member T
           (LOC611158), mRNA
          Length = 883

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 363 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 304

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 303 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 259



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 210 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 151

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 150 gtcggggtgcacctgcttcagcaccttg 123

---

>ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone H2B 291B
           (LOC488296), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129

---

>ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B histone family, member F
           (LOC611089), mRNA
          Length = 381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129

---

>ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-specific histone 2b
           (LOC488252), mRNA
          Length = 384

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 372 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 313

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 312 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 268



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 159 gtcggggtgcacctgcttcagcaccttg 132

---

>ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC608682), mRNA
          Length = 342

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 330 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 271

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 270 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 226



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 177 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 118

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 117 gtcggggtgcacctgcttcagcaccttg 90

---

>ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC608682), mRNA
          Length = 383

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 371 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 312

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 311 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 267



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 218 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 159

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 158 gtcggggtgcacctgcttcagcaccttg 131

---

>ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 3 (LOC488303), mRNA
          Length = 651

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 326

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 281



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 232 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 173

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 172 gtcggggtgcacctgcttcagcaccttg 145

---

>ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B histone family, member
           T, transcript variant 2 (LOC488303), mRNA
          Length = 442

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 369 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 310

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 309 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 265



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129

---

>ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 2 (LOC488267), mRNA
          Length = 440

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 224 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 165

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 164 gtcggggtgcacctgcttcagcaccttg 137

---

>ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript
           variant 1 (LOC488267), mRNA
          Length = 1108

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 377 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 318

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 317 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 273



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 224 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 165

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 164 gtcggggtgcacctgcttcagcaccttg 137

---

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 615 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 556

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 555 gtcggggtgcacctgcttcagcaccttg 528

---

>ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 2 (LOC480760), mRNA
          Length = 487

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 393 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 334

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 333 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 289



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153

---

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 768 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccggg 709

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||| ||||||||
Sbjct: 708 cagcagcaggcgcacggccgtctggatctccctggacgtgatggt 664



 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Minus

                                                                       
Query: 384 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
           ||||||||||||||||| ||| ||||||||||||  |||||||||||| ||||||||  |
Sbjct: 615 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 556

                                       
Query: 444 gtccgggtgcacctgcttgagcaccttg 471
           ||| |||||||||||||| |||||||||
Sbjct: 555 gtcggggtgcacctgcttcagcaccttg 528

---

>gb|BC038854.1| Homo sapiens SECIS binding protein 2, mRNA (cDNA clone
           IMAGE:5209694), with apparent retained intron
          Length = 1740

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 370 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 311

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 310 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 266



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 210 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 151

                                
Query: 451 tgcacctgcttgagcaccttg 471
           || ||||| || |||||||||
Sbjct: 150 tggacctgtttcagcaccttg 130

---

>gb|AF531298.1| Homo sapiens histone H2B (HIST1H2BO) gene, complete cds
          Length = 1137

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 749 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 690

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 689 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 645



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 592 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 533

                                   
Query: 448 gggtgcacctgcttgagcaccttg 471
           ||||| || ||||| |||||||||
Sbjct: 532 gggtggacttgcttcagcaccttg 509

---

>gb|AF531294.1| Homo sapiens histone H2B (HIST1H2BK) gene, complete cds
          Length = 1137

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 748 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 689

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 688 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 644



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 594 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 535

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 534 tcggggtggacctgcttcagcaccttg 508

---

>gb|AF531286.1| Homo sapiens histone H2B (HIST1H2BC) gene, complete cds
          Length = 1137

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 748 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 689

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 688 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 644



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
           |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 588 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 529

                                
Query: 451 tgcacctgcttgagcaccttg 471
           || ||||| || |||||||||
Sbjct: 528 tggacctgtttcagcaccttg 508

---

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
             Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
             H2AFN, and H2BFN histone genes, the OR2B2 gene for
             olfactory receptor 2B2, histone H2B family member I
             pseudogene H2BFIP, a hypothetical protein pseudogene,
             ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 57572 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 57513

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 57512 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 57468



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                        
Query: 384  ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
            |||||||||||| |||| ||||||||||||||||  |||||||||||| ||||| ||| |
Sbjct: 2618 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagataccggt 2559

                                        
Query: 444  gtccgggtgcacctgcttgagcaccttg 471
            ||| ||||| |||||||| |||||||||
Sbjct: 2558 gtcggggtggacctgcttcagcaccttg 2531



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                        
Query: 231  ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
            |||| ||||||||||||||||||||||||| || || ||||||||||| ||||| || ||
Sbjct: 2771 ggtgtacttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctgg 2712

                                                         
Query: 291  gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
             || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 2711 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 2667



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                         
Query: 388   aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
             |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 57415 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 57356

                                     
Query: 448   gggtgcacctgcttgagcaccttg 471
             ||||| || ||||| |||||||||
Sbjct: 57355 gggtggacttgcttcagcaccttg 57332



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 310   gtctggatctcccgggaggtgatggt 335
             ||||||||||||| ||||||||||||
Sbjct: 27875 gtctggatctccctggaggtgatggt 27900

---

>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the
             3' part of the HFE gene for haemochromatosis protein, two
             genes for novel histone 4 family members, two genes for
             novel histone 1 family members, three genes for novel
             histone 2B family members, a gene for a novel histone 2A
             family member, a novel pseudogene, STSs, GSSs, ESTs and
             CpG islands, complete sequence
          Length = 101099

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 29859 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 29918

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 29919 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 29963



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| || ||
Sbjct: 64919 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccgg 64860

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 64859 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 64815



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| ||||||| ||||||||||||||||| || || ||||||||||| ||||| |||||
Sbjct: 90545 ggtgtacttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccggg 90486

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 90485 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 90441



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             ||||||||||||||||| |||||| ||||||||   ||| |||||||| ||||||||| |
Sbjct: 64766 ctcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggt 64707

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| || || |||||||| |||||||||
Sbjct: 64706 gtcgggatggacctgcttcagcaccttg 64679



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Minus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             |||||||||||||||||  ||||| ||||||||   |||||| || |||||||||||| |
Sbjct: 90392 ctcgaagatgtcgttgacaaaggaattcatgatccccatggctttagaggagatgccggt 90333

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| ||||| ||||| || |||||||||
Sbjct: 90332 gtcggggtggacctgtttcagcaccttg 90305



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                         
Query: 391   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
             |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 30019 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 30078

                                  
Query: 451   tgcacctgcttgagcaccttg 471
             || ||||| || |||||||||
Sbjct: 30079 tggacctgtttcagcaccttg 30099

---

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 69735 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 69794

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 69795 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 69839



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                         
Query: 385   tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
             |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 69889 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 69948

                                        
Query: 445   tccgggtgcacctgcttgagcaccttg 471
             || ||||| |||||||| |||||||||
Sbjct: 69949 tcggggtggacctgcttcagcaccttg 69975



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| |||||||||||||||| || |||||||| |||||||||||||| | ||| || ||
Sbjct: 55687 ggtgtacttggtgacggccttagtaccctcggacacggcgtgcttggccaactccccagg 55746

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 55747 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 55791



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Plus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             |||||| |||||||| |  || || |||||||||  |||||||||||| || |||||| |
Sbjct: 55840 ctcgaaaatgtcgttcacaaacgaattcatgatgcccatggccttggacgaaatgccggt 55899

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| ||||| |||||||| || ||||||
Sbjct: 55900 gtcagggtggacctgcttcagaaccttg 55927

---

>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B
          Length = 1661

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 410 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 469

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 470 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 514



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 567 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 626

                                   
Query: 448 gggtgcacctgcttgagcaccttg 471
           ||||| || ||||| |||||||||
Sbjct: 627 gggtggacttgcttcagcaccttg 650

---

>emb|AJ223352.1|HSAJ3352 Homo sapiens mRNA for for histone H2B, clone pjG4-5-14
          Length = 829

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 385 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 326

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 325 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 281



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 231 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 172

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 171 tcggggtggacctgcttcagcaccttg 145

---

>gb|BC064959.1| Homo sapiens histone 1, H2bk, mRNA (cDNA clone MGC:74942
           IMAGE:6093977), complete cds
          Length = 859

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 409 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 350

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 349 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 305



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 255 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 196

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 195 tcggggtggacctgcttcagcaccttg 169

---

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
             hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
             sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 231   ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
             |||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 17523 ggtgtacttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccggg 17464

                                                          
Query: 291   gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
              || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 17463 aagcagcaggcgcacggccgtctggatctccctggaggtgatggt 17419



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                         
Query: 384   ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 443
             ||||||||||||||||| |||||| ||||||||   |||||||||||| ||||||||| |
Sbjct: 97617 ctcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgagatgccggt 97558

                                         
Query: 444   gtccgggtgcacctgcttgagcaccttg 471
             ||| ||||| |||||||| || ||||||
Sbjct: 97557 gtcggggtggacctgcttcagaaccttg 97530



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                         
Query: 391   atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtccggg 450
             |||||||| | ||| || |||||||||  |||||||||||| ||||||||  |||| || 
Sbjct: 17363 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 17304

                                  
Query: 451   tgcacctgcttgagcaccttg 471
             || ||||| || |||||||||
Sbjct: 17303 tggacctgtttcagcaccttg 17283



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 80/100 (80%)
 Strand = Plus / Minus

                                                                         
Query: 236   acttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 295
             ||||||| || ||||| ||||||||||| || || ||||| || ||||| || || || |
Sbjct: 97765 acttggtaactgccttagtgccctcggacacagcatgcttagccagctccccaggcagca 97706

                                                     
Query: 296   cgaggcggacggaggtctggatctcccgggaggtgatggt 335
               ||||| || |  ||||| ||||||| ||||||||||||
Sbjct: 97705 gcaggcgcacagccgtctgaatctccctggaggtgatggt 97666

---

>dbj|AB041017.1| Homo sapiens H2BFS gene for H2B histone family protein, complete
           cds
          Length = 821

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||||||||||||||| |||||||||||||| | ||| |||||
Sbjct: 397 ggtgtacttggtgacggccttggtgccctcggacacggcgtgcttggccaactccccggg 338

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 337 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 293



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                       
Query: 385 tcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatg 444
           |||||||||||||||| |||||||||||||||   ||||||||| |||||||||||| ||
Sbjct: 243 tcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaggagatgccggtg 184

                                      
Query: 445 tccgggtgcacctgcttgagcaccttg 471
           || ||||| |||||||| |||||||||
Sbjct: 183 tcggggtggacctgcttcagcaccttg 157

---

>emb|BX647290.1|HSM807434 Homo sapiens mRNA; cDNA DKFZp781B2436 (from clone DKFZp781B2436)
          Length = 1890

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 290
           |||| |||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 407 ggtgtacttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccggg 348

                                                        
Query: 291 gaggacgaggcggacggaggtctggatctcccgggaggtgatggt 335
            || |  ||||| ||||  ||||||||||||| ||||||||||||
Sbjct: 347 cagcagcaggcgcacggccgtctggatctccctggaggtgatggt 303



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 388 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcc 447
           |||||||| |||| ||||||||||||||||  ||||||||| || ||||||||| |||| 
Sbjct: 250 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 191

                                   
Query: 448 gggtgcacctgcttgagcaccttg 471
           ||||| || ||||| |||||||||
Sbjct: 190 gggtggacttgcttcagcaccttg 167


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,052,134
Number of Sequences: 3902068
Number of extensions: 4052134
Number of successful extensions: 100228
Number of sequences better than 10.0: 1047
Number of HSP's better than 10.0 without gapping: 1094
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 94431
Number of HSP's gapped (non-prelim): 5630
length of query: 533
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 510
effective length of database: 17,143,297,704
effective search space: 8743081829040
effective search space used: 8743081829040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---