>ref|XM_461620.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G02244g)
           partial mRNA
          Length = 3594

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 38  gttacatgttccaatggtaga 58
           |||||||||||||||||||||
Sbjct: 168 gttacatgttccaatggtaga 188

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
              hansenii
          Length = 2051428

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 38     gttacatgttccaatggtaga 58
              |||||||||||||||||||||
Sbjct: 159635 gttacatgttccaatggtaga 159615

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 290      cgatgacggcgcgccatgcc 309
                ||||||||||||||||||||
Sbjct: 26497391 cgatgacggcgcgccatgcc 26497410

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 290      cgatgacggcgcgccatgcc 309
                ||||||||||||||||||||
Sbjct: 26588714 cgatgacggcgcgccatgcc 26588733

>gb|AC079889.20| Oryza sativa chromosome 3 BAC OSJNBa0092M19 genomic sequence, complete
             sequence
          Length = 136712

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 290   cgatgacggcgcgccatgcc 309
             ||||||||||||||||||||
Sbjct: 20205 cgatgacggcgcgccatgcc 20224


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,189,582
Number of Sequences: 3902068
Number of extensions: 2189582
Number of successful extensions: 34069
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34027
Number of HSP's gapped (non-prelim): 42
length of query: 400
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 378
effective length of database: 17,147,199,772
effective search space: 6481641513816
effective search space used: 6481641513816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)