Clone Name	rbags24k23
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|X76605.1|HVB15C H.vulgare (cv. Bomi) B15C mRNA	955	0.0
2	emb|X96551.1|HVPER1 H.vulgare Per1 gene	946	0.0
3	gb|AF327046.1|AF327046 Triticum turgidum subsp. durum 1-Cys pero...	729	0.0
4	gb|AY304482.1| Triticum aestivum cultivar Soissons 1-Cys-peroxir...	680	0.0
5	emb|X63202.1|BSEMSP B.secalinas embryo-specific mRNA	613	e-172
6	gb|BT016686.1| Zea mays clone Contig519 mRNA sequence	339	5e-90
7	ref|XM_479271.1| Oryza sativa (japonica cultivar-group), mRNA	252	1e-63
8	ref|XM_506500.1| PREDICTED Oryza sativa (japonica cultivar-group...	252	1e-63
9	gb|AY336994.1| Oryza sativa (japonica cultivar-group) peroxiredo...	252	1e-63
10	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	252	1e-63
11	dbj|AP005292.5| Oryza sativa (japonica cultivar-group) genomic D...	252	1e-63
12	dbj|AK102982.1| Oryza sativa (japonica cultivar-group) cDNA clon...	252	1e-63
13	dbj|AK101401.1| Oryza sativa (japonica cultivar-group) cDNA clon...	252	1e-63
14	ref|XM_479272.1| Oryza sativa (japonica cultivar-group), mRNA	236	6e-59
15	ref|XM_506501.1| PREDICTED Oryza sativa (japonica cultivar-group...	236	6e-59
16	dbj|AK104089.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	6e-59
17	dbj|AK073273.1| Oryza sativa (japonica cultivar-group) cDNA clon...	230	4e-57
18	dbj|D63917.1|RICRAB24P Rice mRNA for RAB24 protein, complete cds	198	1e-47
19	gb|AF484696.1| Xerophyta viscosa 1-cys peroxiredoxin (Per1) mRNA...	92	2e-15
20	gb|AF191099.1|AF191099 Fagopyrum esculentum 1-Cys peroxiredoxin ...	64	5e-07
21	ref|NM_103709.3| Arabidopsis thaliana ATPER1; antioxidant AT1G48...	56	1e-04
22	gb|BT014873.1| Arabidopsis thaliana At1g48130 gene, complete cds	56	1e-04
23	emb|Y12089.1|AT12089 A.thaliana Per1 gene	56	1e-04
24	emb|BX817653.1|CNS0AAWD Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
25	gb|BT003916.1| Arabidopsis thaliana clone RAFL15-09-L01 (R20672)...	56	1e-04
26	gb|AC023673.3|AC023673 Genomic sequence for Arabidopsis thaliana...	56	1e-04
27	emb|BX818549.1|CNS0ABAN Arabidopsis thaliana Full-length cDNA Co...	52	0.002
28	ref|NM_184127.2| Oryza sativa (japonica cultivar-group), mRNA	44	0.44
29	gb|AY679591.1| Fragaria x ananassa 1-Cys peroxiredoxin mRNA, par...	44	0.44
30	gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome	44	0.44
31	emb|BX053384.1|CNS09DCS Single read from an extremity of a full-...	44	0.44
32	emb|BX053383.1|CNS09DCR Single read from an extremity of a full-...	44	0.44
33	emb|BX070810.1|CNS09QSU Single read from an extremity of a full-...	44	0.44
34	emb|BX069290.1|CNS09PMM Single read from an extremity of a full-...	44	0.44
35	emb|BX069289.1|CNS09PML Single read from an extremity of a full-...	44	0.44
36	emb|BX068000.1|CNS09OMS Single read from an extremity of a full-...	44	0.44
37	emb|BX067999.1|CNS09OMR Single read from an extremity of a full-...	44	0.44
38	emb|BX067924.1|CNS09OKO Single read from an extremity of a full-...	44	0.44
39	emb|BX067923.1|CNS09OKN Single read from an extremity of a full-...	44	0.44
40	emb|BX067642.1|CNS09OCU Single read from an extremity of a full-...	44	0.44
41	emb|BX067641.1|CNS09OCT Single read from an extremity of a full-...	44	0.44
42	emb|BX067553.1|CNS09OAD Single read from an extremity of a full-...	44	0.44
43	emb|BX067552.1|CNS09OAC Single read from an extremity of a full-...	44	0.44
44	emb|BX066871.1|CNS09NRF Single read from an extremity of a full-...	44	0.44
45	emb|BX066870.1|CNS09NRE Single read from an extremity of a full-...	44	0.44
46	emb|BX066317.1|CNS09NC1 Single read from an extremity of a full-...	44	0.44
47	emb|BX066088.1|CNS09N5O Single read from an extremity of a full-...	44	0.44
48	emb|BX066087.1|CNS09N5N Single read from an extremity of a full-...	44	0.44
49	emb|BX064916.1|CNS09M94 Single read from an extremity of a full-...	44	0.44
50	emb|BX064915.1|CNS09M93 Single read from an extremity of a full-...	44	0.44
51	emb|BX064537.1|CNS09LYL Single read from an extremity of a full-...	44	0.44
52	emb|BX064536.1|CNS09LYK Single read from an extremity of a full-...	44	0.44
53	emb|BX064227.1|CNS09LPZ Single read from an extremity of a full-...	44	0.44
54	emb|BX063236.1|CNS09KYG Single read from an extremity of a full-...	44	0.44
55	emb|BX063235.1|CNS09KYF Single read from an extremity of a full-...	44	0.44
56	emb|BX063000.1|CNS09KRW Single read from an extremity of a full-...	44	0.44
57	emb|BX062999.1|CNS09KRV Single read from an extremity of a full-...	44	0.44
58	emb|BX062727.1|CNS09KKB Single read from an extremity of a full-...	44	0.44
59	emb|BX062083.1|CNS09K2F Single read from an extremity of a full-...	44	0.44
60	emb|BX062082.1|CNS09K2E Single read from an extremity of a full-...	44	0.44
61	emb|BX061501.1|CNS09JM9 Single read from an extremity of a full-...	44	0.44
62	emb|BX061473.1|CNS09JLH Single read from an extremity of a full-...	44	0.44
63	emb|BX060364.1|CNS09IQO Single read from an extremity of a full-...	44	0.44
64	emb|BX060363.1|CNS09IQN Single read from an extremity of a full-...	44	0.44
65	emb|BX059169.1|CNS09HTH Single read from an extremity of a full-...	44	0.44
66	emb|BX059168.1|CNS09HTG Single read from an extremity of a full-...	44	0.44
67	emb|BX057376.1|CNS09GFO Single read from an extremity of a full-...	44	0.44
68	emb|BX057375.1|CNS09GFN Single read from an extremity of a full-...	44	0.44
69	emb|BX056369.1|CNS09FNP Single read from an extremity of a full-...	44	0.44
70	emb|BX056328.1|CNS09FMK Single read from an extremity of a full-...	44	0.44
71	emb|BX056327.1|CNS09FMJ Single read from an extremity of a full-...	44	0.44
72	emb|BX055202.1|CNS09ERA Single read from an extremity of a full-...	44	0.44
73	emb|BX055201.1|CNS09ER9 Single read from an extremity of a full-...	44	0.44
74	emb|BX051413.1|CNS09BU1 Single read from an extremity of a full-...	44	0.44
75	emb|BX051412.1|CNS09BU0 Single read from an extremity of a full-...	44	0.44
76	emb|BX048982.1|CNS099YI Single read from an extremity of a full-...	44	0.44
77	emb|BX048360.1|CNS099H8 Single read from an extremity of a full-...	44	0.44
78	emb|BX044318.1|CNS096CY Single read from an extremity of a full-...	44	0.44
79	emb|BX044317.1|CNS096CX Single read from an extremity of a full-...	44	0.44
80	emb|BX042869.1|CNS0958P Single read from an extremity of a full-...	44	0.44
81	emb|BX042868.1|CNS0958O Single read from an extremity of a full-...	44	0.44
82	emb|BX041612.1|CNS0949S Single read from an extremity of a full-...	44	0.44
83	emb|BX041611.1|CNS0949R Single read from an extremity of a full-...	44	0.44
84	emb|BX041334.1|CNS09422 Single read from an extremity of a full-...	44	0.44
85	emb|BX041333.1|CNS09421 Single read from an extremity of a full-...	44	0.44
86	emb|BX041214.1|CNS093YQ Single read from an extremity of a full-...	44	0.44
87	emb|BX041213.1|CNS093YP Single read from an extremity of a full-...	44	0.44
88	emb|BX041188.1|CNS093Y0 Single read from an extremity of a full-...	44	0.44
89	emb|BX041187.1|CNS093XZ Single read from an extremity of a full-...	44	0.44
90	emb|BX039275.1|CNS092GV Single read from an extremity of a full-...	44	0.44
91	emb|BX039274.1|CNS092GU Single read from an extremity of a full-...	44	0.44
92	emb|BX037468.1|CNS0912O Single read from an extremity of a full-...	44	0.44
93	emb|BX037467.1|CNS0912N Single read from an extremity of a full-...	44	0.44
94	emb|BX036510.1|CNS090C2 Single read from an extremity of a full-...	44	0.44
95	emb|BX035990.1|CNS08ZXM Single read from an extremity of a full-...	44	0.44
96	emb|BX034262.1|CNS08YLM Single read from an extremity of a full-...	44	0.44
97	emb|BX031811.1|CNS08WPJ Single read from an extremity of a full-...	44	0.44
98	emb|BX031810.1|CNS08WPI Single read from an extremity of a full-...	44	0.44
99	emb|BX031320.1|CNS08WBW Single read from an extremity of a full-...	44	0.44
100	emb|BX031319.1|CNS08WBV Single read from an extremity of a full-...	44	0.44
101	emb|BX031133.1|CNS08W6P Single read from an extremity of a full-...	44	0.44
102	emb|BX031132.1|CNS08W6O Single read from an extremity of a full-...	44	0.44
103	emb|BX028834.1|CNS08UEU Single read from an extremity of a full-...	44	0.44
104	emb|BX028833.1|CNS08UET Single read from an extremity of a full-...	44	0.44
105	emb|BX027737.1|CNS08TKD Single read from an extremity of a full-...	44	0.44
106	emb|BX025425.1|CNS08RS5 Single read from an extremity of a full-...	44	0.44
107	emb|BX025424.1|CNS08RS4 Single read from an extremity of a full-...	44	0.44
108	emb|BX025171.1|CNS08RL3 Single read from an extremity of a full-...	44	0.44
109	emb|BX025170.1|CNS08RL2 Single read from an extremity of a full-...	44	0.44
110	emb|BX023597.1|CNS08QDD Single read from an extremity of a full-...	44	0.44
111	emb|BX023566.1|CNS08QCI Single read from an extremity of a full-...	44	0.44
112	emb|BX021889.1|CNS08P1X Single read from an extremity of a full-...	44	0.44
113	emb|BX021888.1|CNS08P1W Single read from an extremity of a full-...	44	0.44
114	emb|BX020060.1|CNS08NN4 Single read from an extremity of a full-...	44	0.44
115	emb|BX020059.1|CNS08NN3 Single read from an extremity of a full-...	44	0.44
116	emb|BX019879.1|CNS08NI3 Single read from an extremity of a full-...	44	0.44
117	emb|BX019878.1|CNS08NI2 Single read from an extremity of a full-...	44	0.44
118	emb|BX016635.1|CNS08KZZ Single read from an extremity of a full-...	44	0.44
119	emb|BX016634.1|CNS08KZY Single read from an extremity of a full-...	44	0.44
120	emb|BX015941.1|CNS08KGP Single read from an extremity of a full-...	44	0.44
121	emb|BX014548.1|CNS08JE0 Single read from an extremity of a full-...	44	0.44
122	emb|BX014547.1|CNS08JDZ Single read from an extremity of a full-...	44	0.44
123	emb|BX013680.1|CNS08IPW Single read from an extremity of a full-...	44	0.44
124	emb|BX013679.1|CNS08IPV Single read from an extremity of a full-...	44	0.44
125	emb|BX012100.1|CNS08HI0 Single read from an extremity of a full-...	44	0.44
126	emb|BX012009.1|CNS08HFH Single read from an extremity of a full-...	44	0.44
127	emb|BX011355.1|CNS08GXB Single read from an extremity of a full-...	44	0.44
128	emb|BX011354.1|CNS08GXA Single read from an extremity of a full-...	44	0.44
129	emb|BX009675.1|CNS08FMN Single read from an extremity of a full-...	44	0.44
130	emb|BX009674.1|CNS08FMM Single read from an extremity of a full-...	44	0.44
131	emb|BX009416.1|CNS08FFG Single read from an extremity of a full-...	44	0.44
132	emb|BX005616.1|CNS08CHW Single read from an extremity of a full-...	44	0.44
133	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	44	0.44
134	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.44
135	dbj|AP002541.2| Oryza sativa (japonica cultivar-group) genomic D...	44	0.44
136	dbj|AP002868.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.44
137	ref|XM_308081.2| Anopheles gambiae str. PEST ENSANGP00000019782 ...	44	0.44
138	dbj|AK105948.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.44
139	dbj|AK071050.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.44
140	dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp...	44	0.44
141	ref|XM_322365.1| Neurospora crassa OR74A predicted protein (NCU0...	42	1.8
142	ref|XM_952658.1| Neurospora crassa OR74A hypothetical protein (N...	42	1.8
143	gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl...	42	1.8
144	dbj|AB124932.1| Uncultured sulfate-reducing bacterium DsrA, DsrB...	42	1.8
145	dbj|AB124920.1| Uncultured sulfate-reducing bacterium DsrA, DsrB...	42	1.8
146	gb|AC090522.1|AC090522 Caenorhabditis briggsae cosmid CB015K23, ...	42	1.8
147	dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g...	42	1.8
148	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	42	1.8
149	gb|AE017221.1| Thermus thermophilus HB27, complete genome	42	1.8
150	gb|AC008337.8| Drosophila melanogaster clone BACR02B03, complete...	40	6.9
151	gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ...	40	6.9
152	gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complet...	40	6.9
153	ref|XM_965890.1| PREDICTED: Tribolium castaneum similar to Ran-s...	40	6.9
154	emb|BX248341.1| Mycobacterium bovis subsp. bovis AF2122/97 compl...	40	6.9
155	emb|BX248340.1| Mycobacterium bovis subsp. bovis AF2122/97 compl...	40	6.9
156	ref|NM_133148.2| Drosophila melanogaster CG8034-RA (CG8034), mRNA	40	6.9
157	gb|AY069772.1| Drosophila melanogaster SD01508 full length cDNA	40	6.9
158	gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g...	40	6.9
159	gb|AE003511.4| Drosophila melanogaster chromosome X, section 63 ...	40	6.9
160	gb|M74438.1|GATATAT Gatrotheca riobambae 5S rRNA gene, complete ...	40	6.9

---

>emb|X76605.1|HVB15C H.vulgare (cv. Bomi) B15C mRNA
          Length = 864

 Score =  955 bits (482), Expect = 0.0
 Identities = 495/501 (98%)
 Strand = Plus / Minus

                                                                       
Query: 14  aaacgacacatgctaccacaaaagtacgcacgcaccacaacgacacataccaccaccata 73
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 808 aaacgacacatgctaccacaaaagtacgcacgcaccacaacgacacataccaccaccata 749

                                                                       
Query: 74  agtaaccgagcaagcgccgacgagctagcacggacggacgcctagaccttggtgaagcgg 133
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 748 agtaaccgagcaagcgccgacgagctagcacggacggacgcctagaccttggtgaagcgg 689

                                                                       
Query: 134 aggtagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttg 193
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 688 aggtagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttg 629

                                                                       
Query: 194 gcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccgggcttccagttggcc 253
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 628 gcctcctcgtcggagacgccgggcgcgatcacaacgcactcgccgggcttccagttggcc 569

                                                                       
Query: 254 ggggttgccaccttgtgctttgccgccgtcagcagcgagtccacggngcgcaccacctcg 313
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 568 ggggttgccaccttgtgctttgccgccgtcagcagcgagtccacggcgcgcaccacctcg 509

                                                                       
Query: 314 tccatgttccgccccgtgcacgacgggtacaggaagctcagcttcaccaccttgtccggc 373
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 508 tccatgttccgccccgtgcacgacgggtacaggaagctcagcttcaccaccttgtccggc 449

                                                                       
Query: 374 cccacgatgtgcagggtgcgggacggcagctgcccctgcgcgtccttctngtncgggtcc 433
           ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 448 cccacgatgtgcagggtgcgggacggcagctgcccctgcgcgtccttctcgtccgggtcc 389

                                                                       
Query: 434 accatgttgagctgcttgatcgccgaccggtccgggtccgccatgatcgggtacgtcacc 493
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 accatgttgagctgcttgatcgccgaccggtccgggtccgccatgatcgggtacgtcacc 329

                                
Query: 494 ttgctnccaggcttgtangcc 514
           ||||| ||||||||||| |||
Sbjct: 328 ttgctcccaggcttgtaggcc 308

---

>emb|X96551.1|HVPER1 H.vulgare Per1 gene
          Length = 1994

 Score =  946 bits (477), Expect = 0.0
 Identities = 488/493 (98%)
 Strand = Plus / Minus

                                                                        
Query: 14   aaacgacacatgctaccacaaaagtacgcacgcaccacaacgacacataccaccaccata 73
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1938 aaacgacacatgctaccacaaaagtacgcacgcaccacaacgacacataccaccaccata 1879

                                                                        
Query: 74   agtaaccgagcaagcgccgacgagctagcacggacggacgcctagaccttggtgaagcgg 133
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1878 agtaaccgagcaagcgccgacgagctagcacggacggacgcctagaccttggtgaagcgg 1819

                                                                        
Query: 134  aggtagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttg 193
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1818 aggtagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttg 1759

                                                                        
Query: 194  gcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccgggcttccagttggcc 253
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 1758 gcctcctcgtcggagacgccgggcgcgatcacaacgcactcgccgggcttccagttggcc 1699

                                                                        
Query: 254  ggggttgccaccttgtgctttgccgccgtcagcagcgagtccacggngcgcaccacctcg 313
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 1698 ggggttgccaccttgtgctttgccgccgtcagcagcgagtccacggcgcgcaccacctcg 1639

                                                                        
Query: 314  tccatgttccgccccgtgcacgacgggtacaggaagctcagcttcaccaccttgtccggc 373
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1638 tccatgttccgccccgtgcacgacgggtacaggaagctcagcttcaccaccttgtccggc 1579

                                                                        
Query: 374  cccacgatgtgcagggtgcgggacggcagctgcccctgcgcgtccttctngtncgggtcc 433
            ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 1578 cccacgatgtgcagggtgcgggacggcagctgcccctgcgcgtccttctcgtccgggtcc 1519

                                                                        
Query: 434  accatgttgagctgcttgatcgccgaccggtccgggtccgccatgatcgggtacgtcacc 493
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1518 accatgttgagctgcttgatcgccgaccggtccgggtccgccatgatcgggtacgtcacc 1459

                         
Query: 494  ttgctnccaggct 506
            ||||| |||||||
Sbjct: 1458 ttgctcccaggct 1446

---

>gb|AF327046.1|AF327046 Triticum turgidum subsp. durum 1-Cys peroxiredoxin (PER1) mRNA,
           complete cds
          Length = 827

 Score =  729 bits (368), Expect = 0.0
 Identities = 467/501 (93%), Gaps = 3/501 (0%)
 Strand = Plus / Minus

                                                                       
Query: 14  aaacgacacatgctaccacaaaagtacgcacgcaccacaacgacacataccaccaccata 73
           ||||||||| | | |||||||||||||||||| |||||||||||||| ||| |||| |  
Sbjct: 755 aaacgacacgtaccaccacaaaagtacgcacggaccacaacgacacagaccgccacga-- 698

                                                                       
Query: 74  agtaaccgagcaagcgccgacgagctagcacggacggacgcctagaccttggtgaagcgg 133
            ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 697 -gtaaccgagcaggcgccgacgagctagcacggacgcacgcctagaccttggtgaagcgg 639

                                                                       
Query: 134 aggtagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttg 193
           ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 638 aggtaccccttcttggagggcaggtcggcagtctcgaacccctgcgggaacatcttcttg 579

                                                                       
Query: 194 gcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccgggcttccagttggcc 253
           ||| | ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 578 gccccgtcgtcggagacgccgggcgcgatcaccacgcactccccgggattccagttggcc 519

                                                                       
Query: 254 ggggttgccaccttgtgctttgccgccgtcagcagcgagtccacggngcgcaccacctcg 313
           ||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||
Sbjct: 518 ggggtggccaccttgtgcttggccgccgtcagcagcgagtccacggcgcgcaccacctcg 459

                                                                       
Query: 314 tccatgttccgccccgtgcacgacgggtacaggaagctcagcttcaccaccttgtccggc 373
           ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||
Sbjct: 458 tccatgttccgccccgtgcacgacgggtacaggaagctcagcttcaccttcttgtccggc 399

                                                                       
Query: 374 cccacgatgtgcagggtgcgggacggcagctgcccctgcgcgtccttctngtncgggtcc 433
           ||||||||||||| ||||||||||||||||||||||| ||||||||||| ||  ||||| 
Sbjct: 398 cccacgatgtgcaaggtgcgggacggcagctgcccctccgcgtccttctcgtcggggtcg 339

                                                                       
Query: 434 accatgttgagctgcttgatcgccgaccggtccgggtccgccatgatcgggtacgtcacc 493
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 338 accatgttcagttgcttgatggccgaccggtccgggtccgccatgatcgggtacgtcacc 279

                                
Query: 494 ttgctnccaggcttgtangcc 514
           ||||| ||||||||||| |||
Sbjct: 278 ttgctcccaggcttgtaggcc 258

---

>gb|AY304482.1| Triticum aestivum cultivar Soissons 1-Cys-peroxiredoxine (PER1)
           mRNA, complete cds
          Length = 719

 Score =  680 bits (343), Expect = 0.0
 Identities = 407/430 (94%)
 Strand = Plus / Minus

                                                                       
Query: 85  aagcgccgacgagctagcacggacggacgcctagaccttggtgaagcggaggtagccctt 144
           |||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||
Sbjct: 719 aagcgcggacgagctagcacggacgcacgcctagaccttggtgaagcggaggtacccctt 660

                                                                       
Query: 145 cttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttggcctcctcgtc 204
           |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 659 cttggagggcaggtcggcagtctcgaacccctgcgggaacatcttcttggcctcgtcgtc 600

                                                                       
Query: 205 ggagacgccgggcgcgatcaccacgcactcgccgggcttccagttggccggggttgccac 264
           |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 599 ggagacgccgggcgcgatcaccacgcactccccgggattccagttggccggggtggccac 540

                                                                       
Query: 265 cttgtgctttgccgccgtcagcagcgagtccacggngcgcaccacctcgtccatgttccg 324
           ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 539 cttgtgcttggccgccgtcagcagcgagtccacggcgcgcaccacctcgtccatgttccg 480

                                                                       
Query: 325 ccccgtgcacgacgggtacaggaagctcagcttcaccaccttgtccggccccacgatgtg 384
           |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 479 ccccgtgcacgacgggtacaggaagctcagcttcaccttcttgtccggccccacgatgtg 420

                                                                       
Query: 385 cagggtgcgggacggcagctgcccctgcgcgtccttctngtncgggtccaccatgttgag 444
           || ||||||||||||||||||||||| ||||||||||| ||  ||||| |||||||| ||
Sbjct: 419 caaggtgcgggacggcagctgcccctccgcgtccttctcgtcggggtcgaccatgttcag 360

                                                                       
Query: 445 ctgcttgatcgccgaccggtccgggtccgccatgatcgggtacgtcaccttgctnccagg 504
            |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 359 ttgcttgatggccgaccggtccgggtccgccatgatcgggtacgtcaccttgctcccagg 300

                     
Query: 505 cttgtangcc 514
           |||||| |||
Sbjct: 299 cttgtaggcc 290

---

>emb|X63202.1|BSEMSP B.secalinas embryo-specific mRNA
          Length = 816

 Score =  613 bits (309), Expect = e-172
 Identities = 379/404 (93%)
 Strand = Plus / Minus

                                                                       
Query: 111 acgcctagaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcga 170
           |||||||||||||||||||||||||||| ||||||||||||||||||||   ||||||||
Sbjct: 614 acgcctagaccttggtgaagcggaggtatcccttcttggagggcaggtccttggtctcga 555

                                                                       
Query: 171 acccctgcgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgc 230
           ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 554 acccctgcgggaacaacttcttggcctcctcgtcggacacgcccggcgcgatcaccacgc 495

                                                                       
Query: 231 actcgccgggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcg 290
           |||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 494 actccccgggcttccagttggccggggtggccaccttgtgcttggccgccgtcagcagcg 435

                                                                       
Query: 291 agtccacggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagc 350
           ||||||| | |||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 434 agtccaccgcgcgcacaacctcgtccatgttcctccccgtgcacgacgggtacaggaagc 375

                                                                       
Query: 351 tcagcttcaccaccttgtccggccccacgatgtgcagggtgcgggacggcagctgcccct 410
           |||||||||||  |||||||||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 374 tcagcttcaccttcttgtccggccccacgatgtgcagcgtgcgcgacggcagctgcccct 315

                                                                       
Query: 411 gcgcgtccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggt 470
            ||||||||||| || ||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 314 ccgcgtccttctcgtccggatccaccatgttgagctgcttgatggccgaccggtccgggt 255

                                                       
Query: 471 ccgccatgatcgggtacgtcaccttgctnccaggcttgtangcc 514
           |||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 254 ccgccatgatcgggtacgtcaccttgctcccaggcttgtaggcc 211

---

>gb|BT016686.1| Zea mays clone Contig519 mRNA sequence
          Length = 1081

 Score =  339 bits (171), Expect = 5e-90
 Identities = 336/390 (86%), Gaps = 9/390 (2%)
 Strand = Plus / Minus

                                                                       
Query: 115 ctagaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaaccc 174
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 726 ctagaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaaccc 667

                                                                       
Query: 175 ctgcgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactc 234
           |||||||||||||||| |||||||||| |||||||||||||||||||| ||  |||||||
Sbjct: 666 ctgcgggaacatcttcctggcctcctcatcggagacgccgggcgcgatgacggcgcactc 607

                                                                       
Query: 235 gccgggcttccagttggccggggttgccacctt------gtgctttgccgccgtcagcag 288
            ||||||||||||||||| || || ||||||||      |||||| || || || |||||
Sbjct: 606 cccgggcttccagttggcgggcgtggccaccttcccgccgtgcttggcggcggtgagcag 547

                                                                       
Query: 289 cgagtccacggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaa 348
           |||||| |||| ||||| |||||||||||||||||||||||||   | ||||||||||||
Sbjct: 546 cgagtcgacggcgcgcagcacctcgtccatgttccgccccgtggtggccgggtacaggaa 487

                                                                       
Query: 349 gctcagcttcaccaccttgtccggccccacgatgtgcagggtgcgggacggca-gct--g 405
           ||||||||||||  ||||||| ||||| |||| ||| || | ||||||||||| |||  |
Sbjct: 486 gctcagcttcacggccttgtcgggcccgacgacgtggagcgcgcgggacggcatgctccg 427

                                                                       
Query: 406 cccctgcgcgtccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtc 465
           ||||  ||||||||||| ||  |||||||||||||| ||||||  ||| ||   |||  |
Sbjct: 426 ccccgccgcgtccttctcgtcggggtccaccatgttcagctgccggatggcgtcccgcgc 367

                                         
Query: 466 cgggtccgccatgatcgggtacgtcacctt 495
           ||||||||| | ||||||| ||||||||||
Sbjct: 366 cgggtccgcgaggatcgggaacgtcacctt 337

---

>ref|XM_479271.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 999

 Score =  252 bits (127), Expect = 1e-63
 Identities = 243/282 (86%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
           |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 753 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 694

                                                                       
Query: 178 cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
            |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |||| ||||||
Sbjct: 693 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgacgcgctcgcc 634

                                                                       
Query: 238 gggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccac 297
           ||||||||||||  |||| || ||||||  |||||| ||||||||| |||||| ||| ||
Sbjct: 633 gggcttccagttcaccggcgtcgccaccgcgtgcttcgccgccgtctgcagcgcgtcgac 574

                                                                       
Query: 298 ggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagctt 357
            |  ||||||||||| |||||||||||||||  ||||| |||||||||||||||||||||
Sbjct: 573 cgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagctt 514

                                                     
Query: 358 caccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
           ||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 513 caccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 472



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
           ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 452 tccttctcgtccgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 393

                            
Query: 476 atgatcgggtacgtcac 492
           |||||||||||||||||
Sbjct: 392 atgatcgggtacgtcac 376

---

>ref|XM_506500.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1340_C08.107
           mRNA
          Length = 1094

 Score =  252 bits (127), Expect = 1e-63
 Identities = 243/282 (86%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
           |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 754 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 695

                                                                       
Query: 178 cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
            |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |||| ||||||
Sbjct: 694 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgacgcgctcgcc 635

                                                                       
Query: 238 gggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccac 297
           ||||||||||||  |||| || ||||||  |||||| ||||||||| |||||| ||| ||
Sbjct: 634 gggcttccagttcaccggcgtcgccaccgcgtgcttcgccgccgtctgcagcgcgtcgac 575

                                                                       
Query: 298 ggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagctt 357
            |  ||||||||||| |||||||||||||||  ||||| |||||||||||||||||||||
Sbjct: 574 cgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagctt 515

                                                     
Query: 358 caccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
           ||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 514 caccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 473



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
           ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 453 tccttctcgtccgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 394

                            
Query: 476 atgatcgggtacgtcac 492
           |||||||||||||||||
Sbjct: 393 atgatcgggtacgtcac 377

---

>gb|AY336994.1| Oryza sativa (japonica cultivar-group) peroxiredoxin mRNA, complete
           cds
          Length = 1002

 Score =  252 bits (127), Expect = 1e-63
 Identities = 243/282 (86%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
           |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 765 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 706

                                                                       
Query: 178 cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
            |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |||| ||||||
Sbjct: 705 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgacgcgctcgcc 646

                                                                       
Query: 238 gggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccac 297
           ||||||||||||  |||| || ||||||  |||||| ||||||||| |||||| ||| ||
Sbjct: 645 gggcttccagttcaccggcgtcgccaccgcgtgcttcgccgccgtctgcagcgcgtcgac 586

                                                                       
Query: 298 ggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagctt 357
            |  ||||||||||| |||||||||||||||  ||||| |||||||||||||||||||||
Sbjct: 585 cgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagctt 526

                                                     
Query: 358 caccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
           ||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 525 caccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 484



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
           ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 464 tccttctcgtccgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 405

                            
Query: 476 atgatcgggtacgtcac 492
           |||||||||||||||||
Sbjct: 404 atgatcgggtacgtcac 388

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  252 bits (127), Expect = 1e-63
 Identities = 243/282 (86%)
 Strand = Plus / Minus

                                                                            
Query: 118      gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
                |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 26496218 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 26496159

                                                                            
Query: 178      cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
                 |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |||| ||||||
Sbjct: 26496158 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgacgcgctcgcc 26496099

                                                                            
Query: 238      gggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccac 297
                ||||||||||||  |||| || ||||||  |||||| ||||||||| |||||| ||| ||
Sbjct: 26496098 gggcttccagttcaccggcgtcgccaccgcgtgcttcgccgccgtctgcagcgcgtcgac 26496039

                                                                            
Query: 298      ggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagctt 357
                 |  ||||||||||| |||||||||||||||  ||||| |||||||||||||||||||||
Sbjct: 26496038 cgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagctt 26495979

                                                          
Query: 358      caccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
                ||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 26495978 caccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 26495937



 Score =  236 bits (119), Expect = 6e-59
 Identities = 229/266 (86%)
 Strand = Plus / Minus

                                                                            
Query: 119      accttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctgc 178
                |||| ||||||||||||||||| ||| ||||||||||| | |||||||||||||||   |
Sbjct: 26499073 acctgggtgaagcggaggtagcacttgttggagggcagctgggcggtctcgaacccggcc 26499014

                                                                            
Query: 179      gggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccg 238
                |||||| ||  ||||||||||||||||||||||||||| | ||| || |||| |||||||
Sbjct: 26499013 gggaacctcgccttggcctcctcgtcggagacgccgggggggatgacgacgcgctcgccg 26498954

                                                                            
Query: 239      ggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccacg 298
                |||||||||||  |||| || ||||||  |||| | |||||||||||||||| ||||   
Sbjct: 26498953 ggcttccagttcaccggcgtcgccacccggtgcctcgccgccgtcagcagcgcgtccgtc 26498894

                                                                            
Query: 299      gngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttc 358
                | ||||| ||||||  ||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 26498893 gcgcgcagcacctccgccatgttccgccccgtgcacgccgggaacaggaagctcagcttc 26498834

                                          
Query: 359      accaccttgtccggccccacgatgtg 384
                |||  |||||||||||| ||||||||
Sbjct: 26498833 accttcttgtccggcccgacgatgtg 26498808



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                            
Query: 416      tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
                ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 26495917 tccttctcgtccgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 26495858

                                 
Query: 476      atgatcgggtacgtcac 492
                |||||||||||||||||
Sbjct: 26495857 atgatcgggtacgtcac 26495841



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                                 
Query: 436      catgttgagctgcttgatcgccgaccggtccgggtccgccatgatcggg 484
                ||||||||||||| ||||||||  || ||||||||| || | |||||||
Sbjct: 26498753 catgttgagctgcctgatcgcctccctgtccgggtcggcgacgatcggg 26498705

---

>dbj|AP005292.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1340_C08
          Length = 192167

 Score =  252 bits (127), Expect = 1e-63
 Identities = 243/282 (86%)
 Strand = Plus / Minus

                                                                         
Query: 118   gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
             |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 41489 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 41430

                                                                         
Query: 178   cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
              |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |||| ||||||
Sbjct: 41429 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgacgcgctcgcc 41370

                                                                         
Query: 238   gggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccac 297
             ||||||||||||  |||| || ||||||  |||||| ||||||||| |||||| ||| ||
Sbjct: 41369 gggcttccagttcaccggcgtcgccaccgcgtgcttcgccgccgtctgcagcgcgtcgac 41310

                                                                         
Query: 298   ggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagctt 357
              |  ||||||||||| |||||||||||||||  ||||| |||||||||||||||||||||
Sbjct: 41309 cgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagctt 41250

                                                       
Query: 358   caccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
             ||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 41249 caccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 41208



 Score =  236 bits (119), Expect = 6e-59
 Identities = 229/266 (86%)
 Strand = Plus / Minus

                                                                         
Query: 119   accttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctgc 178
             |||| ||||||||||||||||| ||| ||||||||||| | |||||||||||||||   |
Sbjct: 44344 acctgggtgaagcggaggtagcacttgttggagggcagctgggcggtctcgaacccggcc 44285

                                                                         
Query: 179   gggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccg 238
             |||||| ||  ||||||||||||||||||||||||||| | ||| || |||| |||||||
Sbjct: 44284 gggaacctcgccttggcctcctcgtcggagacgccgggggggatgacgacgcgctcgccg 44225

                                                                         
Query: 239   ggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccacg 298
             |||||||||||  |||| || ||||||  |||| | |||||||||||||||| ||||   
Sbjct: 44224 ggcttccagttcaccggcgtcgccacccggtgcctcgccgccgtcagcagcgcgtccgtc 44165

                                                                         
Query: 299   gngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttc 358
             | ||||| ||||||  ||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 44164 gcgcgcagcacctccgccatgttccgccccgtgcacgccgggaacaggaagctcagcttc 44105

                                       
Query: 359   accaccttgtccggccccacgatgtg 384
             |||  |||||||||||| ||||||||
Sbjct: 44104 accttcttgtccggcccgacgatgtg 44079



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 416   tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
             ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 41188 tccttctcgtccgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 41129

                              
Query: 476   atgatcgggtacgtcac 492
             |||||||||||||||||
Sbjct: 41128 atgatcgggtacgtcac 41112



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 436   catgttgagctgcttgatcgccgaccggtccgggtccgccatgatcggg 484
             ||||||||||||| ||||||||  || ||||||||| || | |||||||
Sbjct: 44024 catgttgagctgcctgatcgcctccctgtccgggtcggcgacgatcggg 43976

---

>dbj|AK102982.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033115O22, full
           insert sequence
          Length = 1092

 Score =  252 bits (127), Expect = 1e-63
 Identities = 243/282 (86%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
           |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 753 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 694

                                                                       
Query: 178 cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
            |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |||| ||||||
Sbjct: 693 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgacgcgctcgcc 634

                                                                       
Query: 238 gggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccac 297
           ||||||||||||  |||| || ||||||  |||||| ||||||||| |||||| ||| ||
Sbjct: 633 gggcttccagttcaccggcgtcgccaccgcgtgcttcgccgccgtctgcagcgcgtcgac 574

                                                                       
Query: 298 ggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagctt 357
            |  ||||||||||| |||||||||||||||  ||||| |||||||||||||||||||||
Sbjct: 573 cgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagctt 514

                                                     
Query: 358 caccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
           ||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 513 caccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 472



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
           ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 452 tccttctcgttcgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 393

                            
Query: 476 atgatcgggtacgtcac 492
           |||||||||||||||||
Sbjct: 392 atgatcgggtacgtcac 376

---

>dbj|AK101401.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037F14, full
           insert sequence
          Length = 999

 Score =  252 bits (127), Expect = 1e-63
 Identities = 243/282 (86%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
           |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 753 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 694

                                                                       
Query: 178 cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
            |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |||| ||||||
Sbjct: 693 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgacgcgctcgcc 634

                                                                       
Query: 238 gggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccac 297
           ||||||||||||  |||| || ||||||  |||||| ||||||||| |||||| ||| ||
Sbjct: 633 gggcttccagttcaccggcgtcgccaccgcgtgcttcgccgccgtctgcagcgcgtcgac 574

                                                                       
Query: 298 ggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagctt 357
            |  ||||||||||| |||||||||||||||  ||||| |||||||||||||||||||||
Sbjct: 573 cgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagctt 514

                                                     
Query: 358 caccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
           ||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 513 caccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 472



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
           ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 452 tccttctcgtccgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 393

                            
Query: 476 atgatcgggtacgtcac 492
           |||||||||||||||||
Sbjct: 392 atgatcgggtacgtcac 376

---

>ref|XM_479272.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1047

 Score =  236 bits (119), Expect = 6e-59
 Identities = 229/266 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 accttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctgc 178
           |||| ||||||||||||||||| ||| ||||||||||| | |||||||||||||||   |
Sbjct: 761 acctgggtgaagcggaggtagcacttgttggagggcagctgggcggtctcgaacccggcc 702

                                                                       
Query: 179 gggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccg 238
           |||||| ||  ||||||||||||||||||||||||||| | ||| || |||| |||||||
Sbjct: 701 gggaacctcgccttggcctcctcgtcggagacgccgggggggatgacgacgcgctcgccg 642

                                                                       
Query: 239 ggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccacg 298
           |||||||||||  |||| || ||||||  |||| | |||||||||||||||| ||||   
Sbjct: 641 ggcttccagttcaccggcgtcgccacccggtgcctcgccgccgtcagcagcgcgtccgtc 582

                                                                       
Query: 299 gngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttc 358
           | ||||| ||||||  ||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 581 gcgcgcagcacctccgccatgttccgccccgtgcacgccgggaacaggaagctcagcttc 522

                                     
Query: 359 accaccttgtccggccccacgatgtg 384
           |||  |||||||||||| ||||||||
Sbjct: 521 accttcttgtccggcccgacgatgtg 496



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 436 catgttgagctgcttgatcgccgaccggtccgggtccgccatgatcggg 484
           ||||||||||||| ||||||||  || ||||||||| || | |||||||
Sbjct: 441 catgttgagctgcctgatcgcctccctgtccgggtcggcgacgatcggg 393

---

>ref|XM_506501.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1340_C08.108
           mRNA
          Length = 1088

 Score =  236 bits (119), Expect = 6e-59
 Identities = 229/266 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 accttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctgc 178
           |||| ||||||||||||||||| ||| ||||||||||| | |||||||||||||||   |
Sbjct: 763 acctgggtgaagcggaggtagcacttgttggagggcagctgggcggtctcgaacccggcc 704

                                                                       
Query: 179 gggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccg 238
           |||||| ||  ||||||||||||||||||||||||||| | ||| || |||| |||||||
Sbjct: 703 gggaacctcgccttggcctcctcgtcggagacgccgggggggatgacgacgcgctcgccg 644

                                                                       
Query: 239 ggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccacg 298
           |||||||||||  |||| || ||||||  |||| | |||||||||||||||| ||||   
Sbjct: 643 ggcttccagttcaccggcgtcgccacccggtgcctcgccgccgtcagcagcgcgtccgtc 584

                                                                       
Query: 299 gngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttc 358
           | ||||| ||||||  ||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 583 gcgcgcagcacctccgccatgttccgccccgtgcacgccgggaacaggaagctcagcttc 524

                                     
Query: 359 accaccttgtccggccccacgatgtg 384
           |||  |||||||||||| ||||||||
Sbjct: 523 accttcttgtccggcccgacgatgtg 498



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 436 catgttgagctgcttgatcgccgaccggtccgggtccgccatgatcggg 484
           ||||||||||||| ||||||||  || ||||||||| || | |||||||
Sbjct: 443 catgttgagctgcctgatcgcctccctgtccgggtcggcgacgatcggg 395

---

>dbj|AK104089.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-D12, full
           insert sequence
          Length = 1047

 Score =  236 bits (119), Expect = 6e-59
 Identities = 229/266 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 accttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctgc 178
           |||| ||||||||||||||||| ||| ||||||||||| | |||||||||||||||   |
Sbjct: 761 acctgggtgaagcggaggtagcacttgttggagggcagctgggcggtctcgaacccggcc 702

                                                                       
Query: 179 gggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccg 238
           |||||| ||  ||||||||||||||||||||||||||| | ||| || |||| |||||||
Sbjct: 701 gggaacctcgccttggcctcctcgtcggagacgccgggggggatgacgacgcgctcgccg 642

                                                                       
Query: 239 ggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccacg 298
           |||||||||||  |||| || ||||||  |||| | |||||||||||||||| ||||   
Sbjct: 641 ggcttccagttcaccggcgtcgccacccggtgcctcgccgccgtcagcagcgcgtccgtc 582

                                                                       
Query: 299 gngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttc 358
           | ||||| ||||||  ||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 581 gcgcgcagcacctccgccatgttccgccccgtgcacgccgggaacaggaagctcagcttc 522

                                     
Query: 359 accaccttgtccggccccacgatgtg 384
           |||  |||||||||||| ||||||||
Sbjct: 521 accttcttgtccggcccgacgatgtg 496



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 436 catgttgagctgcttgatcgccgaccggtccgggtccgccatgatcggg 484
           ||||||||||||| ||||||||  || ||||||||| || | |||||||
Sbjct: 441 catgttgagctgcctgatcgcctccctgtccgggtcggcgacgatcggg 393

---

>dbj|AK073273.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028A12, full
           insert sequence
          Length = 1087

 Score =  230 bits (116), Expect = 4e-57
 Identities = 226/263 (85%)
 Strand = Plus / Minus

                                                                       
Query: 119 accttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctgc 178
           |||| ||||||||||||||||| ||| ||||||||||| | |||||||||||||||   |
Sbjct: 762 acctgggtgaagcggaggtagcacttgttggagggcagctgggcggtctcgaacccggcc 703

                                                                       
Query: 179 gggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgccg 238
           |||||| ||  ||||||||||||||||||||||||||| | ||| || |||| |||||||
Sbjct: 702 gggaacctcgccttggcctcctcgtcggagacgccgggggggatgacgacgcgctcgccg 643

                                                                       
Query: 239 ggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccacg 298
           |||||||||||  |||| || ||||||  |||| | |||||||||||||||| ||||   
Sbjct: 642 ggcttccagttcaccggcgtcgccacccggtgcctcgccgccgtcagcagcgcgtccgtc 583

                                                                       
Query: 299 gngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttc 358
           | ||||| ||||||  ||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 582 gcgcgcagcacctccgccatgttccgccccgtgcacgccgggaacaggaagctcagcttc 523

                                  
Query: 359 accaccttgtccggccccacgat 381
           |||  |||||||||||| |||||
Sbjct: 522 accttcttgtccggcccgacgat 500



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 436 catgttgagctgcttgatcgccgaccggtccgggtccgccatgatcggg 484
           ||||||||||||| ||||||||  || ||||||||| || | |||||||
Sbjct: 442 catgttgagctgcctgatcgcctccctgtccgggtcggcgacgatcggg 394

---

>dbj|D63917.1|RICRAB24P Rice mRNA for RAB24 protein, complete cds
          Length = 985

 Score =  198 bits (100), Expect = 1e-47
 Identities = 239/283 (84%), Gaps = 2/283 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 gaccttggtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctg 177
           |||||||||||||||||||||||||||   ||| |||||||||||||| |||||||||||
Sbjct: 739 gaccttggtgaagcggaggtagcccttgccggacggcaggtcggcggtgtcgaacccctg 680

                                                                       
Query: 178 cgggaacatcttcttggcctcctcgtcggagacgccgggcgcgatcaccacgcactcgcc 237
            |||||| ||| ||| ||||| ||||||||||||||||| | ||| || |    ||||||
Sbjct: 679 ggggaacttctccttcgcctcgtcgtcggagacgccgggagggatgacgaacggctcgcc 620

                                                                       
Query: 238 gggcttccagttggccggggttgcc-accttgtgctttgccgccgtcagcagcgagtcca 296
           ||||||||||||  |||| || ||| |||  || ||| ||||||||| |||||| ||| |
Sbjct: 619 gggcttccagttcaccggcgtcgccaaccgcgt-cttcgccgccgtctgcagcgcgtcga 561

                                                                       
Query: 297 cggngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagct 356
           | |  ||||||||||| |||||||||||||||  ||||| ||||||||||||||||||||
Sbjct: 560 ccgcacgcaccacctcatccatgttccgccccacgcacgccgggtacaggaagctcagct 501

                                                      
Query: 357 tcaccaccttgtccggccccacgatgtgcagggtgcgggacgg 399
           |||||  |||||| || || ||||||||||| | |||||||||
Sbjct: 500 tcaccttcttgtcggggccgacgatgtgcagcgcgcgggacgg 458



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 tccttctngtncgggtccaccatgttgagctgcttgatcgccgaccggtccgggtccgcc 475
           ||||||| || |||||| |||||||| ||||||||||| |||   |||  ||| || |||
Sbjct: 438 tccttctcgtccgggtcgaccatgttcagctgcttgatggcctcgcggctcggatcggcc 379

                            
Query: 476 atgatcgggtacgtcac 492
           |||||||||||||||||
Sbjct: 378 atgatcgggtacgtcac 362

---

>gb|AF484696.1| Xerophyta viscosa 1-cys peroxiredoxin (Per1) mRNA, complete cds
          Length = 849

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 ggcttccagttggccggggttgccaccttgtgctttgccgccgtcagcagcgagtccacg 298
           ||||||||||| ||||| ||||||||||||||||||||||||  | | ||||| ||||| 
Sbjct: 536 ggcttccagttcgccggcgttgccaccttgtgctttgccgcctgctggagcgactccact 477

                                                                       
Query: 299 gngcgcaccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttc 358
           |  | || |||||| |||||||| ||||||||  |||  ||||||||||| |||||||| 
Sbjct: 476 gccctcagcacctcatccatgtttcgccccgtcgacgcggggtacaggaaactcagcttg 417

                                        
Query: 359 accaccttgtccggccccacgatgtgcag 387
           | |  |||||| ||||| | |||||||||
Sbjct: 416 atcctcttgtcgggcccaatgatgtgcag 388

---

>gb|AF191099.1|AF191099 Fagopyrum esculentum 1-Cys peroxiredoxin (Per1) mRNA, complete cds
          Length = 858

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 125 gtgaagcggaggtagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaac 184
           ||||| ||||| || |||||||||||||| |||||| |||||  | | || || ||||||
Sbjct: 693 gtgaaacggagatatcccttcttggaggggaggtcgacggtccggtagccatgagggaac 634

                               
Query: 185 atcttcttggcctcctcgtc 204
           || |||||||||||||||||
Sbjct: 633 attttcttggcctcctcgtc 614



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 304 caccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctcagcttcaccac 363
           ||||||||| |||||||||| ||||||    | |||||||||||| ||||||||||||  
Sbjct: 514 caccacctcctccatgttcctccccgtcgttgccgggtacaggaaactcagcttcacctt 455

                                
Query: 364 cttgtccggccccacgatgtg 384
           |||||| || ||||| |||||
Sbjct: 454 cttgtcgggacccacaatgtg 434

---

>ref|NM_103709.3| Arabidopsis thaliana ATPER1; antioxidant AT1G48130 (ATPER1) mRNA,
           complete cds
          Length = 986

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 137 tagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttggcc 196
           ||||| ||||| || || || |||||||||| ||| ||||| ||||||||||| ||||| 
Sbjct: 734 tagcctttctttgacggaagatcggcggtcttgaaaccctgtgggaacatctttttggct 675

                   
Query: 197 tcctcgtc 204
           ||||||||
Sbjct: 674 tcctcgtc 667

---

>gb|BT014873.1| Arabidopsis thaliana At1g48130 gene, complete cds
          Length = 651

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 137 tagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttggcc 196
           ||||| ||||| || || || |||||||||| ||| ||||| ||||||||||| ||||| 
Sbjct: 626 tagcctttctttgacggaagatcggcggtcttgaaaccctgtgggaacatctttttggct 567

                   
Query: 197 tcctcgtc 204
           ||||||||
Sbjct: 566 tcctcgtc 559

---

>emb|Y12089.1|AT12089 A.thaliana Per1 gene
          Length = 2135

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 137  tagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttggcc 196
            ||||| ||||| || || || |||||||||| ||| ||||| ||||||||||| ||||| 
Sbjct: 1888 tagcctttctttgacggaagatcggcggtcttgaaaccctgtgggaacatctttttggct 1829

                    
Query: 197  tcctcgtc 204
            ||||||||
Sbjct: 1828 tcctcgtc 1821

---

>emb|BX817653.1|CNS0AAWD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL35ZE01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 915

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 137 tagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttggcc 196
           ||||| ||||| || || || |||||||||| ||| ||||| ||||||||||| ||||| 
Sbjct: 663 tagcctttctttgacggaagatcggcggtcttgaaaccctgtgggaacatctttttggct 604

                   
Query: 197 tcctcgtc 204
           ||||||||
Sbjct: 603 tcctcgtc 596

---

>gb|BT003916.1| Arabidopsis thaliana clone RAFL15-09-L01 (R20672) putative
           peroxiredoxin (At1g48130) mRNA, complete cds
          Length = 973

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 137 tagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttggcc 196
           ||||| ||||| || || || |||||||||| ||| ||||| ||||||||||| ||||| 
Sbjct: 734 tagcctttctttgacggaagatcggcggtcttgaaaccctgtgggaacatctttttggct 675

                   
Query: 197 tcctcgtc 204
           ||||||||
Sbjct: 674 tcctcgtc 667

---

>gb|AC023673.3|AC023673 Genomic sequence for Arabidopsis thaliana BAC F21D18 from chromosome I,
             complete sequence
          Length = 109367

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                         
Query: 137   tagcccttcttggagggcaggtcggcggtctcgaacccctgcgggaacatcttcttggcc 196
             ||||| ||||| || || || |||||||||| ||| ||||| ||||||||||| ||||| 
Sbjct: 39985 tagcctttctttgacggaagatcggcggtcttgaaaccctgtgggaacatctttttggct 40044

                     
Query: 197   tcctcgtc 204
             ||||||||
Sbjct: 40045 tcctcgtc 40052

---

>emb|BX818549.1|CNS0ABAN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL85ZA12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 740

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 159 cggcggtctcgaacccctgcgggaacatcttcttggcctcctcgtc 204
           ||||||||| ||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 594 cggcggtcttgaaaccctgtgggaacatctttttggcttcctcgtc 549

---

>ref|NM_184127.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1690

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  gcgcaccacctcgtccatgttc 322
            ||||||||||||||||||||||
Sbjct: 1025 gcgcaccacctcgtccatgttc 1004

---

>gb|AY679591.1| Fragaria x ananassa 1-Cys peroxiredoxin mRNA, partial cds
          Length = 266

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 304 caccacctcgtccatgttccgccccgtgcacgacgggtacaggaagctca 353
           ||||||||| ||||||||||| || |||  |||||| ||||| |||||||
Sbjct: 57  caccacctcatccatgttccggccagtggtcgacggatacagaaagctca 8



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 173 ccctgcgggaacatcttcttggcctcctc 201
           ||||| ||||||||||||| |||||||||
Sbjct: 188 ccctgagggaacatcttctgggcctcctc 160

---

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 244     ccagttggccggggttgccaccttgt 269
               ||||||||||||||| ||||||||||
Sbjct: 6080298 ccagttggccggggtggccaccttgt 6080323

---

>emb|BX053384.1|CNS09DCS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 287 gccgggcttccagttggccggg 308

---

>emb|BX053383.1|CNS09DCR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 727 gccgggcttccagttggccggg 706

---

>emb|BX070810.1|CNS09QSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 578 gccgggcttccagttggccggg 557

---

>emb|BX069290.1|CNS09PMM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 400 gccgggcttccagttggccggg 421

---

>emb|BX069289.1|CNS09PML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 736 gccgggcttccagttggccggg 715

---

>emb|BX068000.1|CNS09OMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 382 gccgggcttccagttggccggg 403

---

>emb|BX067999.1|CNS09OMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 722 gccgggcttccagttggccggg 701

---

>emb|BX067924.1|CNS09OKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 359 gccgggcttccagttggccggg 380

---

>emb|BX067923.1|CNS09OKN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 711 gccgggcttccagttggccggg 690

---

>emb|BX067642.1|CNS09OCU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 378 gccgggcttccagttggccggg 399

---

>emb|BX067641.1|CNS09OCT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 714 gccgggcttccagttggccggg 693

---

>emb|BX067553.1|CNS09OAD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 309 gccgggcttccagttggccggg 330

---

>emb|BX067552.1|CNS09OAC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 709 gccgggcttccagttggccggg 688

---

>emb|BX066871.1|CNS09NRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 364 gccgggcttccagttggccggg 385

---

>emb|BX066870.1|CNS09NRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 722 gccgggcttccagttggccggg 701

---

>emb|BX066317.1|CNS09NC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 733 gccgggcttccagttggccggg 712

---

>emb|BX066088.1|CNS09N5O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 664

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 180 gccgggcttccagttggccggg 201

---

>emb|BX066087.1|CNS09N5N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 716 gccgggcttccagttggccggg 695

---

>emb|BX064916.1|CNS09M94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 353 gccgggcttccagttggccggg 374

---

>emb|BX064915.1|CNS09M93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 525 gccgggcttccagttggccggg 504

---

>emb|BX064537.1|CNS09LYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 389 gccgggcttccagttggccggg 410

---

>emb|BX064536.1|CNS09LYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 729 gccgggcttccagttggccggg 708

---

>emb|BX064227.1|CNS09LPZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 364 gccgggcttccagttggccggg 385

---

>emb|BX063236.1|CNS09KYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 602

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 360 gccgggcttccagttggccggg 381

---

>emb|BX063235.1|CNS09KYF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 532 gccgggcttccagttggccggg 511

---

>emb|BX063000.1|CNS09KRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 358 gccgggcttccagttggccggg 379

---

>emb|BX062999.1|CNS09KRV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 713 gccgggcttccagttggccggg 692

---

>emb|BX062727.1|CNS09KKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 451

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 367 gccgggcttccagttggccggg 388

---

>emb|BX062083.1|CNS09K2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 367 gccgggcttccagttggccggg 388

---

>emb|BX062082.1|CNS09K2E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 707 gccgggcttccagttggccggg 686

---

>emb|BX061501.1|CNS09JM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 361 gccgggcttccagttggccggg 382

---

>emb|BX061473.1|CNS09JLH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 368 gccgggcttccagttggccggg 389

---

>emb|BX060364.1|CNS09IQO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 385 gccgggcttccagttggccggg 406

---

>emb|BX060363.1|CNS09IQN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 729 gccgggcttccagttggccggg 708

---

>emb|BX059169.1|CNS09HTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 362 gccgggcttccagttggccggg 383

---

>emb|BX059168.1|CNS09HTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 721 gccgggcttccagttggccggg 700

---

>emb|BX057376.1|CNS09GFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 383 gccgggcttccagttggccggg 404

---

>emb|BX057375.1|CNS09GFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 711 gccgggcttccagttggccggg 690

---

>emb|BX056369.1|CNS09FNP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 738 gccgggcttccagttggccggg 717

---

>emb|BX056328.1|CNS09FMK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 617

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 146 gccgggcttccagttggccggg 167

---

>emb|BX056327.1|CNS09FMJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 570 gccgggcttccagttggccggg 549

---

>emb|BX055202.1|CNS09ERA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 355 gccgggcttccagttggccggg 376

---

>emb|BX055201.1|CNS09ER9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 528 gccgggcttccagttggccggg 507

---

>emb|BX051413.1|CNS09BU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 370 gccgggcttccagttggccggg 391

---

>emb|BX051412.1|CNS09BU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 714 gccgggcttccagttggccggg 693

---

>emb|BX048982.1|CNS099YI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 726

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 696 gccgggcttccagttggccggg 675

---

>emb|BX048360.1|CNS099H8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 401 gccgggcttccagttggccggg 422

---

>emb|BX044318.1|CNS096CY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC17DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 360 gccgggcttccagttggccggg 381

---

>emb|BX044317.1|CNS096CX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 599 gccgggcttccagttggccggg 578

---

>emb|BX042869.1|CNS0958P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 404 gccgggcttccagttggccggg 425

---

>emb|BX042868.1|CNS0958O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 724 gccgggcttccagttggccggg 703

---

>emb|BX041612.1|CNS0949S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 262

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 184 gccgggcttccagttggccggg 205

---

>emb|BX041611.1|CNS0949R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 707 gccgggcttccagttggccggg 686

---

>emb|BX041334.1|CNS09422 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 267 gccgggcttccagttggccggg 288

---

>emb|BX041333.1|CNS09421 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 619 gccgggcttccagttggccggg 598

---

>emb|BX041214.1|CNS093YQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 384 gccgggcttccagttggccggg 405

---

>emb|BX041213.1|CNS093YP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 712 gccgggcttccagttggccggg 691

---

>emb|BX041188.1|CNS093Y0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 498

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 365 gccgggcttccagttggccggg 386

---

>emb|BX041187.1|CNS093XZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 721 gccgggcttccagttggccggg 700

---

>emb|BX039275.1|CNS092GV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC1AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 334 gccgggcttccagttggccggg 355

---

>emb|BX039274.1|CNS092GU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 749 gccgggcttccagttggccggg 728

---

>emb|BX037468.1|CNS0912O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 375 gccgggcttccagttggccggg 396

---

>emb|BX037467.1|CNS0912N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 722 gccgggcttccagttggccggg 701

---

>emb|BX036510.1|CNS090C2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 721 gccgggcttccagttggccggg 700

---

>emb|BX035990.1|CNS08ZXM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 716 gccgggcttccagttggccggg 695

---

>emb|BX034262.1|CNS08YLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 706 gccgggcttccagttggccggg 685

---

>emb|BX031811.1|CNS08WPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 370 gccgggcttccagttggccggg 391

---

>emb|BX031810.1|CNS08WPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 710 gccgggcttccagttggccggg 689

---

>emb|BX031320.1|CNS08WBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 792

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 372 gccgggcttccagttggccggg 393

---

>emb|BX031319.1|CNS08WBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 722 gccgggcttccagttggccggg 701

---

>emb|BX031133.1|CNS08W6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 371 gccgggcttccagttggccggg 392

---

>emb|BX031132.1|CNS08W6O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 714 gccgggcttccagttggccggg 693

---

>emb|BX028834.1|CNS08UEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 369 gccgggcttccagttggccggg 390

---

>emb|BX028833.1|CNS08UET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 701 gccgggcttccagttggccggg 680

---

>emb|BX027737.1|CNS08TKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 629

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 447 gccgggcttccagttggccggg 426

---

>emb|BX025425.1|CNS08RS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 370 gccgggcttccagttggccggg 391

---

>emb|BX025424.1|CNS08RS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 706 gccgggcttccagttggccggg 685

---

>emb|BX025171.1|CNS08RL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 184 gccgggcttccagttggccggg 205

---

>emb|BX025170.1|CNS08RL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 711 gccgggcttccagttggccggg 690

---

>emb|BX023597.1|CNS08QDD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 442

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 385 gccgggcttccagttggccggg 406

---

>emb|BX023566.1|CNS08QCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 723 gccgggcttccagttggccggg 702

---

>emb|BX021889.1|CNS08P1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 352 gccgggcttccagttggccggg 373

---

>emb|BX021888.1|CNS08P1W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 710 gccgggcttccagttggccggg 689

---

>emb|BX020060.1|CNS08NN4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 376 gccgggcttccagttggccggg 397

---

>emb|BX020059.1|CNS08NN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 709 gccgggcttccagttggccggg 688

---

>emb|BX019879.1|CNS08NI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 385 gccgggcttccagttggccggg 406

---

>emb|BX019878.1|CNS08NI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 629 gccgggcttccagttggccggg 608

---

>emb|BX016635.1|CNS08KZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 391 gccgggcttccagttggccggg 412

---

>emb|BX016634.1|CNS08KZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 731 gccgggcttccagttggccggg 710

---

>emb|BX015941.1|CNS08KGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 399 gccgggcttccagttggccggg 378

---

>emb|BX014548.1|CNS08JE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 377 gccgggcttccagttggccggg 398

---

>emb|BX014547.1|CNS08JDZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 727 gccgggcttccagttggccggg 706

---

>emb|BX013680.1|CNS08IPW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 362 gccgggcttccagttggccggg 383

---

>emb|BX013679.1|CNS08IPV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 711 gccgggcttccagttggccggg 690

---

>emb|BX012100.1|CNS08HI0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 734

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 710 gccgggcttccagttggccggg 689

---

>emb|BX012009.1|CNS08HFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 706 gccgggcttccagttggccggg 685

---

>emb|BX011355.1|CNS08GXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 368 gccgggcttccagttggccggg 389

---

>emb|BX011354.1|CNS08GXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 733 gccgggcttccagttggccggg 712

---

>emb|BX009675.1|CNS08FMN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 495

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 378 gccgggcttccagttggccggg 399

---

>emb|BX009674.1|CNS08FMM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 720 gccgggcttccagttggccggg 699

---

>emb|BX009416.1|CNS08FFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 722 gccgggcttccagttggccggg 701

---

>emb|BX005616.1|CNS08CHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 374 gccgggcttccagttggccggg 395

---

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 244     ccagttggccggggttgccaccttgt 269
               ||||||||||||||| ||||||||||
Sbjct: 6750432 ccagttggccggggtggccaccttgt 6750457

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 301     gcgcaccacctcgtccatgttc 322
               ||||||||||||||||||||||
Sbjct: 1078230 gcgcaccacctcgtccatgttc 1078251

---

>dbj|AP002541.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0494A10
          Length = 145576

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 301    gcgcaccacctcgtccatgttc 322
              ||||||||||||||||||||||
Sbjct: 115898 gcgcaccacctcgtccatgttc 115919

---

>dbj|AP002868.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0698A04
          Length = 141079

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 301   gcgcaccacctcgtccatgttc 322
             ||||||||||||||||||||||
Sbjct: 47544 gcgcaccacctcgtccatgttc 47565

---

>ref|XM_308081.2| Anopheles gambiae str. PEST ENSANGP00000019782
           (ENSANGG00000017293), mRNA
          Length = 1128

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 235 gccgggcttccagttggccggg 256
           ||||||||||||||||||||||
Sbjct: 744 gccgggcttccagttggccggg 723

---

>dbj|AK105948.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-C08, full
            insert sequence
          Length = 1791

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  gcgcaccacctcgtccatgttc 322
            ||||||||||||||||||||||
Sbjct: 1126 gcgcaccacctcgtccatgttc 1105

---

>dbj|AK071050.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023075J12, full
            insert sequence
          Length = 1688

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  gcgcaccacctcgtccatgttc 322
            ||||||||||||||||||||||
Sbjct: 1023 gcgcaccacctcgtccatgttc 1002

---

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 233     tcgccgggcttccagttggccg 254
               ||||||||||||||||||||||
Sbjct: 1045276 tcgccgggcttccagttggccg 1045255

---

>ref|XM_322365.1| Neurospora crassa OR74A predicted protein (NCU00280.1) partial mRNA
          Length = 2820

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  tcttcttggcctcctcgtcgg 206
            |||||||||||||||||||||
Sbjct: 2515 tcttcttggcctcctcgtcgg 2495

---

>ref|XM_952658.1| Neurospora crassa OR74A hypothetical protein (NCU00280.1) partial
            mRNA
          Length = 2820

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 186  tcttcttggcctcctcgtcgg 206
            |||||||||||||||||||||
Sbjct: 2515 tcttcttggcctcctcgtcgg 2495

---

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 215     ggcgcgatcaccacgcactcg 235
               |||||||||||||||||||||
Sbjct: 1724577 ggcgcgatcaccacgcactcg 1724557

---

>dbj|AB124932.1| Uncultured sulfate-reducing bacterium DsrA, DsrB genes for
            dissimilatory sulfite reductase alpha and beta subunit,
            partial cds, clone:SUIYO-10
          Length = 1919

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 123  tggtgaagcggaggtagccct 143
            |||||||||||||||||||||
Sbjct: 1443 tggtgaagcggaggtagccct 1423

---

>dbj|AB124920.1| Uncultured sulfate-reducing bacterium DsrA, DsrB genes for
            dissimilatory sulfite reductase alpha and beta subunit,
            partial cds, clone:NBC-6
          Length = 1918

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 123  tggtgaagcggaggtagccct 143
            |||||||||||||||||||||
Sbjct: 1442 tggtgaagcggaggtagccct 1422

---

>gb|AC090522.1|AC090522 Caenorhabditis briggsae cosmid CB015K23, complete sequence
          Length = 46455

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 43    acgcaccacaacgacacatac 63
             |||||||||||||||||||||
Sbjct: 46151 acgcaccacaacgacacatac 46171

---

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 185    atcttcttggcctcctcgtcggaga 209
              ||||||| |||||||||||||||||
Sbjct: 393715 atcttctcggcctcctcgtcggaga 393739

---

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 181     gaacatcttcttggcctcctcgtcg 205
               |||| ||||||||||||||||||||
Sbjct: 3415727 gaacttcttcttggcctcctcgtcg 3415751



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 143     ttcttggagggcaggtcggc 162
               ||||||||||||||||||||
Sbjct: 2474706 ttcttggagggcaggtcggc 2474725

---

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 185   atcttcttggcctcctcgtcggaga 209
             ||||||| |||||||||||||||||
Sbjct: 43396 atcttctcggcctcctcgtcggaga 43420

---

>gb|AC008337.8| Drosophila melanogaster clone BACR02B03, complete sequence
          Length = 169680

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   tcttcttggcctcctcgtcg 205
             ||||||||||||||||||||
Sbjct: 73175 tcttcttggcctcctcgtcg 73194

---

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 154    caggtcggcggtctcgaacc 173
              ||||||||||||||||||||
Sbjct: 254233 caggtcggcggtctcgaacc 254252

---

>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence
          Length = 183048

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   tcttcttggcctcctcgtcg 205
             ||||||||||||||||||||
Sbjct: 25388 tcttcttggcctcctcgtcg 25407

---

>ref|XM_965890.1| PREDICTED: Tribolium castaneum similar to Ran-specific
           GTPase-activating protein (Ran binding protein 1)
           (RanBP1) (LOC659598), mRNA
          Length = 504

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 187 cttcttggcctcctcgtcgg 206
           ||||||||||||||||||||
Sbjct: 456 cttcttggcctcctcgtcgg 437

---

>emb|BX248341.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
             8/14
          Length = 306050

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   cagttggccggggttgccac 264
             ||||||||||||||||||||
Sbjct: 36625 cagttggccggggttgccac 36606

---

>emb|BX248340.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
             7/14
          Length = 291050

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   cagttggccggggttgccac 264
             ||||||||||||||||||||
Sbjct: 74592 cagttggccggggttgccac 74573

---

>ref|NM_133148.2| Drosophila melanogaster CG8034-RA (CG8034), mRNA
          Length = 2080

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 186  tcttcttggcctcctcgtcg 205
            ||||||||||||||||||||
Sbjct: 1157 tcttcttggcctcctcgtcg 1138

---

>gb|AY069772.1| Drosophila melanogaster SD01508 full length cDNA
          Length = 2102

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 186  tcttcttggcctcctcgtcg 205
            ||||||||||||||||||||
Sbjct: 1157 tcttcttggcctcctcgtcg 1138

---

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 190     cttggcctcctcgtcggaga 209
               ||||||||||||||||||||
Sbjct: 2757662 cttggcctcctcgtcggaga 2757643

---

>gb|AE003511.4| Drosophila melanogaster chromosome X, section 63 of 74 of the complete
              sequence
          Length = 297969

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    tcttcttggcctcctcgtcg 205
              ||||||||||||||||||||
Sbjct: 228497 tcttcttggcctcctcgtcg 228516

---

>gb|M74438.1|GATATAT Gatrotheca riobambae 5S rRNA gene, complete sequence
          Length = 1052

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 274 tgccgccgtcagcagcgagtccac 297
           |||||||||||||||| |||||||
Sbjct: 818 tgccgccgtcagcagccagtccac 795


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,602,694
Number of Sequences: 3902068
Number of extensions: 2602694
Number of successful extensions: 55570
Number of sequences better than 10.0: 160
Number of HSP's better than 10.0 without gapping: 160
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54895
Number of HSP's gapped (non-prelim): 663
length of query: 514
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 491
effective length of database: 17,143,297,704
effective search space: 8417359172664
effective search space used: 8417359172664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---