ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags24m24
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ784281.1| Hordeum vulgare subsp. vulgare partial mRNA for ... 226 3e-56
2ref|NM_191088.1| Oryza sativa (japonica cultivar-group), predic... 70 5e-09
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 70 5e-09
4dbj|AP003411.4| Oryza sativa (japonica cultivar-group) genomic D... 70 5e-09
5dbj|AP003255.3| Oryza sativa (japonica cultivar-group) genomic D... 70 5e-09
6dbj|AK065059.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 5e-09
7dbj|AK060836.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
8emb|AJ004915.1|MDJ004915 Malus domestica mRNA for phosphoglycero... 64 3e-07
9dbj|AK110143.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 1e-06
10dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
11dbj|AK065541.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
12gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome... 58 2e-05
13gb|BT017744.1| Zea mays clone EL01N0449F02.c mRNA sequence 54 3e-04
14emb|Z33612.1|ZMPHMU2 Z.mays (W22) phosphoglycerate mutase gene e... 54 3e-04
15gb|M80912.1|MZEPPGM Zea mays cofactor-independent phosphoglycera... 54 3e-04
16gb|BT018558.1| Zea mays clone EL01N0439H08.d mRNA sequence 52 0.001
17gb|BT016770.1| Zea mays clone Contig603 mRNA sequence 52 0.001
18gb|AY103600.1| Zea mays PCO072546 mRNA sequence 52 0.001
19gb|AC007374.6|AC007374 Homo sapiens chromosome 14 clone RP11-325... 48 0.017
20emb|AL121784.5|CNS01DSH Human chromosome 14 DNA sequence BAC R-3... 48 0.017
21gb|U16021.1|MCU16021 Mesembryanthemum crystallinum phosphoglycer... 46 0.066
22gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, com... 44 0.26
23gb|AC134474.4| Mus musculus BAC clone RP23-234N16 from chromosom... 42 1.0
24emb|AL354836.13| Human DNA sequence from clone RP11-157P1 on chr... 42 1.0
25gb|AC155641.8| Mus musculus 10 BAC RP24-121N1 (Roswell Park Canc... 42 1.0
26emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on ch... 42 1.0
27emb|AL671867.8| Mouse DNA sequence from clone RP23-131J17 on chr... 42 1.0
28dbj|AB063037.1| Macaca fascicularis brain cDNA clone:QmoA-11735,... 42 1.0
29gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, co... 40 4.0
30gb|AY153760.1| Agrostis stolonifera var. palustris chloroplast l... 40 4.0
31gb|AY153759.1| Agrostis stolonifera var. palustris chloroplast l... 40 4.0
32gb|AY153758.1| Agrostis stolonifera var. palustris chloroplast l... 40 4.0
33gb|AC159746.5| Mus musculus 6 BAC RP23-437F11 (Roswell Park Canc... 40 4.0
34gb|AC107810.8| Mus musculus chromosome 1, clone RP23-68D4, compl... 40 4.0
35emb|AL163011.3|CNS01RI8 Human chromosome 14 DNA sequence BAC C-2... 40 4.0 
>emb|AJ784281.1| Hordeum vulgare subsp. vulgare partial mRNA for putative
           2,3-bisphosphoglycerate-independent phosphoglycerate
           mutase (pgam-I gene)
          Length = 196

 Score =  226 bits (114), Expect = 3e-56
 Identities = 117/118 (99%)
 Strand = Plus / Minus

                                                                       
Query: 188 cgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcaccgtgg 247
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 cgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcaccgtgg 107

                                                                     
Query: 248 cggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctcactcctgggtg 305
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 106 cggcaacgttggcgagcccgggtgtctggatgtcagagcggaatctcactcctgggtg 49
to top
>ref|NM_191088.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1551

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
            ||||| || ||||| |||||||| |  ||||| || |||||||||| ||| ||||||| |
Sbjct: 1547 ttgtccacaacttcaatgagggttggttcgtagtcagcaggagcctcgaaaccatggaag 1488

                                                                        
Query: 235  ttcatcaccgtggcggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctc 294
            ||||| || || || ||||| |||||||||||  | ||||| |||||||| |||||| ||
Sbjct: 1487 ttcattacggttgcagcaacattggcgagcccaggggtctgaatgtcagaccggaatttc 1428

                       
Query: 295  actcctgggtg 305
            || || |||||
Sbjct: 1427 acaccagggtg 1417
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                            
Query: 175      ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
                ||||| || ||||| |||||||| |  ||||| || |||||||||| ||| ||||||| |
Sbjct: 34801017 ttgtccacaacttcaatgagggttggttcgtagtcagcaggagcctcgaaaccatggaag 34800958

                                                                            
Query: 235      ttcatcaccgtggcggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctc 294
                ||||| || || || ||||| |||||||||||  | ||||| |||||||| |||||| ||
Sbjct: 34800957 ttcattacggttgcagcaacattggcgagcccaggggtctgaatgtcagaccggaatttc 34800898

                           
Query: 295      actcctgggtg 305
                || || |||||
Sbjct: 34800897 acaccagggtg 34800887
to top
>dbj|AP003411.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1148D12
          Length = 132060

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                          
Query: 175    ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
              ||||| || ||||| |||||||| |  ||||| || |||||||||| ||| ||||||| |
Sbjct: 116257 ttgtccacaacttcaatgagggttggttcgtagtcagcaggagcctcgaaaccatggaag 116198

                                                                          
Query: 235    ttcatcaccgtggcggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctc 294
              ||||| || || || ||||| |||||||||||  | ||||| |||||||| |||||| ||
Sbjct: 116197 ttcattacggttgcagcaacattggcgagcccaggggtctgaatgtcagaccggaatttc 116138

                         
Query: 295    actcctgggtg 305
              || || |||||
Sbjct: 116137 acaccagggtg 116127
to top
>dbj|AP003255.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0454H12
          Length = 161004

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                         
Query: 175   ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
             ||||| || ||||| |||||||| |  ||||| || |||||||||| ||| ||||||| |
Sbjct: 60189 ttgtccacaacttcaatgagggttggttcgtagtcagcaggagcctcgaaaccatggaag 60130

                                                                         
Query: 235   ttcatcaccgtggcggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctc 294
             ||||| || || || ||||| |||||||||||  | ||||| |||||||| |||||| ||
Sbjct: 60129 ttcattacggttgcagcaacattggcgagcccaggggtctgaatgtcagaccggaatttc 60070

                        
Query: 295   actcctgggtg 305
             || || |||||
Sbjct: 60069 acaccagggtg 60059
to top
>dbj|AK065059.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001J10, full
            insert sequence
          Length = 2026

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
            ||||| || ||||| |||||||| |  ||||| || |||||||||| ||| ||||||| |
Sbjct: 1768 ttgtccacaacttcaatgagggttggttcgtagtcagcaggagcctcgaaaccatggaag 1709

                                                                        
Query: 235  ttcatcaccgtggcggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctc 294
            ||||| || || || ||||| |||||||||||  | ||||| |||||||| |||||| ||
Sbjct: 1708 ttcattacggttgcagcaacattggcgagcccaggggtctgaatgtcagaccggaatttc 1649

                       
Query: 295  actcctgggtg 305
            || || |||||
Sbjct: 1648 acaccagggtg 1638
to top
>dbj|AK060836.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-C10, full
            insert sequence
          Length = 1945

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                        
Query: 184  acttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcacc 243
            ||||| |||||||| |  ||||| || |||||||||| ||| ||||||| |||||| || 
Sbjct: 1671 acttcaatgagggttggttcgtagtcagcaggagcctcgaaaccatggaagttcattacg 1612

                                                                        
Query: 244  gtggcggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctcactcctggg 303
            || || ||||| |||||||||||  | ||||| |||||||| |||||| |||| || |||
Sbjct: 1611 gttgcagcaacattggcgagcccaggggtctgaatgtcagaccggaatttcacaccaggg 1552

              
Query: 304  tg 305
            ||
Sbjct: 1551 tg 1550
to top
>emb|AJ004915.1|MDJ004915 Malus domestica mRNA for phosphoglyceromutase, complete cds
          Length = 2132

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                        
Query: 184  acttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcacc 243
            |||||||||||||  | |||||| |||  |||||||||||| ||||| ||||||||||| 
Sbjct: 1741 acttcgatgagggatggctcgtagtcgctaggagcctggaatccatgcaggttcatcaca 1682

                                    
Query: 244  gtggcggcaacgttggcgagcccg 267
            || || ||||| ||||| ||||||
Sbjct: 1681 gttgcagcaacattggccagcccg 1658
to top
>dbj|AK110143.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-D09, full
           insert sequence
          Length = 3350

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 175 ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
           ||||| || ||||| |||||||| |  ||||| || |||||||||| ||| ||||||| |
Sbjct: 738 ttgtccacaacttcaatgagggttggttcgtagtcagcaggagcctcgaaaccatggaag 679

                                                                       
Query: 235 ttcatcaccgtggcggcaacgttggcgagcccgtgtgtctggatgtcagagcggaatctc 294
           |||||  | || || ||||| |||||||||||  | ||||| |||||||| |||||| ||
Sbjct: 678 ttcattgcggttgcagcaacattggcgagcccaggggtctgaatgtcagaccggaatttc 619

                      
Query: 295 actcctgggtg 305
           || || |||||
Sbjct: 618 acaccagggtg 608
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                            
Query: 175      ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
                ||||| || ||||| || ||||| | |||||| || ||||| ||||  || || ||||||
Sbjct: 23603660 ttgtcaactacttcaattagggttggctcgtagtcagcaggggcctcaaacccgtggagg 23603719

                                             
Query: 235      ttcatcaccgtggcggcaacgttggcgag 263
                |||||||| |||||||| |||||||||||
Sbjct: 23603720 ttcatcacggtggcggcgacgttggcgag 23603748
to top
>dbj|AK065541.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029A18, full
            insert sequence
          Length = 1920

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                        
Query: 175  ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
            ||||| || ||||| || ||||| | |||||| || ||||| ||||  || || ||||||
Sbjct: 1770 ttgtcaactacttcaattagggttggctcgtagtcagcaggggcctcaaacccgtggagg 1711

                                         
Query: 235  ttcatcaccgtggcggcaacgttggcgag 263
            |||||||| |||||||| |||||||||||
Sbjct: 1710 ttcatcacggtggcggcgacgttggcgag 1682
to top
>gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0095J22,
              complete sequence
          Length = 151730

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                          
Query: 175    ttgtcgacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggagg 234
              ||||| || ||||| || ||||| | |||||| || ||||| ||||  || || ||||||
Sbjct: 140832 ttgtcaactacttcaattagggttggctcgtagtcagcaggggcctcaaacccgtggagg 140891

                                           
Query: 235    ttcatcaccgtggcggcaacgttggcgag 263
              |||||||| |||||||| |||||||||||
Sbjct: 140892 ttcatcacggtggcggcgacgttggcgag 140920
to top
>gb|BT017744.1| Zea mays clone EL01N0449F02.c mRNA sequence
          Length = 679

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 184 acttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcacc 243
           ||||| ||||||||   |||||| || ||||| ||||  || || |||||||||||||| 
Sbjct: 499 acttcaatgagggtttgctcgtagtcagcaggggcctcaaatccgtggaggttcatcacg 440

                                  
Query: 244 gtggcggcaacgttggcgagccc 266
           || ||||| ||||||||||||||
Sbjct: 439 gttgcggctacgttggcgagccc 417
to top
>emb|Z33612.1|ZMPHMU2 Z.mays (W22) phosphoglycerate mutase gene exons 2-8
          Length = 3583

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                        
Query: 184  acttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcacc 243
            ||||| ||||||||   |||||| || ||||| ||||  || || |||||||||||||| 
Sbjct: 3231 acttcaatgagggtttgctcgtagtcagcaggggcctcaaatccgtggaggttcatcacg 3172

                                   
Query: 244  gtggcggcaacgttggcgagccc 266
            || ||||| ||||||||||||||
Sbjct: 3171 gttgcggctacgttggcgagccc 3149
to top
>gb|M80912.1|MZEPPGM Zea mays cofactor-independent phosphoglycerate mutase mRNA, complete
            cds
          Length = 1946

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                        
Query: 184  acttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcatcacc 243
            ||||| ||||||||   |||||| || ||||| ||||  || || |||||||||||||| 
Sbjct: 1667 acttcaatgagggtttgctcgtagtcagcaggggcctcaaatccgtggaggttcatcacg 1608

                                   
Query: 244  gtggcggcaacgttggcgagccc 266
            || ||||| ||||||||||||||
Sbjct: 1607 gttgcggctacgttggcgagccc 1585
to top
>gb|BT018558.1| Zea mays clone EL01N0439H08.d mRNA sequence
          Length = 1718

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 201  ctcgtaatcggcaggagcctggaagccatggaggttcatcaccgtggcggcaacgttggc 260
            |||||| || ||||| ||||  || ||||||||||||||||| || ||||| || |||||
Sbjct: 1479 ctcgtagtccgcaggggcctcaaatccatggaggttcatcacagttgcggctacattggc 1420

                  
Query: 261  gagccc 266
            ||||||
Sbjct: 1419 gagccc 1414
to top
>gb|BT016770.1| Zea mays clone Contig603 mRNA sequence
          Length = 1688

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 201  ctcgtaatcggcaggagcctggaagccatggaggttcatcaccgtggcggcaacgttggc 260
            |||||| || ||||| ||||  || ||||||||||||||||| || ||||| || |||||
Sbjct: 1303 ctcgtagtccgcaggggcctcaaatccatggaggttcatcacagttgcggctacattggc 1244

                  
Query: 261  gagccc 266
            ||||||
Sbjct: 1243 gagccc 1238
to top
>gb|AY103600.1| Zea mays PCO072546 mRNA sequence
          Length = 2174

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 201  ctcgtaatcggcaggagcctggaagccatggaggttcatcaccgtggcggcaacgttggc 260
            |||||| || ||||| ||||  || ||||||||||||||||| || ||||| || |||||
Sbjct: 1791 ctcgtagtcagcaggggcctcaaatccatggaggttcatcacagttgcggctacattggc 1732

                  
Query: 261  gagccc 266
            ||||||
Sbjct: 1731 gagccc 1726
to top
>gb|AC007374.6|AC007374 Homo sapiens chromosome 14 clone RP11-325L17 map 14q31, complete sequence
          Length = 190565

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 93     cattccttgacccaccccaaaact 116
              ||||||||||||||||||||||||
Sbjct: 133361 cattccttgacccaccccaaaact 133338
to top
>emb|AL121784.5|CNS01DSH Human chromosome 14 DNA sequence BAC R-305I3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 180523

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 93     cattccttgacccaccccaaaact 116
              ||||||||||||||||||||||||
Sbjct: 110880 cattccttgacccaccccaaaact 110857
to top
>gb|U16021.1|MCU16021 Mesembryanthemum crystallinum phosphoglyceromutase (pgm) gene,
            complete cds
          Length = 2032

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                        
Query: 180  gacgacttcgatgagggtcgtctcgtaatcggcaggagcctggaagccatggaggttcat 239
            |||||| ||||||||||| | ||||||||||  ||||||||  || ||||| || |||||
Sbjct: 1775 gacgacctcgatgagggttggctcgtaatcgctaggagcctcaaacccatgaagattcat 1716

               
Query: 240  cac 242
            |||
Sbjct: 1715 cac 1713
to top
>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 91     atcattccttgacccaccccaaaact 116
              |||| |||||||||||||||||||||
Sbjct: 111352 atcaatccttgacccaccccaaaact 111327
to top
>gb|AC134474.4| Mus musculus BAC clone RP23-234N16 from chromosome 6, complete sequence
          Length = 171491

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 210   ggcaggagcctggaagccatggagg 234
             |||||||||||||| ||||||||||
Sbjct: 72358 ggcaggagcctggaggccatggagg 72382
to top
>emb|AL354836.13| Human DNA sequence from clone RP11-157P1 on chromosome 20 Contains the
             LAMA5 gene for laminin alpha 5 (KIAA0533), the GP110 gene
             for cell membrane glycoprotein (surface antigen),
             110000M(r), the KIAA0772 gene with similarity to the gene
             for oxysterol-binding protein and two putative novel
             genes, complete sequence
          Length = 141056

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 22    acctttctcaatgttacacat 42
             |||||||||||||||||||||
Sbjct: 39452 acctttctcaatgttacacat 39432
to top
>gb|AC155641.8| Mus musculus 10 BAC RP24-121N1 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 195480

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 96     tccttgacccaccccaaaact 116
              |||||||||||||||||||||
Sbjct: 117723 tccttgacccaccccaaaact 117743
to top
>emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on chromosome 4, complete
             sequence
          Length = 182829

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 210   ggcaggagcctggaagccatggagg 234
             ||||||| |||||||||||||||||
Sbjct: 62135 ggcaggaacctggaagccatggagg 62159
to top
>emb|AL671867.8| Mouse DNA sequence from clone RP23-131J17 on chromosome 4, complete
             sequence
          Length = 202342

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 90    gatcattccttgacccacccc 110
             |||||||||||||||||||||
Sbjct: 85302 gatcattccttgacccacccc 85322
to top
>dbj|AB063037.1| Macaca fascicularis brain cDNA clone:QmoA-11735, full insert sequence
          Length = 3116

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 22   acctttctcaatgttacacat 42
            |||||||||||||||||||||
Sbjct: 2503 acctttctcaatgttacacat 2483
to top
>gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, complete sequence
          Length = 136276

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 205    taatcggcaggagcctggaagcca 228
              |||| |||||||||||||||||||
Sbjct: 112576 taattggcaggagcctggaagcca 112599
to top
>gb|AY153760.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.8 gene, complete cds; nuclear
            gene for chloroplast product
          Length = 3098

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 124  caaaattggctaccgcaattttgg 147
            |||||||||||||| |||||||||
Sbjct: 2815 caaaattggctacctcaattttgg 2838
to top
>gb|AY153759.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.2m gene, complete cds; nuclear
            gene for chloroplast product
          Length = 2922

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 124  caaaattggctaccgcaattttgg 147
            |||||||||||||| |||||||||
Sbjct: 2787 caaaattggctacctcaattttgg 2810
to top
>gb|AY153758.1| Agrostis stolonifera var. palustris chloroplast low molecular weight
            heat shock protein HSP26.2 gene, complete cds; nuclear
            gene for chloroplast product
          Length = 3064

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 124  caaaattggctaccgcaattttgg 147
            |||||||||||||| |||||||||
Sbjct: 2784 caaaattggctacctcaattttgg 2807
to top
>gb|AC159746.5| Mus musculus 6 BAC RP23-437F11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 171039

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     ccttgacccaccccaaaact 116
              ||||||||||||||||||||
Sbjct: 141948 ccttgacccaccccaaaact 141929
to top
>gb|AC107810.8| Mus musculus chromosome 1, clone RP23-68D4, complete sequence
          Length = 160167

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 100   tgacccaccccaaaactata 119
             ||||||||||||||||||||
Sbjct: 50763 tgacccaccccaaaactata 50782
to top
>emb|AL163011.3|CNS01RI8 Human chromosome 14 DNA sequence BAC C-2324M15 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 100791

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    ctggcaaatctcaaattatt 80
             ||||||||||||||||||||
Sbjct: 63746 ctggcaaatctcaaattatt 63765


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,118,572
Number of Sequences: 3902068
Number of extensions: 2118572
Number of successful extensions: 40098
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40036
Number of HSP's gapped (non-prelim): 62
length of query: 308
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 286
effective length of database: 17,147,199,772
effective search space: 4904099134792
effective search space used: 4904099134792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top